Mesoporous silica nanoparticle and application thereof in plant antivirus

Abstract

The invention relates to mesoporous silica nanoparticles and application thereof in plant antivirus, the mesoporous silica nanoparticles are used as a silica nano pesticide, and the particle size of the mesoporous silica nanoparticles is 110-120nm. The synthesis and preparation method is simple, the reaction condition is mild, the cost is low, and the mesoporous silica nanoparticles with good biological safety are obtained. The mesoporous silica nanoparticles can enhance the resistance of rice to southern rice black-streaked dwarf virus, which is shown as follows: after virus inoculation, the transcription level of a virus shell gene CP is obviously lower than that of rice sprayed with water after the mesoporous silica nanoparticles are sprayed; and the content of virus coat protein CP is obviously lower than that of rice sprayed with water. According to the invention, the effect of the mesoporous silica nanoparticles in regulating and controlling the plant virus resistance is confirmed for the first time, and a theoretical basis is provided for the application of nano materials in green prevention and control of plant virus diseases.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural disease-resistant drugs, in particular to mesoporous silicon dioxide nanoparticles and application thereof in plant anti-virus. Background Art

[0002] Viral diseases seriously threaten the safe production of rice and farmers' income in my country. Southern rice black-streaked dwarf virus (SRBSDV) was first discovered in Yangxi County, Guangdong Province, China in 2001. The virus is transmitted by the long-distance migratory pest white-backed planthopper in a persistent, proliferative and cyclical manner. It is an important viral disease that has seriously endangered rice production in my country and neighboring countries in the past decade. In 2020 and 2023, SRBSDV and its transmission vector white-backed planthopper were listed in the "List of Class I Crop Diseases and Insect Pests" by the Ministry of Agriculture and Rural Affairs of my country twice in a row. It is the only viral disease in the list. The prevention and control of insect-borne viral diseases requires both the control of the virus itself and the control of the transmission of the virus by the vector insects. The prevention and control strategies are complex and extremely difficult. At present, there is a shortage of antiviral germplasm resources for rice, and field prevention and control relies on traditional pesticides. Therefore, the development of new, environmentally friendly control agents is the basis for developing more efficient prevention and control of rice viral diseases.

[0003] In recent years, nanomaterials have become a hot topic in the research and development of biology. As a new type of material for green prevention of plant diseases and ensuring food security, it has become one of the research hotspots of green prevention of plant diseases in the current agricultural field. In modern agriculture, nanomaterials have broken through the harmfulness of traditional pesticides and have the advantages of low biological toxicity, environmental friendliness, high utilization rate and low cost. Among various nanomaterials, mesoporous silica has attracted widespread attention due to its large specific surface area, good stability and good biocompatibility. Studies have shown that applying mesoporous silica nanoparticles to crops such as wheat, sugarcane, mango, sorghum, rice and tomatoes can enhance the resistance of plants to pathogens. For example, mesoporous silica nanoparticles can enhance the resistance of rice to important fungal and bacterial diseases such as white blight and sheath blight, but there is no report on the control effect of nanomaterials on rice viral diseases. Summary of the invention

[0004] In order to overcome the above-mentioned shortcomings of the prior art, the object of the present invention is a mesoporous silica nanoparticle and its application in plant antiviral.

[0005] The technical solution adopted by the present invention to solve the technical problem is: a mesoporous silica nanoparticle, the particle size of the mesoporous silica nanoparticle is in the range of 110 to 120 nm, and the mesoporous silica nanoparticle comprises the following preparation steps:

[0006] S1. Add surfactant and water to the flask in sequence, control the reaction temperature in an oil bath, and start stirring;

[0007] S2, to the above reaction system, add triethanolamine (TEA), keep the reaction temperature in an oil bath, continue stirring, until all the solids in the reaction system are dissolved and mixed evenly, add tetraethyl orthosilicate (TEOS), keep the reaction temperature, continue stirring the reaction, centrifuge to remove the supernatant, wash the obtained solid with water and methanol respectively, repeat each three times, and obtain mesoporous silica nanoparticles composited with hexadecyltrimethylammonium chloride (CTAC) template;

[0008] S3, dispersing the mesoporous silica nanoparticles composited with the CTAC template obtained in step S2 with methanol, stirring the mixture evenly, adding concentrated hydrochloric acid to the reaction system, stirring the mixture vigorously, controlling the reaction temperature at 60° C. in an oil bath, introducing condensed water, and condensing and refluxing the mixture to remove the CTAC template;

[0009] S4. After collecting the above reaction system, the supernatant is removed by centrifugation, and the obtained solid is washed with water and methanol. After each step is repeated for multiple times, the obtained solid is further washed with water. After repeating for three times, mesoporous silica nanoparticles stored in the aqueous phase are obtained.

[0010] As a further improvement of the present invention: in step S1, the surfactant is cetyltrimethylammonium chloride (CTAC) with a mass fraction of 9% to 9.2%.

[0011] As a further improvement of the present invention: in step S1, an oil bath is used to maintain the reaction temperature at 93-97°C.

[0012] As a further improvement of the present invention: in step S2, after adding triethanolamine (TEA), the reaction system is fully stirred to completely dissolve the surfactant, and the reaction system becomes clear, transparent and colorless. The stirring time is 1 hour, and the generation of bubbles is avoided during the entire stirring process.

[0013] As a further improvement of the present invention: in step S2, the amount of triethanolamine (TEA) is 0.59-0.61 g, and the amount of tetraethyl orthosilicate (TEOS) is 15 mL.

[0014] As a further improvement of the present invention: in step S2, after adding tetraethyl orthosilicate (TEOS), the reaction temperature is maintained and the stirring reaction is continued for 1 hour; the reaction temperature is 93-97°C.

[0015] As a further improvement of the present invention: in step S3, the amount of mesoporous silica nanoparticles composited with CTAC template is 0.5 g, the amount of methanol is 80 mL, and the amount of concentrated hydrochloric acid is 4.5 mL.

[0016] As a further improvement of the present invention: in step S3, after adding concentrated hydrochloric acid to the reaction system, the system is vigorously stirred for 24 hours, and at the same time, the condensation reflux time is 48 hours.

[0017] The present invention also includes an application of mesoporous silica nanoparticles in plant anti-virus, wherein the mesoporous silica nanoparticles are applied as silica nanopesticides to crops by foliar spraying, and the crops are rice.

[0018] As a further improvement of the present invention: the plant viral disease is southern rice black-streaked dwarf virus SRBSDV.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: the present invention first discovered that the external application of spherical mesoporous silica nanoparticles significantly improved the resistance of plants to viruses; the present invention first confirmed through experiments that spherical mesoporous silica nanoparticles participate in regulating the tolerance of plants to viruses, and in view of the application of spherical mesoporous silica nanoparticles in virus resistance, it is determined that the nanomaterial has potential application value in regulating plant virus tolerance, and the present invention also provides a theoretical basis for the application of nanomaterials in green prevention and control of plant virus diseases. The present invention uses chemical synthesis, cell biology, biochemical experimental analysis and other methods to study the role of spherical mesoporous silica nanoparticles in improving rice resistance to SRBSDV infection, so as to deepen the understanding of spherical mesoporous silica nanoparticles in plant antiviral. The spherical mesoporous silica nanoparticles developed by the present invention have the advantages of simple preparation method, mild reaction conditions, low cost, good biosafety and eco-friendly environment; they have high application value in using nanomaterials to improve rice disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a transmission electron microscope image of the spherical mesoporous silica nanoparticles prepared in the present invention.

[0021] Figure 2 This is a symptom diagram of rice sprayed with water and spherical mesoporous silica nanoparticles after virus inoculation in an embodiment of the present invention.

[0022] Figure 3 It is the transcription level of the viral capsid gene CP after the rice sprayed with water and spherical mesoporous silica nanoparticles was inoculated with virus in the embodiment of the present invention.

[0023] Figure 4 It is the content of virus coat protein CP after the rice sprayed with water and spherical mesoporous silica nanoparticles is inoculated with virus in the example of the present invention. DETAILED DESCRIPTION

[0024] The principles and features of the present invention are described below in conjunction with the accompanying drawings and specific embodiments. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0025] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0026] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. Reagents not described in detail in this application are all conventional reagents and can be obtained from commercial channels; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.

[0027] In the present application, the term "gene" refers to a nucleic acid fragment that expresses a specific protein or functional RNA molecule, which may contain regulatory sequences preceding the coding sequence (5' non-coding region) and following the coding sequence (3' non-coding region).

[0028] In this application, the term "nucleic acid molecule" refers to a polymer of RNA or DNA, which is single-stranded or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleic acid molecules in the form of DNA polymers can be composed of one or more segments of cDNA, genomic DNA or synthetic DNA.

[0029] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes a plurality of such plants; reference to "a cell" includes one or more cells and equivalents thereof known to those skilled in the art, and so forth.

[0030] A "control", "control plant" or "control plant cell" provides a reference for determining phenotypic changes in a test plant or plant cell, where the genomic changes in the test plant or plant cell affect the gene of interest due to transformation, and the test plant or plant cell may be a transgenic plant or a progeny of a transgenic plant cell. For example, the control plant may have the same genetic background as the test plant, except for the genetic changes that caused the test plant or cell.

[0031] "Plant" includes whole plants, plant organs, plant tissues, seeds and plant cells and the progeny of the plant. Plant cells include, but are not limited to, cells from the following materials: seeds, suspension cultures, embryos, meristematic regions, callus, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.

[0032] "Progeny" includes any subsequent generation of a plant.

[0033] "Polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers that optionally contain synthetic, non-natural or altered nucleotide bases. Nucleotides (usually in their 5'-monophosphate form) are referred to by their single letter names as follows: "A" is adenylic acid or deoxyadenylic acid (RNA or DNA, respectively), "C" represents cytidylic acid or deoxycytidylic acid, "G" represents guanylic acid or deoxyguanylic acid, "U" represents uridylic acid, "T" represents deoxythymidylic acid, "R" represents a purine (A or G), "Y" represents a pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "I" represents inosine, and "N" represents any nucleotide.

[0034] Viral diseases, especially southern rice black-streaked dwarf virus (SRBSDV), pose a huge threat to rice production, especially in the southern region. As the vector of the virus, the migratory and transmission characteristics of the white-backed planthopper make prevention and control work face great challenges, especially in the prevention and control of insect-borne viruses, which requires both controlling the virus itself and effectively suppressing the vector insects to form a double line of defense.

[0035] With the improvement of agricultural environmental protection requirements, the traditional chemical pesticides for rice disease control are gradually restricted, and green control strategies are becoming the direction of development. Nanomaterials, especially mesoporous silica, are gradually attracting attention due to their unique physical and chemical properties. Mesoporous silica has the advantages of large specific surface area, good biocompatibility and low toxicity. These properties make it show good potential in plant disease control, especially in enhancing plant disease resistance. Studies have shown that it can effectively improve the ability of crops to resist fungal and bacterial diseases.

[0036] Although the research on mesoporous silica nanoparticles in the prevention and control of rice virus diseases is not sufficient, combined with its effect on the prevention and control of other crop diseases, its application in virus prevention and control can be further explored in the future. As a new type of green control agent, nanomaterials can effectively reduce environmental pollution and provide a feasible new way for the prevention and control of rice virus diseases, especially for SRBSDV, a virus transmitted by insects, the innovation of its prevention and control strategy is particularly important.

[0037] Examples

[0038] The following are examples of specific embodiments of certain aspects of the present invention. The examples provided are for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

[0039] Implementation Case 1:

[0040] Mesoporous silica nanoparticles (MSN) were prepared by the following steps: 20 g of hexadecyltrimethylammonium chloride (CTAC) and 200 mL of water were added to a 500 mL flask in sequence, stirring was started, the reaction temperature was controlled at 95°C using an oil bath, 0.60 g of triethanolamine (TEA) was added to the reaction system, the reaction temperature was maintained constant, stirring was continued for 1 h, and after all the solids were dissolved and mixed, 15 mL of tetraethyl orthosilicate (TEOS) was added, the reaction temperature was continued to be maintained at 95°C using an oil bath, stirring was continued for 1 h, the supernatant was removed by centrifugation, the obtained solid was washed with water and methanol respectively, and each was repeated three times to obtain mesoporous silica nanoparticles composited with CTAC. 0.5 g of mesoporous silica nanoparticles composited with CTAC were dispersed in 80 mL of methanol and stirred evenly. Then, 4.5 mL of concentrated hydrochloric acid was added to the reaction system. After vigorous stirring for 24 h, the reaction temperature was controlled to 60 ° C using an oil bath, and condensed water was introduced. The condensation reflux was performed for 48 h to remove the CTAC template. After that, the supernatant was removed by centrifugation, and the obtained solid was washed with water and methanol. After each of the steps was repeated several times, the obtained solid was continued to be washed with water. After repeating three times, mesoporous silica nanoparticles (MSN) stored in the aqueous phase were obtained.

[0041] Implementation Case 2:

[0042] The disease resistance of spherical mesoporous silica nanoparticles to southern rice black-streaked dwarf disease was tested after spraying rice.

[0043] 1. Virus inoculation of rice seedlings

[0044] The SRBSDV virus source used in the present invention was collected by our laboratory from the rice-growing areas in southern China, and after being confirmed to be infected with SRBSDV by RT-PCR detection, it was planted and preserved in the experimental field.

[0045] The transmission medium white-backed planthoppers used in the present invention are all collected from the field by this laboratory, and then undergo long-term multiplication and subculture. The white-backed planthoppers are raised in an artificial climate incubator with a temperature of 25°C±1°C, a relative humidity of 70%±5%, and 16h light / 8h dark.

[0046] Rice was sown, and when the seedlings grew to the 3-4 leaf stage, 0.1 mg / ml MSNs were sprayed on the rice leaves once a day. After spraying once, the white-backed planthoppers carrying SRBSDV that had passed the cycle period were placed on the rice for feeding at a ratio of 2 per plant; the white-backed planthoppers were removed 2-3 days after inoculation, and the inoculated rice was transplanted and cultured in an artificial climate incubator. After 10 days, the virus rate of rice could be detected by RT-PCR. Symptom pictures were taken 5 days later. The symptom picture results were as follows: Figure 3 The results showed that the growth of diseased plants sprayed with 0.1 mg / ml mesoporous silica nanoparticles was significantly better than that of the control group sprayed with water.

[0047] 2. Determination of the transcription level of the viral capsid gene CP in the control strain and the strain sprayed with mesoporous silica nanoparticles after virus inoculation.

[0048] Fifteen days after virus inoculation, RNA was extracted from rice leaves, and the expression of the virus capsid CP gene was detected by RT-qPCR experiment. The primers used in the RT-qPCR experiment were (5'-3'):

[0049] SRBSDV CP-QF CGCGTCATCTCAAACTACAG;

[0050] SRBSDV CP-QRTTTGTCAGCATCTAAAGCGC.

[0051] The results are as follows Figure 4 The results showed that the transcription level of the viral coat gene CP in rice sprayed with 0.1 mg / ml mesoporous silica nanoparticles was significantly lower than that in the control group sprayed with water. * and ** represent significant differences between the mutant and the wild type (* indicates p<0.05; ** indicates p<0.01).

[0052] 3. Determination of virus capsid protein CP of the control strain and the MSNs sprayed strain after virus inoculation.

[0053] 15 days after virus inoculation, rice leaves were taken to extract proteins. The results were as follows Figure 4 The results of protein immunoblotting showed that the content of viral capsid protein CP in rice sprayed with 0.1 mg / ml mesoporous silica nanoparticles was significantly lower than that in the control group sprayed with water.

[0054] The main functions of the present invention are:

[0055] The present invention provides mesoporous silica nanoparticles with simple synthesis and preparation methods, mild reaction conditions, low cost and good biosafety. The obtained nanomaterials significantly improve the resistance of rice to southern rice black-streaked dwarf virus. The present invention experimentally confirms for the first time the role of mesoporous silica nanoparticles in regulating plant virus tolerance. Based on the application of mesoporous silica nanoparticles in plant virus resistance, it can be considered that the nanomaterial has potential application value in regulating plant response to viral stress. The present invention also provides a theoretical basis for the application of nanomaterials in green prevention and control of plant viral diseases.

[0056] In summary, after reading the present invention document, ordinary technicians in this field can make various other corresponding transformation schemes based on the technical scheme and technical concept of the present invention without creative mental work, which all fall within the scope of protection of the present invention.

Claims

1. A mesoporous silica nanoparticle, characterized in that: The particle size of the mesoporous silica nanoparticles ranges from 110 to 120 nm, and the mesoporous silica nanoparticles include the following preparation steps: S1. Add surfactant and water to the flask in sequence, control the reaction temperature in an oil bath, and start stirring; S2, adding triethanolamine to the above reaction system, maintaining the reaction temperature in an oil bath, and continuing to stir until all the solids in the reaction system are dissolved and mixed evenly, adding tetraethyl orthosilicate, maintaining the reaction temperature, continuing to stir the reaction, centrifuging to remove the supernatant, washing the obtained solid with water and methanol respectively, and repeating each three times to obtain mesoporous silica nanoparticles composited with hexadecyltrimethylammonium chloride (CTAC) template; S3, dispersing the mesoporous silica nanoparticles composited with the CTAC template obtained in step S2 with methanol, stirring the mixture evenly, adding concentrated hydrochloric acid to the reaction system, stirring the mixture vigorously, controlling the reaction temperature at 60° C. in an oil bath, introducing condensed water, and condensing and refluxing the mixture to remove the CTAC template; S4. After collecting the above reaction system, the supernatant is removed by centrifugation, and the obtained solid is washed with water and methanol. After each step is repeated for multiple times, the obtained solid is further washed with water. After repeating for three times, mesoporous silica nanoparticles stored in the aqueous phase are obtained.

2. A mesoporous silica nanoparticle according to claim 1, characterized in that In step S1, the surfactant is hexadecyltrimethylammonium chloride, and the mass fraction is 9% to 9.2%.

3. A mesoporous silica nanoparticle according to claim 2, characterized in that: In step S2, after adding triethanolamine, the reaction system is fully stirred to completely dissolve the surfactant and the reaction system becomes clear, transparent and colorless. The stirring time is 1 hour.

4. A mesoporous silica nanoparticle according to claim 1, characterized in that: In step S2, the amount of triethanolamine used is 0.59-0.61 g, and the amount of ethyl orthosilicate is 15 mL.

5. A mesoporous silica nanoparticle according to claim 4, characterized in that: In step S2, after adding ethyl orthosilicate, the reaction temperature is maintained and the stirring reaction is continued for 1 hour; the reaction temperature is 93-97°C.

6. A mesoporous silica nanoparticle according to claim 1, characterized in that: In step S3, the amount of mesoporous silica nanoparticles composited with CTAC template is 0.5 g, the amount of methanol is 80 mL, and the amount of concentrated hydrochloric acid is 4.5 mL.

7. A mesoporous silica nanoparticle according to claim 6, characterized in that: In step S3, concentrated hydrochloric acid is added to the reaction system and then vigorously stirred for 24 hours. Meanwhile, the condensation reflux time is 48 hours.

8. Application of mesoporous silica nanoparticles in plant antiviral treatment, characterized in that: The mesoporous silica nanoparticles according to any one of claims 1 to 7 are applied to crops by foliar spraying as silica nanopesticides, wherein the crops are rice.

9. The use of mesoporous silica nanoparticles in plant antiviral treatment according to claim 8, characterized in that: The plant viral disease is southern rice black-streaked dwarf virus.

Images