Application of alfalfa NACsa3 protein in cultivation of salt-tolerant plants

Abstract

The invention discloses an application of alfalfa NACsa3 protein in cultivation of salt-tolerant plants. The protein provided by the invention is named as MtNACsa3 protein, is derived from medicago truncatula, and is the protein as shown in SEQ ID NO: 1. The invention also provides a biological material related to the MtNACsa3 protein. The invention also protects a method for cultivating the plant with improved salt tolerance, and the method comprises the following step: introducing the MtNACsa3 protein related biological material into a receptor plant to obtain the transgenic plant with improved salt tolerance. The invention also protects a method for cultivating the plant with reduced salt tolerance, and the method comprises the following steps: inhibiting the expression of the nucleic acid molecule for coding the MtNACsa3 protein in the target plant to obtain the transgenic plant with reduced salt tolerance. The invention provides important normal forms and gene resources for cultivating salt-tolerant plant varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of alfalfa NACsa3 protein in cultivating salt-tolerant plants. Background Art

[0002] Soil salinization is a global problem that limits land use and crop production.

[0003] In-depth research and exploration of plant salt-tolerance-related genes is crucial to understanding how plants resist salt stress. Using plant genetic engineering technology to enhance plant resistance to salt stress can reduce the dependence of food production on environmental conditions, increase food output under salt stress environments, and ultimately benefit mankind.

[0004] Alfalfa is the fourth most important economic crop in the world and a key source of feed. Research on the key regulatory genes of alfalfa salt tolerance will provide valuable genetic resources for breeding plant varieties with more salt-tolerant characteristics. Summary of the invention

[0005] The purpose of the present invention is to provide application of alfalfa NACsa3 protein in cultivating salt-tolerant plants.

[0006] The protein provided by the present invention, named MtNACsa3 protein, is derived from Medicago truncatula ( Medicago truncatula ), is as follows (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to plant salt tolerance obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1); (a4) A protein derived from alfalfa that has more than 98% identity with (a1) and is associated with plant salt tolerance.

[0007] Exemplarily, the tag may be a Poly-Arg tag, a Poly-His tag, a FLAG tag, a Strep-tag II tag, a c-myc tag, or the like.

[0008] The present invention also provides a MtNACsa3 protein-related biomaterial, which is any one of the following (b1) to (b4): (b1) a nucleic acid molecule encoding the MtNACsa3 protein; (b2) an expression cassette containing the nucleic acid molecule described in (b1); (b3) a recombinant vector containing the nucleic acid molecule described in (b1) or a recombinant vector containing the expression cassette described in (b2); (b4) A recombinant microorganism containing the nucleic acid molecule described in (b1), a recombinant microorganism containing the expression cassette described in (b2), or a recombinant microorganism containing the recombinant vector described in (b3).

[0009] The nucleic acid molecule encoding the MtNACsa3 protein may specifically be a gene encoding the MtNACsa3 protein.

[0010] Specifically, the gene encoding the MtNACsa3 protein is as follows (c1) or (c2) or (c3) or (c4) or (c5): (c1) a DNA molecule having a coding region as shown in SEQ ID NO: 2; (c2) the DNA molecule shown at positions 178 to 1630 in SEQ ID NO: 3; (c3) a DNA molecule represented by SEQ ID NO: 3; (c4) a DNA molecule derived from alfalfa and having more than 95% identity with (c1) or (c2) or (c3) and encoding the protein; (c5) A DNA molecule that hybridizes to the nucleotide sequence defined in (c1) or (c2) or (c3) under stringent conditions and encodes the protein.

[0011] The stringent conditions may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0012] Exemplarily, the recombinant vector may be: the double-stranded DNA molecule shown at positions 1 to 864 in SEQ ID NO: 6 is used to replace the Sal I and XB I restriction enzyme cutting site to obtain the recombinant plasmid.

[0013] Exemplarily, the recombinant vector may be: the double-stranded DNA molecule shown in SEQ ID NO: 6 is used to replace the pEarleyGate100 vector XOt I and Spe I restriction enzyme cutting site to obtain the recombinant plasmid.

[0014] Exemplarily, the recombinant microorganism may be a recombinant Agrobacterium obtained by introducing the recombinant vector into Agrobacterium EHA105.

[0015] The present invention also protects the use of MtNACsa3 protein or nucleic acid molecules encoding MtNACsa3 protein in regulating plant salt tolerance.

[0016] The regulation is positive regulation.

[0017] Increased abundance of MtNACsa3 protein increases plant salt tolerance.

[0018] The increased abundance of nucleic acid molecules encoding MtNACsa3 protein increases the salt tolerance of plants.

[0019] Reduced abundance of MtNACsa3 protein reduces plant salt tolerance.

[0020] Reduced abundance of nucleic acid molecules encoding MtNACsa3 protein reduces plant salt tolerance.

[0021] The invention also protects the use of the protein-related biological material in cultivating transgenic plants with improved salt tolerance.

[0022] The present invention also protects a method for cultivating plants with improved salt tolerance, comprising the following steps: introducing MtNACsa3 protein-related biological materials into a recipient plant to obtain a transgenic plant with improved salt tolerance.

[0023] The present invention also protects a method for cultivating plants with improved salt tolerance, comprising the following steps: increasing the content of MtNACsa3 protein in the plants to obtain plants with improved salt tolerance.

[0024] The present invention also protects the use of MtNACsa3 protein or a nucleic acid molecule encoding MtNACsa3 protein as an inhibition target in cultivating plants with reduced salt tolerance.

[0025] The present invention also protects a method for cultivating plants with reduced salt tolerance, comprising the following steps: inhibiting the expression of a nucleic acid molecule encoding the MtNACsa3 protein in a target plant to obtain a transgenic plant with reduced salt tolerance.

[0026] Inhibiting the expression of the nucleic acid molecule encoding the MtNACsa3 protein in the target plant can be achieved by introducing a substance that inhibits the nucleic acid molecule encoding the MtNACsa3 protein into the target plant. The substance that inhibits the nucleic acid molecule encoding the MtNACsa3 protein can be specifically: a gene editing vector targeting the nucleic acid molecule encoding the MtNACsa3 protein. The gene editing vector expresses the Cas9 protein and sgRNA. The target of the sgRNA is located in the nucleic acid molecule encoding the MtNACsa3 protein.

[0027] Exemplarily, the substance that inhibits the nucleic acid molecule encoding the MtNACsa3 protein can be the following recombinant plasmid: the segment shown in SEQ ID NO: 5 in the p6401 vector is replaced with the DNA molecule shown in SEQ ID NO: 4, while keeping other sequences unchanged, to obtain a recombinant plasmid.

[0028] The present invention also provides a method for cultivating plants with reduced salt tolerance, comprising the following steps: reducing the content of MtNACsa3 protein in the plants to obtain plants with reduced salt tolerance.

[0029] The present invention also protects the use of any of the above methods in plant breeding.

[0030] The goal of plant breeding is to create plants with improved salt tolerance.

[0031] The goal of plant breeding is to create plants with reduced salt tolerance.

[0032] The improved salt tolerance is reflected in the increased seed germination rate under salt stress.

[0033] The improved salt tolerance is reflected in the increase of the biomass of the aboveground part of the plant under salt stress.

[0034] The reduced salt tolerance is reflected in a reduced seed germination rate under salt stress.

[0035] The reduced salt tolerance is reflected in the reduction of the aboveground biomass of the plant under salt stress.

[0036] The salt tolerance can also be called resistance to salt stress.

[0037] The cause of the salt stress may specifically be that the soil contains 100 mM-200 mM NaCl.

[0038] Any of the above plants is a leguminous plant.

[0039] Any of the above plants is a plant of the genus Alfalfa.

[0040] Any of the above plants is Medicago truncatula.

[0041] Any of the above plants is of Medicago truncatula R108 ecotype.

[0042] Any of the above plants is alfalfa.

[0043] Any of the above plants is Alfalfa Zhongmu No. 1.

[0044] The present invention discloses a plant salt tolerance-related protein MtNACsa3, its encoding gene and application. Overexpression of MtNACsa3 in alfalfa and alfalfa truncatula can significantly improve the salt tolerance of plants; knocking out or knocking down MtNACsa3 using genome editing technology can significantly reduce the salt tolerance of plants. The present invention provides an important paradigm and gene resources for breeding salt-tolerant plant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1Schematic diagram of the element structure of the recombinant plasmid p6401-MtNACsa3.

[0046] Figure 2 Schematic diagram of the elements of the recombinant plasmid pCAMBIA1307-MtNACsa3.

[0047] Figure 3 For Example 3 MtNACsa3 Results of relative transcription levels of genes.

[0048] Figure 4 Schematic diagram of the elements of the recombinant plasmid pEarleyGate100-MtNACsa3.

[0049] Figure 5 These are the results of the relative transcription level of the MtNACsa3-GFP gene in Example 4.

[0050] Figure 6 This is the result of step 1 of Example 5.

[0051] Figure 7 This is the result of step 2 of Example 5.

[0052] Figure 8 This is the result of step three of Example 5. DETAILED DESCRIPTION

[0053] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0054] The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are set up for three repeated experiments, and the results are averaged. In the examples, the significance analysis was performed using SPSS software ANOVA Tukey's post-hoc test, * represents P<0.05, ** represents P<0.01, and *** represents P<0.001. Unless otherwise specified, the meaning of light and dark alternation is 16h light / 8h dark. Culture matrix: obtained by mixing 5 parts by volume of vermiculite and 2 parts by volume of perlite. MURASHIGE&SKOOG (MS) BASAL MEDIUM: Phyto Technology Laboratories, product catalog number is M519.

[0055] The wild type Medicago truncatula used in the examples is Medicago truncatula R108 (represented by WT). The wild type alfalfa in the examples refers to alfalfa Zhongmu 1 (represented by ZM1).

[0056] The p6401 vector (i.e., "the binary vector p6401" in the literature) is described in the following literature: Ye Q, Zheng L, Liu P, et al. The S-acylation cycle of transcription factor MtNAC80 influences cold stress responses in Medicago truncatula. Plant Cell. 2024;36(7):2629-2651. doi:10.1093 / plcell / koae103. Sequencing confirmed that the p6401 vector contains the segment shown in SEQ ID NO: 5.

[0057] The vector pCAMBIA1307 (i.e., “pCAMBIA1307 empty vector” in the literature) is described in the following literature: Zhu F, Deng J, Chen H, Liu P, Zheng L, Ye Q, Li R, Brault M, Wen J, FrugierF, Dong J, Wang T. A CEP peptide receptor-like kinase regulates auxinbiosynthesis and ethylene signaling to coordinate root growth and symbioticnodulation in Medicago truncatula. The Plant Cell, Vol. 32: 2855–2877, September 2020. doi: 10.1105 / tpc.20.00248.

[0058] The formula of SH3a liquid medium (1L) is: 100mL of 10×N6 macromolecular solution, 1mL of 1000×SH micromolecular solution, 1mL of 1000×SH organic solution, 20mL of 50×EDFS iron salt solution, 0.4mL of 2,4-D stock solution, 0.5mL of 6-BAP stock solution, 100mg of inositol, 30g of sucrose, and the balance is water; pH 5.85. Compared with SH3a liquid medium, the only difference of SH3a solid medium is the addition of 3.2g of plant gel per liter.

[0059] The formula of SH9 liquid medium (1L) is: 100mL of 10×N6 macromolecular solution, 1mL of 1000×SH micromolecular solution, 1mL of 1000×SH organic solution, 20mL of 50×EDFS iron salt solution, 100mg of inositol, 20g of sucrose, and the balance is water; pH 5.85. Compared with SH9 liquid medium, the only difference of SH9 solid medium is the addition of 8g of agar per liter.

[0060] The formula of SM4 liquid medium (1L): MURASHIGE&SKOOG (MS) BASAL MEDIUM 4.43g, 2,4-D stock solution 0.4mL, 6-BAP stock solution 0.2mL, sucrose 30g, the balance is water; pH 5.85. Compared with SM4 liquid medium, the difference of SM4 solid medium is only the increase of 3.2g of plant gel per liter.

[0061] The formula of MSBK liquid medium (1L): MURASHIGE&SKOOG (MS) BASAL MEDIUM 4.43g, kinetin solution 1mL, 6-BAP stock solution 0.5mL, sucrose 30g, the balance is water; pH 5.85. Compared with MSBK liquid medium, the difference of MSBK solid medium is only the increase of 3.2g of plant gel per liter.

[0062] The formula of 1 / 2 MS liquid medium (1L): MURASHIGE&SKOOG (MS) BASAL MEDIUM 2.22g, sucrose 12g, the balance is water; pH 5.85. Compared with 1 / 2 MS liquid medium, the difference of 1 / 2 MS solid medium is only the increase of 8g agar per liter.

[0063] The formula of 10×N6 bulk mother liquor (1L) is: MgSO4·7H2O 1.85g, KNO3 28.3g, (NH4)2SO4 4.63g, CaCl2·2H2O 1.66g, KH2PO4 4g, and the balance is water.

[0064] The formula of 1000×SH trace mother solution (100 mL): MnSO4·H2O 1 g, H3BO3 500 mg, ZnSO4·7H2O 100 mg, KI 100 mg, Na2MoO4·2H2O 10 mg, CuSO4·5H2O 20 mg, CoCl2·6H2O 10 mg, and the balance is water.

[0065] The formula of 1000×SH organic mother solution (100 mL): niacin 500 mg, pyridoxine hydrochloride 500 mg, thiamine hydrochloride 500 mg, and the balance is water.

[0066] The formula of 50×EDFS iron salt mother solution (500 mL) is: NaFe·EDTA 3.487 g, the balance is water.

[0067] 2,4-D stock solution: contains 10 mg / mL 2,4-D, the balance is water.

[0068] 6-BAP stock solution: contains 1 mg / mL 6-BAP, the balance is water.

[0069] Kinetin solution: contains 1 mg / mL kinetin, the balance is water.

[0070] Example 1, MtNACsa3 protein and MtNACsa3 Discovery of genes From Medicago truncatula ( Medicago truncatula ) was found in the wild, named MtNACsa3 protein, as shown in SEQ ID NO: 1 (288aa). The gene encoding MtNACsa3 protein is named MtNACsa3 Gene. In the cDNA of Medicago truncatula, the open reading frame encoding the MtNACsa3 protein is shown in SEQ ID NO: 2 (867 bp). In the genomic DNA of Medicago truncatula, the gene encoding the MtNACsa3 protein is shown in SEQ ID NO: 3 (1630 bp).

[0071] Example 2, Preparation mtnacsa3 Medicago truncatula 1. Construction of the gene editing binary vector p6401-MtNACsa3 Construction of a Medicago truncatula genomic DNA MtNACsa3 Gene editing binary vector with the gene as the target gene.

[0072] 1. The two targets selected are as follows: Target 1 (SEQ ID NO: 7): 5′-CCGAGCTTCAATTGCCACC-3′; Target 2 (SEQ ID NO: 8): 5'-CACACCGATTCGAGCTGTT-3'.

[0073] In SEQ ID NO: 2, nucleotides 8-26 are target 1, and nucleotides 661-679 are target 2. In SEQ ID NO: 3, nucleotides 185-203 are target 1, and nucleotides 1424-1442 are target 2.

[0074] 2. Construct recombinant plasmid p6401-MtNACsa3.

[0075] The segment shown in SEQ ID NO: 5 in the p6401 vector was replaced with the DNA molecule shown in SEQ ID NO: 4, and the other sequences were kept unchanged to obtain the recombinant plasmid p6401-MtNACsa3. The schematic diagram of the element structure of the recombinant plasmid p6401-MtNACsa3 is shown in Figure 1 The recombinant plasmid p6401-MtNACsa3 is a circular double-stranded DNA (16316 bp). In SEQ ID NO: 4, nucleotides 528-622 encode sgRNA1 (whose target sequence binding region is directed to target 1), and nucleotides 1316-1410 encode sgRNA2 (whose target sequence binding region is directed to target 2).

[0076] 2. Medicago truncatula mtnacsa3 Acquisition of mutants 1. Introduce the recombinant plasmid p6401-MtNACsa3 into Agrobacterium EHA105 to obtain recombinant Agrobacterium.

[0077] 2. The recombinant Agrobacterium obtained in step 1 was inoculated into YEP liquid medium containing 75 mg / L rifampicin and 50 mg / L kanamycin, and cultured at 28°C and 230 rpm until OD 600nm The value was 0.6-0.8, and then the mixture was centrifuged at room temperature and 5000 rpm for 10 min. The bacterial precipitate was collected and resuspended with an equal volume of SH3a liquid culture medium containing 0.1 mM acetosyringone to obtain the infection solution.

[0078] 3. Take wild-type Medicago truncatula seeds, treat them with 98% H2SO4 solution for 8 minutes, then rinse them with deionized water for 3 times, and then disinfect them with 0.5% NaClO aqueous solution containing 0.1% TritonX100 for 12 minutes, and then rinse them with sterile water; then spread the seeds on 0.8% water agar plates and culture them upside down in the dark at 4°C for 3 days, and then culture them upside down at room temperature away from light for 12 hours; then place the germinated seeds on 1 / 2 MS solid culture medium and culture them at 22°C with alternating light and dark for 3-4 weeks; then take the fully expanded leaves, immerse the leaves with sterile water, and cut them into 2-4 pieces with a knife to form explants.

[0079] 4. Immerse the explants prepared in step 3 in the infection solution prepared in step 2, evacuate to -0.09 MPa and maintain for 30 min, then slowly release the air; then place in a horizontal shaker at 60 rpm and culture in the dark for 1.5 h; then take out the explants, spread them on SH3a solid culture medium containing 0.1 mM acetosyringone covered with a single layer of filter paper, and culture at 22°C in the dark for 3 days.

[0080] 5. After completing step 4, transfer the explants to SH3a solid medium containing 10 mg / L hygromycin B and 200 mg / L timentin and culture at 22°C in the dark. Subculture every 2 weeks for a total of 6 weeks.

[0081] 6. After completing step 5, transfer the callus to SH9 solid medium containing 10 mg / L hygromycin B and 120 mg / L timentin, and culture at 22°C with alternating light and dark. Subculture once every 3 weeks until regenerated shoots are obtained.

[0082] 7. Transfer the regenerated seedlings obtained in step 6 to 1 / 2 MS solid medium and culture them at 22°C with alternating light and dark. Subculture every 3-4 weeks until the plants take root, which are T0 generation plants. Number each T0 generation plant in sequence, which will be used as the strain number later.

[0083] 8. Transfer the T0 generation plants to the culture medium, cover with plastic wrap to keep moisture for 5 days, then remove the film and culture in the greenhouse. Greenhouse conditions: 22℃, 16h light / 8h dark, humidity 70%-80%.

[0084] 9. The T0 generation plants are self-pollinated and the seeds are harvested. The plants grown from the seeds are the T1 generation plants. The T1 generation plants are self-pollinated and the seeds are harvested. The plants grown from the seeds are the T2 generation plants.

[0085] 3. Molecular Identification Take the leaves of the T2 generation plants obtained in step 2 or the leaves of the wild-type Medicago truncatula plants, and extract genomic DNA respectively. Using genomic DNA as a template, use primer pair 1 composed of MtNACsa3-F0 and MtNACsa3-R0 (the target sequence is located in the backbone part of the recombinant plasmid, which is 812 bp), primer pair 2 composed of MtNACsa3-F1 and MtNACsa3-R1 (the target sequence is located around target site 1 in the genome of the wild-type Medicago truncatula plant, which is 592 bp), and primer pair 3 composed of MtNACsa3-F2 and MtNACsa3-R2 (the target sequence is located around target site 2 in the genome of the wild-type Medicago truncatula plant, which is 432 bp) for PCR amplification. Screen plants that have no amplification product using primer pair 1 (i.e., the recombinant plasmid is removed during selfing), amplification products obtained using primer pair 2, and amplification products obtained using primer pair 3, and recover the PCR amplification products and sequence them.

[0086] According to the sequencing results, two mutant strains were screened from the T2 generation plants and named mtnacsa3 -L1 mutants and mtnacsa3 -L2 mutant. Compared with wild-type Medicago truncatula plants, MtNACsa3 Compared with genes, mtnacsa3-L1 mutant strain had the following mutation: "ATGGCATCCGAGCTTCAATTGCCACCGGG" (SEQ ID NO: 23) mutated to "ATGGCATCCGAGCTTCAATTGCCCACCGGG" (SEQ ID NO: 24), and the mutation was homozygous (i.e., a pair of homologous chromosomes had the same mutation), and no other mutation occurred. MtNACsa3 Compared with genes, mtnacsa3 The following mutations occurred in the genome of the -L2 mutant strain: "ATGGCATCCGAGCTTCAATTGCCACCGGG" (SEQ ID NO: 23) mutated to "ATGGCATCCGAGCTTCAATTGCCCACCGGG" (SEQ ID NO: 24) and "GCTGCACACCGATTCGAGCTGTTCGGAA" (SEQ ID NO: 25) mutated to "GCTGCACACCGATTGTTCGGAA" (SEQ ID NO: 26). All mutations were homozygous (i.e., a pair of homologous chromosomes underwent the same mutation), and no mutations occurred in other parts.

[0087] Example 3: Preparation of MtNACsa3 overexpressing transgenic Medicago truncatula 1. Construction of pCAMBIA1307- MtNACsa3 plant overexpression vector The double-stranded DNA molecule shown at positions 1 to 864 in SEQ ID NO: 6 was used to replace the DNA in the vector pCAMBIA1307. Sal I and XB I restriction site, keeping other sequences unchanged, to obtain the recombinant plasmid pCAMBIA1307-MtNACsa3. In the recombinant plasmid pCAMBIA1307-MtNACsa3, the inserted foreign DNA molecule and part of the nucleotides on the vector backbone form the fusion gene shown in SEQ ID NO: 6. In SEQ ID NO: 6, positions 1-864 encode the MtNACsa3 protein, and positions 871-1626 encode the GFP protein. The recombinant plasmid pCAMBIA1307-MtNACsa3 has been sequenced and verified. The schematic diagram of the elements of the recombinant plasmid pCAMBIA1307-MtNACsa3 is shown in Figure 2 .

[0088] 2. Preparation of MtNACsa3-overexpressing transgenic Medicago truncatula 1. Introduce the recombinant plasmid pCAMBIA1307-MtNACsa3 into Agrobacterium EHA105 to obtain recombinant Agrobacterium.

[0089] 2. Same as step 2 of Example 2.

[0090] 3. Same as step 3 of step 2 in Example 2.

[0091] 4. Same as step 4 of step 2 in Example 2.

[0092] 5. Same as step 5 of step 2 in embodiment 2.

[0093] 6. Same as step 6 of step 2 in Example 2.

[0094] 7. Same as 7 of step 2 in Example 2.

[0095] 8. Same as 8 of step 2 of Example 2. Take leaves of T0 generation plants, extract genomic DNA and perform PCR identification (same method as 1 of step 3) to screen transgenic plants.

[0096] 9. Self-pollinate the T0 transgenic plants and harvest the seeds. The plants grown from the seeds are the T1 plants. Take the leaves of the T1 plants, extract the genomic DNA and perform PCR identification (the method is the same as step 3, 1) to screen the transgenic plants.

[0097] 10. The T1 transgenic plants are self-pollinated and seeds are harvested. The plants grown from the seeds are the T2 plants. Sample the T2 plants, take leaves, extract genomic DNA and perform PCR identification (the method is the same as step 3, 1). If all the T2 plants obtained from the self-pollination of a T1 plant are transgenic plants, then the T1 plant is a homozygous transgenic plant, and the self-pollinated offspring of the T1 plant is a transgenic strain. Multiple transgenic strains were obtained (using MtNACsa3 OE-N, N is a natural number).

[0098] 11. The T2 generation plants of each transgenic line are self-pollinated and the seeds are harvested. The plants grown from the seeds are the T3 generation plants.

[0099] 3. Molecular Identification Test plants: T3 plants of each transgenic line obtained in step 2 or wild-type Medicago truncatula plants.

[0100] 1. PCR identification Take the leaves of the test plant and extract genomic DNA. Use the genomic DNA as a template and use the primer pair consisting of pCAMBIA1307-MtNACsa3-F and GFP-R for PCR amplification, and then perform agarose gel electrophoresis. If an amplification product of about 983bp is displayed, the PCR identification result is positive and the test plant is a transgenic plant.

[0101] 2. RNA level identification Take the leaves of the test plants, extract total RNA, and reverse transcribe to obtain cDNA. MtActin4A The gene was used as an internal reference gene and detected by RT-qPCR MtNACsa3 The transcription level of the gene was measured by MtNACsa3 The gene transcription level was used as reference 1 to calculate the MtNACsa3 Relative transcription levels of genes.

[0102] For detection MtNACsa3 Primers for the gene: MtNACsa3-RT-F and MtNACsa3-RT-R.

[0103] For detection MtActin4A Primers for the gene: MtActin4A-RT-F and MtActin4A-RT-R.

[0104] Results Figure 3 (The vertical axis is MtNACsa3 relative transcription level of genes).

[0105] 3. Protein level identification Take the leaves of the tested plants, extract the total protein, perform SDS-PAGE gel electrophoresis, and then transfer the protein to cellulose acetate membrane for immunoblotting hybridization. The primary antibody is: GFP-Tag Mouse mAb. The secondary antibody is: peroxidase-labeled goat anti-mouse IgG. MtNACsa3 OE-9 strain plants and MtNACsa3 All OE-13 strains showed a target band of approximately 60 kDa and were immunoblot positive.

[0106] Example 4: Preparation of MtNACsa3 overexpressing transgenic alfalfa 1. pEarlygate100-MtNACsa3 plant overexpression vector The double-stranded DNA molecule shown in SEQ ID NO: 6 was used to replace the pEarleyGate100 vector (Newpro Bio, product catalog number V010866). XOt I and Spe I restriction site, keeping other sequences unchanged, to obtain the recombinant plasmid pEarleyGate100-MtNACsa3. The recombinant plasmid pEarleyGate100-MtNACsa3 has been sequenced and verified. The schematic diagram of the elements is shown in Figure 4 .

[0107] 2. Agrobacterium infection of alfalfa 1. Introduce the recombinant plasmid pEarleyGate100-MtNACsa3 plasmid into Agrobacterium EHA105 to obtain recombinant Agrobacterium.

[0108] 2. The recombinant Agrobacterium obtained in step 1 was inoculated into a liquid YEP medium containing 50 μg / mL kanamycin and 75 μg / mL rifampicin, and cultured at 28°C and 230 rpm until OD 600nm The cell pellet was resuspended in SM4 liquid medium containing 100 μM acetosyringone and the OD was adjusted to 0.4. The cell pellet was centrifuged at 4000 g for 10 min at 24 °C. The supernatant was discarded and the cell pellet was resuspended in SM4 liquid medium containing 100 μM acetosyringone. 600nm The value is 0.2-0.4, which is the infection solution.

[0109] 3. Take leaves of wild-type alfalfa plants, soak them in 0.1% Tween 20 solution for 5 minutes, then rinse them with deionized water three times, then rinse them with 75% ethanol solution for 15 seconds, then soak them in 30% bleach for 10 minutes, and then rinse them with deionized water three times.

[0110] 4. Transfer the leaves that have completed step 3 to a sterile empty glass bottle, add the infection solution prepared in step 2, first vacuum for 5 minutes, then ultrasonically treat for 3 minutes, and then vacuum for 5 minutes. Then take the leaves, remove the surface liquid with filter paper, blow dry, and cut into small pieces with a blade to obtain the explants.

[0111] 5. Spread the explants obtained in step 4 onto SM4 solid culture medium and culture in the dark at room temperature for 3 days.

[0112] 6. After completing step 5, transfer the explants to SM4 solid medium containing 200 mg / L timentin and 1 mg / L glufosinate ammonium and culture at 24°C in the light until callus grows. Subculture once every 2 weeks.

[0113] 7. After completing step 6, transfer the callus to MSBK solid medium containing 200 mg / L timentin and 1 mg / L glufosinate ammonium and culture for 2-3 weeks.

[0114] 8. After completing step 7, transfer the callus to SH9 solid medium containing 200 mg / L timentin and 1 mg / L glufosinate ammonium, and culture at 22°C with alternating light and dark conditions. Subculture once every 3 weeks until regenerated seedlings are obtained.

[0115] 9. Transfer the regenerated seedlings obtained in step 8 to 1 / 2 MS solid medium and culture them at 22°C with alternating light and dark. Subculture every 3-4 weeks until the plants take root, which are T0 generation plants. Number each T0 generation plant in sequence.

[0116] 3. Molecular Identification 1. PCR identification Test plants: five T0 plants obtained in step 2 (NACsa3-L1 plants, NACsa3-L2 plants, NACsa3-L3 plants, NACsa3-L4 plants and NACsa3-L5 plants) or wild-type alfalfa plants.

[0117] Leaves of the tested plants were taken to extract genomic DNA. Using genomic DNA as a template, PCR amplification was performed using a primer pair consisting of MtNACsa3-RT-F and GFP-R, and then agarose gel electrophoresis was performed. The results showed that all five T0 generation plants showed an amplification product of about 587 bp, and all were transgenic plants.

[0118] 2. RNA level identification Take the leaves of the test plants, extract total RNA, and reverse transcribe to obtain cDNA. Using cDNA as a template and MsACTIN4A gene as an internal reference gene, the transcription level of MtNACsa3-GFP gene was detected by RT-qPCR. The transcription level of MtNACsa3-GFP gene in wild-type alfalfa plants was used as reference 1 to calculate the relative transcription level of MtNACsa3-GFP gene in each transgenic plant.

[0119] Primers used to detect the MtNACsa3-GFP gene: MtNACsa3-RT-F and MtNACsa3-RT-R.

[0120] Primers used to detect the MsACTIN4A gene: MtActin4A-RT-F and MtActin4A-RT-R.

[0121] Results Figure 5 (The vertical axis is the relative transcription level of the MtNACsa3-GFP gene) Example 5: Salt tolerance evaluation Greenhouse conditions: 22°C, 16h light / 8h dark, humidity 70%-80%.

[0122] I. Salt tolerance identification of wild-type plants and mtnacsa3 mutants Seeds for testing: mtnacsa3 -Seeds obtained by self-pollination of L1 mutants, mtnacsa3 -Seeds obtained from self-pollination of the L2 mutant and seeds of wild-type Medicago truncatula.

[0123] 1. Place the test seeds in a 2 mL centrifuge tube, add 1 mL of 98% concentrated sulfuric acid solution for 8 min, then rinse with sterile water, then add 1 mL of 0.5% sodium hypochlorite solution for disinfection for 12 min, and then wash with deionized water.

[0124] 2. Each test seed was divided into two groups, and water treatment and NaCl treatment were performed respectively. Water treatment method: add water (4 ml / petri dish) to a glass petri dish with a diameter of 9 cm, then lay a double layer of filter paper, then place the seeds on the filter paper, then place it in a 4°C refrigerator in the dark for 3 days, and then place it in a 22°C incubator in the dark for incubation. NaCl treatment method: add 150mM NaCl aqueous solution (4 ml / petri dish) to a glass petri dish with a diameter of 9 cm, then lay a double layer of filter paper, then place the seeds on the filter paper, then place it in a 4°C refrigerator in the dark for 3 days, and then place it in a 22°C incubator in the dark for incubation. Three replicate samples were set for each treatment of each test seed, and the number of seeds in each replicate sample was 20.

[0125] 3. After 0h, 12h, 24h, 36h, 48h, 60h, 72h, 84h, 96h, 108h, 120h or 132h of dark culture in step 2, observe the phenotype and count the number of germinated seeds (seeds with radicle exposed to seed coat) and the total number of seeds. Germination rate (%) = number of germinated seeds ÷ total number of seeds × 100%.

[0126] The results of germination rate are shown in Table 1 and Figure 6 (A is water treatment, B is NaCl treatment). Under water treatment conditions, the germination rate of wild-type Medicago truncatula seeds was 97.22%. mtnacsa3 The germination rate of seeds of the -L1 mutant was 97.11% (no significant difference from WT). mtnacsa3 The germination rate of seeds of the -L2 mutant was 100% (no significant difference from WT). Under NaCl treatment conditions, the germination rate of seeds of wild-type Medicago truncatula was 67.22%, mtnacsa3 The germination rate of seeds of the -L1 mutant was 37.78% (significantly lower than that of WT). mtnacsa3 The germination rate of seeds of the -L2 mutant was 40% (significantly lower than that of WT).

[0127]

[0128] II. Identification of salt tolerance of MtNACsa3-overexpressing Medicago truncatula Seeds for testing: MtNACsa3 T3 seeds of OE-9 strain, MtNACsa3 T3 seeds of OE-13 strain and seeds of wild-type Medicago truncatula.

[0129] The method is the same as step 1.

[0130] The results of germination rate are shown in Table 2 and Figure 7 (A is water treatment, B is NaCl treatment). Under water treatment conditions, the germination rate of wild-type Medicago truncatula seeds was 98.89%. MtNACsa3The germination rate of T3 seeds of OE-9 strain was 96.67% (no significant difference from WT). MtNACsa3 The germination rate of T3 seeds of OE-13 strain was 89.77% (no significant difference from WT). Under NaCl treatment, the germination rate of wild-type Medicago truncatula seeds was 56.17%, MtNACsa3 The germination rate of T3 seeds of OE-9 strain was 82.11% (significantly higher than WT). MtNACsa3 The germination rate of T3 seeds of OE-13 line was 83.25% (significantly higher than WT).

[0131]

[0132] III. Identification of salt tolerance of MtNACsa3-overexpressing alfalfa Test plants: NACsa3-L1 plants, NACsa3-L5 plants, and wild-type alfalfa plants.

[0133] 1. Cut stem segments from the test plants (each stem segment is 6-8 cm long and has an axillary bud in the lower middle of the stem segment), and cut every 6 stem segments into a flower pot with a culture matrix (with holes at the bottom of the flower pot), and put every 6 flower pots on a tray, and then inject 2L 1 / 2 MS liquid culture medium into each tray, and then culture in a greenhouse for 4 weeks. Greenhouse conditions: 22℃, 16h light / 8h dark, humidity 70%-80%.

[0134] 2. After completing step 1, divide the test plants into two groups and perform water treatment or NaCl treatment respectively. Water treatment method: inject deionized water into the tray every 4 days (250ml per tray) and culture for 4 weeks. NaCl treatment method: inject 200mM NaCl aqueous solution into the tray every 4 days (250ml per tray) and culture for 4 weeks. Each treatment of each test plant is set up with 3 replicates, and the number of cuttings in each replicate is 15 plants.

[0135] 3. After completing step 2, take a photo, then cut off the above-ground part and dry it to constant weight, which is the dry weight.

[0136] Count the aboveground biomass (in dry weight).

[0137] See the sample photos Figure 8 The biomass statistics of water treatment are shown in Figure 8 The biomass statistics of B. NaCl treatment are shown in Figure 8C. Under water treatment conditions, the average biomass of the aboveground part of wild-type alfalfa cuttings was 179.1 mg, the average biomass of the aboveground part of NACsa3-L1 cuttings was 151.3 mg (no significant difference from ZM1), and the average biomass of the aboveground part of NACsa3-L5 cuttings was 164.45 mg (no significant difference from ZM1). Under NaCl treatment conditions, the average biomass of the aboveground part of wild-type alfalfa cuttings was 91.2 mg, the average biomass of the aboveground part of NACsa3-L1 cuttings was 145.5 mg (significantly higher than ZM1), and the average biomass of the aboveground part of NACsa3-L5 cuttings was 126.0 mg (significantly higher than ZM1).

[0138] The sequences of the primers used in the above examples are as follows: MtNACsa3-F0 (SEQ ID NO: 9): 5'-TGCCGAGCTTCAATTGCCACCGTTTTAGAGCTAGAAATAGC-3'; MtNACsa3-R0 (SEQ ID NO: 10): 5'-AACAACAGCTCGAATCGGTGTGCAATTTAATGGTTCGCTTGTA-3'.

[0139] MtNACsa3-F1 (SEQ ID NO: 11): 5'-AATACACGTCTCTCCCTTATGTG-3'; MtNACsa3-R1 (SEQ ID NO: 12): 5'-ACCGGTTTAGGATGACCTATTG-3'.

[0140] MtNACsa3-F2 (SEQ ID NO: 13): 5'-TTGGATGATTGGGTGCTTTG-3'; MtNACsa3-R2 (SEQ ID NO: 14): 5'-TCAAAAGGTTTTGGGCAAGTACATGAA-3'.

[0141] pCAMBIA1307-MtNACsa3-F (SEQ ID NO: 15): 5'-ACGCGTCGACATGGCATCCGAGCTTCAAT-3'; GFP-R (SEQ ID NO: 16): 5'-CACTGACAGAAAATTTGTGCCCA-3'.

[0142] MtNACsa3-RT-F (SEQ ID NO: 17): 5′-TCGTTTAGCTGATGTAGATCGC-3′; MtNACsa3-RT-R (SEQ ID NO: 18): 5′-CACTGTGCTTTGGTTGTTTCTC-3′.

[0143] MtActin4A-RT-F (SEQ ID NO: 19): 5′-CCAAAGGCCAACAGAGAAAA-3′; MtActin4A-RT-R (SEQ ID NO: 20): 5′-ACGACCAGCAAGATCCAAAC-3′.

[0144] MtNACsa3-RT-F (SEQ ID NO: 21): 5′-TCGTTTAGCTGATGTAGATCGC-3′; MtNACsa3-RT-R (SEQ ID NO: 22): 5′-CACTGTGCTTTGGTTGTTTCTC-3′.

[0145] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Protein, which is (a1) or (a2) or (a3) ​​or (a4) as follows: (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to plant salt tolerance obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1); (a4) A protein derived from alfalfa that has more than 98% identity with (a1) and is associated with plant salt tolerance.

2. Protein-related biological material, any one of the following (b1) to (b4): (b1) a nucleic acid molecule encoding the protein according to claim 1; (b2) an expression cassette containing the nucleic acid molecule described in (b1); (b3) a recombinant vector containing the nucleic acid molecule described in (b1) or a recombinant vector containing the expression cassette described in (b2); (b4) A recombinant microorganism containing the nucleic acid molecule described in (b1), a recombinant microorganism containing the expression cassette described in (b2), or a recombinant microorganism containing the recombinant vector described in (b3).

3. Use of the protein according to claim 1 or a nucleic acid molecule encoding the protein according to claim 1 in regulating plant salt tolerance.

4. Use of the protein-related biological material according to claim 2 in cultivating transgenic plants with improved salt tolerance.

5. A method for cultivating plants with improved salt tolerance, comprising the following steps: introducing the protein-related biological material of claim 2 into a recipient plant to obtain a transgenic plant with improved salt tolerance.

6. A method for cultivating plants with improved salt tolerance, comprising the steps of: increasing the content of the protein according to claim 1 in the plants to obtain plants with improved salt tolerance.

7. Use of the protein according to claim 1 or a nucleic acid molecule encoding the protein according to claim 1 as an inhibition target in cultivating plants with reduced salt tolerance.

8. A method for cultivating plants with reduced salt tolerance, comprising the following steps: inhibiting the expression of a nucleic acid molecule encoding the protein of claim 1 in a target plant to obtain a transgenic plant with reduced salt tolerance.

9. A method for cultivating plants with reduced salt tolerance, comprising the steps of: reducing the content of the protein according to claim 1 in the plants to obtain plants with reduced salt tolerance.

10. Use of the method according to claim 5 or 6 or 8 or 9 in plant breeding.

Images