Nanometer antibody targeting Fc epsilon RI alpha protein extracellular domain and application thereof

Abstract

The invention relates to a nano antibody antiFc epsilon RIa-A9 targeting an extracellular domain of an Fc epsilon RIalpha protein (IgE-Fc high affinity receptor) and application of the nano antibody antiFc epsilon RIa-A9 targeting the extracellular domain of the Fc epsilon RIalpha protein (IgE-Fc high affinity receptor). The nano antibody antiFc epsilon RIa-A9 comprises three antigen complementation determining regions CDR1, CDR2 and CDR3, and the amino acid sequences of the CDR1, the CDR2 and the CDR3 are amino acid sequences which have more than 80% of homology with the amino acid sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

Description

Technical Field

[0001] The present invention relates to the technical field of biopharmaceuticals, and in particular to a nano antibody targeting the extracellular segment of FcεRIα protein (IgE-Fc high affinity receptor) and an application thereof. Background Art

[0002] As the sixth largest chronic disease in the world, 40% of people have some kind of allergic disease. The occurrence of rhinitis, asthma, and even anaphylactic shock caused by allergic reactions brings great trouble to many people's lives, and has been listed by the WTO as one of the three major diseases to be studied and prevented in the 21st century. IgE protein plays an important role in human allergic reactions. In type I hypersensitivity reactions, multiple specific IgE aggregates that bind to allergens and cross-link bind to the extracellular segment of the α subunit of the high-affinity receptor FcεRI protein on the surface of mast cells and basophils, thereby leading to the aggregation of FcεRI protein, causing phosphorylation of downstream messenger proteases, activating reaction pathways, and ultimately leading to degranulation of effector cells, releasing a large number of enzymes, cytokines and vasoactive mediators, causing various clinical manifestations of allergic reactions, including airway obstruction, rash, etc. Therefore, in addition to traditional histamine receptor antagonists and glucocorticoid drugs, antibodies that can block the interaction between IgE and receptor FcεRI can also be used as drugs to treat allergic diseases.

[0003] FcεRIα protein is one of the most important proteins in human plasma and is also a multifunctional biomolecule. FcεRI is a transmembrane protein composed of four subunits, αβγ2. The extracellular segment of the α subunit is responsible for binding to IgE and consists of two 85-amino acid immunoglobulin-like domains. The crystal structure of the complex of the FcεRIα extracellular segment and IgE-Fc shows that the FcεRIα extracellular segment binds to the Cε3-Cε4 domain of IgE-Fc in a 1:1 ratio and locks IgE-Fc in an open conformation to prevent it from binding to CD23.

[0004] Currently, the only anti-IgE monoclonal antibody approved by the FDA for marketing is Omalizumab, which is used to treat asthma and chronic spontaneous urticaria. Omalizumab reduces FcεRI on the surface of effector cells by hindering the binding of IgE to FcεRI, thereby exerting the efficacy of inhibiting degranulation and subsequent allergic reactions. However, Omalizumab also has the defects of slow onset and incomplete prevention. In theory, antibodies that specifically bind to FcεRI can also block the cross-linking formation of IgE and FcεRI and play an inhibitory role. Preliminary studies at home and abroad have also proved that this is indeed the case. At the same time, studies have also shown that anti-FcεRI antibodies can replace specific allergens to become a broad-spectrum desensitization agent. Therefore, the specific FcεRIa nanoantibody in the present invention can be used as a therapeutic drug for the treatment and diagnosis of diseases related to FcεRIa, especially in allergic diseases, and also has the potential to be used as a desensitization drug. Summary of the invention

[0005] The present invention is completed in view of the above-mentioned prior art, and its purpose is to provide a nano antibody targeting the extracellular segment of FcεRIα protein and its application.

[0006] In order to solve the above problems in the prior art, the inventors have conducted in-depth research and provided the following aspects.

[0007] On the one hand, the present invention provides a nanoantibody (VHH) antiFcεRIa-A9 targeting the extracellular segment of the FcεRIα protein, which comprises three antigen complementarity determining regions CDR1, CDR2 and CDR3, and the amino acid sequences of CDR1, CDR2 and CDR3 are amino acid sequences with more than 80% homology with the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0008] GLTFSSYFM (SEQ ID NO: 1)

[0009] FVAAISWSGGS (SEQ ID NO: 2)

[0010] AAVRAYSTDYYARSEKYSH(SEQ ID NO: 3)

[0011] In some embodiments, preferably, the amino acid sequences of CDR1, CDR2 and CDR3 are amino acid sequences that have at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0012] In some embodiments, the homologous sequence comprises an amino acid sequence having one or more (preferably 1, 2 or 3) conservative amino acid mutations (preferably substitutions, insertions or deletions) compared to the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0013] In some embodiments, the amino acid sequences of CDR1, CDR2 and CDR3 are shown by SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0014] In some embodiments, the amino acid sequence of the Nanobody antiFcεRIa-A9 is shown by SEQ ID NO:4.

[0015]

[0016] The bolded parts represent SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

[0017] In this article, nanobody refers to a single-domain antibody that only contains the heavy chain variable region, i.e., VHH antibody.

[0018] On the other hand, the present invention also provides a heavy chain antibody targeting FcεRIa protein, which has the nanobody antiFcεRIa-A9 and an Fc domain.

[0019] In this article, heavy chain antibody (HcAb) refers to an antibody lacking a light chain found in camelids. In addition to the lack of light chains, compared with ordinary antibodies, there is no CH1 region between the heavy chain variable region and the hinge region.

[0020] In some embodiments, preferably, the Fc domain is a human IgG1 Fc domain, the amino acid sequence of which is shown in SEQ ID NO: 5, and the nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO: 6.

[0021] IgG1 Fc domain amino acid sequence:

[0022]

[0023] IgG1 Fc domain nucleotide sequence:

[0024]

[0025]

[0026] On the other hand, the present invention also provides a polynucleotide encoding the nanobody antiFcεRIa-A9 or encoding the heavy chain antibody with an Fc domain, wherein the nucleotide sequence encoding the nanobody antiFcεRIa-A9 is shown by SEQ ID NO:7.

[0027] Nucleotide sequence of antiFcεRIa-A9:

[0028]

[0029] On the other hand, the present invention also provides an expression vector comprising the polynucleotide, and a host cell comprising the expression vector.

[0030] In some embodiments, preferably, the host cell is a host cell for expressing foreign proteins, such as bacteria, yeast, insect cells, mammalian cells.

[0031] On the other hand, the present invention also provides a pharmaceutical composition comprising the nanobody antiFcεRIa-A9 or the heavy chain antibody having an Fc domain.

[0032] In some embodiments, preferably, the pharmaceutical composition is in a form suitable for administration by subcutaneous injection, intradermal injection, intravenous injection, intramuscular injection or intralesional injection.

[0033] On the other hand, the present invention provides the use of nanobody antiFcεRIa-A9 / heavy chain antibody in the preparation of drugs for treating and / or diagnosing diseases related to FcεRIa.

[0034] In some embodiments, preferably, the disease associated with FcεRIα is an allergic disease.

[0035] On the other hand, the present invention also provides the use of the nanobody antiFcεRIa-A9 or the heavy chain antibody with an Fc domain in the preparation of a broad-spectrum desensitization drug.

[0036] In some embodiments, preferably, the Nanobody antiFcεRIa-A9 / heavy chain antibody further comprises a second antibody, which comprises a detectable label, such as a radioactive isotope, a luminescent substance, a colored substance, an enzyme or polyethylene glycol.

[0037] The nano antibody of the present invention is derived from natural alpaca heavy chain antibodies, and binds to the extracellular segment of human FcεRIa protein with high affinity. It has the following advantages: 1) simple structure and small molecular weight, which is conducive to expression and use; 2) convenient for efficient and large-scale expression in Escherichia coli and various eukaryotic systems; 3) since it has only one binding site, it is a single-domain antibody, and has better permeability, specificity and detection linearity as a diagnostic reagent; 4) it is easy to couple with various fusion proteins or be more easily labeled with various markers; 5) it is easier to prepare bifunctional antibodies, which is more conducive to targeted drug development and directional transport to cell targets; 6) as a drug development, it has low immunogenicity to humans and is not easy to produce immune rejection. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The ELISA results are for screening monoclonal phages that specifically bind to human FcεRIa protein.

[0039] Figure 2 Figure 1 is the purification and SDS-PAGE analysis results of the heavy chain antibody; Figure A is the elution diagram of the heavy chain antibody purified using a Protein A column, and Figure B is the SDS-PAGE result diagram of the heavy chain antibody.

[0040] Figure 3 The results of the ELISA analysis of the binding of nanobodies to FcεRIa; the EC of nanobodies 50 Value: EC 50 =1.416nM.

[0041] Figure 4 The results of SPR binding analysis of nanobody and FcεRIa; Ka (1 / Ms) of nanobody = 1.111E+5, Kd (1 / s) = 2.023E-4, KD (M) = 1.831E-9. DETAILED DESCRIPTION

[0042] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0043] Example 1: Preparation of antiFcεRIa-A9

[0044] 1) For immunization of alpacas (Vicugna pacos), Freund's complete adjuvant (Sigma, F5881) was used for the first immunization, and Freund's incomplete adjuvant (Sigma, F5506) was used for the next two immunizations. Each time, 200 μg of antigen was used, and the antigen and adjuvant were mixed in a volume ratio of 1:1. The first two injections were injected subcutaneously, and the last injection was injected intramuscularly. The alpacas were immunized 3 times in total, once every 3 weeks.

[0045] 2) At week 11, venous blood was collected and peripheral blood lymphocytes were separated using Ficoll from Solebol.

[0046] 3) Total RNA was extracted using the RNA extraction kit from Omega Biotek and genomic DNA was removed.

[0047] 4) Using Takara’s PrimeScript TM II First Strand cDNA Synthesis Kit, reverse transcribe RNA into cDNA.

[0048] 5) Construction of nanobody phage display library: Using the above cDNA as a template, the coding sequence of nanobody was obtained by PCR amplification using specific alpaca VHH primers (forward primer: GCTGCACAGCCTGCTATGGCACAGKTGCAGCTCGTGGAGTCTGGGGG (SEQ ID NO: 8); reverse primer: GAGTTTTTGTTCGGCTGCTGCTGAGGAGACGGTGACCTGGGTCCCC (SEQ ID NO: 9)). The amplified nanobody sequence was inserted into the NcoI and NotI sites of phagemid pR2 (MRC Laboratory of Molecular Biology) by Gibson assembly (Gibson assembly, Yisheng Bio, 10911ES20). The obtained Gibson assembly product is the initial nanobody phage library, and the product is recovered.

[0049] 6) Prepare competent cells of Escherichia coli T1 (MRC Laboratory of Molecular Biology) by 10% glycerol washing method. The activated TG1 was cultured in 250 mL 2×YT (formula 1 L: 16 g tryptone (OXOID), 10 g yeast extract (OXOID), 5 g NaCl (Sinopharm Chemical Reagent Co., Ltd., the inorganic salt reagents used in subsequent examples are all from the same source)) medium until OD 600 After centrifugation at about 0.6-0.8, 5000g for 15 minutes, the suspension was washed three times with 250mL, 250mL and 100mL of pre-cooled 10% glycerol (Sinopharm Chemical Reagent Co., Ltd.), and finally resuspended with 1mL of 10% glycerol and dispensed into 500μL per tube.

[0050] 7) Use BTX ECM 399 electroporator to transform Escherichia coli TG1 competent cells. Mix the product recovered from Gibson assembly with 500 μL TG1 competent cells and transfer to a 0.1 cm electroporation cuvette, followed by electrotransformation at 2.5 KV. Resuspend the electroporation product in 20 mL 2× culture medium and incubate at 37°C, 220 rpm for 1 h. Take 10 μL of bacterial solution, dilute to 990 μL 2×YT, mix well, then take 40 μL of bacterial solution, dilute to 160 μL 2×YT, plate 100 μL and culture overnight at 37°C. Count and calculate the library size on the second day (library size = number of counts × 10 5 ). The bacteria were spread on five 150 mm 2×YT plates supplemented with 100 μg / ml ampicillin (Zhihong Biotechnology, 1146GR005) 1146GR005 and 2% glucose (Sinopharm Chemical Reagent Co., Ltd.) to amplify the phage library and cultured overnight at 37°C. Next, the transformed colonies were scraped from the plates, vortexed and thoroughly mixed with a final concentration of 25% glycerol, and then quickly frozen in liquid nitrogen in 1 mL aliquots and stored at -80°C, and the size of the phage library was calculated.

[0051] 8) Amplification of the Nanobody Phage Display Library: To amplify the Nanobody phage library, 0.2 ml of the frozen library was thawed on ice, diluted into 200 mL of 2×YT medium supplemented with 100 μg / mL ampicillin and 2% glucose, and cultured at 37°C at 220 rpm. Next, 1×10 12 pfu of KM13 helper phage (MRC Laboratory of Molecular Biology) was added to the culture and incubated at 37°C (water bath) for 45 minutes. The cell pellet was separated by high-speed centrifugation and resuspended in 200mL of 2×YT medium, to which 0.1% glucose, 50μg / mL kanamycin (Zhihong Biology, 1162GR025) and 100μg / mL ampicillin were added. The cells were incubated at 25°C, 220rpm for 20 hours to amplify the phage library. After centrifugation, polyethylene glycol (PEG) was added to the culture supernatant to precipitate phage particles. The precipitated phage particle pellet was dissolved in 1×PBS (formula: 10 mmol / L Na2HPO4; 1.75 mmol / L KH2PO4; 137 mmol / L NaCl; 2.65 mmol / L KCl; pH 7.2-7.6) and stored in 1 mL aliquots at -80°C in the presence of 25% glycerol.

[0052] 9) Screening: FcεRIa antigen was diluted with PBS to a final concentration of 0.1 mg / ml and coated into one well of a 96-well immunoplate ELISA (Nunc maxsorp plate), and one well of the ELISA plate was set aside for negative control. After washing three times with 1×PBS, 300 μL of MPBS (1×PBS containing 5% skim milk) was added to each well of the ELISA plate and incubated at room temperature for 2 hours to block unbound sites. Next, the plate was washed three times with 1×PBS and 1×10 11 pfu (diluted in 100 μL MPBS) phage library was added to each well, incubated at room temperature for 1 hour, and washed 3 times with PBST (1×PBS containing 0.1% Tween20). Phages displaying specificity for FcεRIa nanobodies were eluted by incubating at room temperature for 1 hour with trypsin at a final concentration of 0.5 mg / ml. 10 μL of eluted phage was added to 1 mL of E. coli TG1 competent cells and incubated at 37°C (water bath) for 45 minutes for infection, and then the bacterial culture was plated on 2×YT supplemented with 100 μg / mL ampicillin and 2% glucose and incubated overnight at 37°C.

[0053] 10) Preparation of monoclonal phage: After one round of panning, 48 individual colonies were picked into a 96-well round-bottom culture dish containing 100 μL of 2×YT medium supplemented with 100 μg / mL of ampicillin and 2% glucose (w / v). Incubate at 37°C, 180 rpm for 12 hours. Next, 5 μL of the culture solution was inoculated into a new 96-well round-bottom culture dish containing 200 μL of 2×YT medium supplemented with 100 μg / mL of ampicillin and 2% glucose (w / v). The freshly inoculated plate was incubated at 37°C, 250 rpm for 1.5 hours until the OD260 was about 0.5. 50 μL containing 4×10 8 2×YT medium with pfu KM13 helper phage was added to each well of the plate and incubated at 37°C for 45 minutes without shaking for infection. After infection, 150 μL of supernatant was discarded and the remainder was centrifuged at 3500 g for 15 minutes, the supernatant was discarded, and the bacterial pellet was resuspended in 200 mL of 2×YT medium supplemented with 100 μg / mL ampicillin, 50 μg / mL kanamycin and 0.1% glucose (w / v), and incubated overnight at 25°C, 250 rpm for about 14-16 hours. The next day, the culture was centrifuged at 3500 g for 30 minutes, and then 150 μL of supernatant was transferred to a new 96-well plate and stored at 4°C for screening of nanobodies.

[0054] 11) Phage ELISA test: 96-well round-bottom immunoELISA plates were coated with 100 μL FcεRIα at a final concentration of 0.2 μg / mL by diluting with 1× PBS and incubated at 4°C for 16 hours. Next, the ELISA plate was washed 3 times with 1× PBS. The plate was blocked with MPBS (1× PBS containing 5% skim milk) for 2 hours at room temperature. After the wells were washed 4 times with PBS-0.1% Tween 20. Then 100 μL of 1×10 11 pfu of phage was added to each well and incubated at room temperature for 1 hour. The ELSA plate was then washed 5 times with PBS-0.1% Tween 20. HRP-KM13 (Beijing Yiqiao Shenzhou) diluted in MPBS 1:8000 was added to the ELISA plate at 100 μL per well and incubated at room temperature for 1 hour. The wells were then washed 4 times with PBS-0.1% Tween 20, and 100 μL of 3,3′,5,5′-tetramethylbenzidine (TMB, Beyotime) was added to each well, incubated in the dark for 7 minutes to develop color, and then 50 μL of 1M H2SO4 was immediately added to terminate the reaction, and the OD was measured by an enzyme reader. 450nm Value, the result is Figure 1 shown.

[0055] 12) OD 450nm 20 positive clones with values ​​greater than 1 were selected for sequencing and the sequence results were analyzed. Finally, a positive phage nanobody specific for FcεRIa protein was determined and named antiFcεRIa-A9 (amino acid sequence shown in SEQ ID NO: 4). This nanobody has a specific CDR region that binds to FcεRIa protein.

[0056] Example 2: Expression and purification of nanobody-Fc fusion protein

[0057] The peptide gene sequence that guides secretion was designed and fused to the N-terminus of the nanobody gene to ensure secretion after expression, human IgG1 Fc was fused to the C-terminus of the nanobody gene, and the nanobody gene and human IgG1 Fc were recombined and then cloned into the mammalian expression vector pTT5.

[0058] The constructed vector was transfected into HEK293F cells (density about 2.5x10 6 cells / ml, ATCC, CBP60437), in Freestyle TMThe transfected mammalian cells were cultured with 293 expression medium (Yonglian Bio) at 5% CO2, 150 rpm, 37°C for 4 days, and then centrifuged at 3000 rpm for 10 minutes. The mammalian cells were cultured for 5 days, and then the supernatant of the mammalian cell culture was collected by centrifugation at 2000 rpm for 10 minutes. The nanobody-Fc fusion protein was purified by protein A column, eluted with 0.1 M acetic acid, and the eluted protein was analyzed by SDS-PAGE electrophoresis, as shown in FIG. Figure 2 As shown, highly pure Nanobody-Fc fusion protein was obtained from the supernatant.

[0059] Example 3: Analysis of the binding affinity of nanobodies to FcεRIa protein

[0060] Immuno MaxiSorb plates (Nunc) were coated with 2 μg / mL FcεRIa protein and allowed to stand at room temperature for 2 h. The ELISA plate was washed three times with 1×PBS and 240 μL of MPBS was added to each well and allowed to stand at room temperature for 2 h to block unbound sites. Next, nanoantibody-Fc was gradient diluted with a diluent containing 5% milk in PBST (starting at 50 nM, three-fold continuous gradient dilution, 12 gradient dilutions). 100 μL was added to each well and incubated at room temperature for 1 h. After 1 h, the ELISA plate was washed three times with 1×PBST and HRP-anti-human IgG Fc (Beijing Yiqiao Shenzhou) was diluted with a diluent containing 5% milk in PBST at a ratio of 1:10000 and incubated at room temperature for 1 h. The ELISA plate was washed three times with 1×PBST and 100 μL of TMB (Biyuntian) was added to each well and reacted at room temperature in the dark for 7 minutes. Finally, 50 μL 1 M H2SO4 was added to terminate the reaction and the absorbance at 450 nm was measured.

[0061] The results of ELISA analysis are as follows Figure 3 As shown, the EC of FcεRIa protein and nanobody-IgG1 Fc 50 At 1.416 nM, the prepared nanobody has a higher binding affinity to FcεRIa protein.

[0062] Example 4: Characterization of the affinity between nanobodies and FcεRIa protein by SRP

[0063] Materials: sensor chip CM5, phosphate buffer plus 0.05% Tween 20 (0.05% TPBS), acetate solution pH 5.0, hFcεRIα, nanobody antiFcεRIa-A9, ethanolamine-HCl blocking agent, 10mM NaOH activation solution, 400mM MgCl2 regeneration solution.

[0064] SPR experiments were performed using a Biacore™ T200 system (GE Healthcare) and 0.05% TPBS was used as sample buffer and running buffer. All analytical temperatures were set at 25° C. Immobilization of FcεRIa was performed using an amine coupling kit pH 5.0.

[0065] FcεRIa was immobilized on the surface of a CM5 chip, and nanoantibodies were injected as the mobile phase. When the nanoantibodies flowed through the chip, the antigen specifically bound to the nanoantibodies, resulting in an increase in the weight of the chip surface, thereby observing the intermolecular interaction, using a single-cycle kinetic method with seven concentrations (100-1.5625nM). The surface was regenerated by injecting a regeneration solution (400mM MgCl2) from the capture kit for 120s to remove the bound nanoantibodies. Nanoantibodies + 0.05% TPBS buffer injection + regeneration (blank cycle) was completed in each nanoantibody. The response was first subtracted from the reference flow cell, and then the data from the blank cycle was subtracted as a double reference. By using Biacore TM T200 Evaluation Software 2.0 selects the Kinetics method to fit the data.

[0066] The results are as follows Figure 4 As shown, the Ka(1 / Ms) of antiFcεRIa-A9 is 1.111E+5, Kd(1 / s) is 2.023E-4, and KD(M) is 1.831E-9. The prepared nanobody has a high binding affinity to FcεRIa.

[0067] The above implementation modes are only used to illustrate the technical solutions of the present invention, but not to limit the present invention. Although the present invention has been described in detail with reference to the above implementation modes, those skilled in the art should understand that any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A nanobody antiFcεRIa-A9 targeting the extracellular segment of FcεRIα protein, comprising three antigen complementary determining regions CDR1, CDR2 and CDR3, The amino acid sequences of CDR1, CDR2 and CDR3 are amino acid sequences having more than 80% homology with the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

2. The nanobody antiFcεRIa-A9 according to claim 1, characterized in that The amino acid sequences of CDR1, CDR2 and CDR3 are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

3. The Nanobody antiFcεRIa-A9 according to claim 1 or 2, characterized in that The amino acid sequence of the nanobody antiFcεRIa-A9 is shown in SEQ ID NO:

4.

4. A heavy chain antibody targeting FcεRIα protein, comprising the nanobody antiFcεRIa-A9 according to claim 1 and an Fc domain.

5. The heavy chain antibody according to claim 4, characterized in that The Fc domain is a human IgG1 Fc domain.

6. A polynucleotide encoding the Nanobody antiFcεRIa-A9 according to any one of claims 1 to 3, or encoding the heavy chain antibody according to claim 4 or 5. An expression vector comprising the polynucleotide according to claim 6. A host cell comprising the expression vector according to claim 7.

9. A pharmaceutical composition comprising the Nanobody antiFcεRIa-A9 according to any one of claims 1 to 3, or the heavy chain antibody according to claim 4 or 5.

10. Use of the nanobody antiFcεRIa-A9 according to any one of claims 1 to 3 or the heavy chain antibody according to claim 4 or 5 in the preparation of a drug for treating and / or diagnosing a disease associated with FcεRIα, wherein: The FcεRIα-related disease is preferably an allergic disease.

Images