Cordyceps javanica strain Cordyceps javanica, microbial agent and application of Cordyceps javanica strain Cordyceps javanica

Abstract

The invention belongs to the field of agricultural insect pest killing, and particularly relates to a Cordyceps javanica strain Cordycepsjavanica, a microbial agent, a method for preventing and treating aleyrodid on greenhouse cucumbers and a preparation method of Cordyceps javanica aqueous solution and powder. According to the method for preventing and treating the cucumber whiteflies, spores generated by the cordyceps javanica germinate and invade insect bodies of the whiteflies, and the whiteflies are poisoned and killed. The tea cake powder contains fat, protein, tea saponin and other components, so that the dispersity and adhesiveness of the cordyceps javanica can be improved, meanwhile, nutrient substances are provided for germination of the cordyceps javanica, the infection speed of the cordyceps javanica to the cucumber whiteflies can be increased by adding the tea cake powder, the infection rate can be increased, and the quick-acting property of the cordyceps javanica can be improved.

Description

Technical Field

[0001] The invention belongs to the field of agricultural pest killing, and specifically relates to a Javanese cordyceps strain, a microbial agent, a method for preventing and controlling whiteflies on greenhouse cucumbers, and a preparation method of a Javanese cordyceps aqueous solution and a powder. Background Art

[0002] Cordyceps javanica is an important insect pathogenic fungus, which is widely distributed in nature. It can infect a variety of pests, has strong pathogenicity and is safe for humans and animals. The main spores invade the host through the epidermis, absorb the host's nutrients for reproduction, and eventually cause the host to die. Its advantage is that it is difficult for pests to develop drug resistance, so it is considered to be a biocontrol fungus with broad development prospects. Studies have shown that Cordyceps javanica has pathogenic effects on 43 species of insects in 7 orders and 25 families, and is mainly effective against Homoptera, Hemiptera and Lepidoptera pests. However, the biological activity of biological pesticides is easily affected by the environment. Only at suitable temperature and humidity can biological pesticides have a good control effect on target pests, otherwise the control effect is low. In addition, the rapid effect of biological pesticides is poor. Most target pests need 3 to 7 days to show death after being infected with pathogens. Adding tea cake powder to Cordyceps javanica can increase the parasitic infection rate of Cordyceps javanica on whiteflies and increase the control effect.

[0003] Whiteflies belong to the family Aleyrodidae of the order Homoptera. At present, there are 49 genera and 248 species of whiteflies reported in my country, which harm 74 families and 420 species of plants. Whiteflies occur seriously in various crops such as vegetables and fruits in greenhouses. During the peak period of occurrence, most growers apply chemical pesticides for crop pest control every 5 to 7 days, which easily pollutes the environment and soil. The damage caused by whiteflies to greenhouse crops can be divided into direct damage and indirect damage. Direct damage is that whiteflies suck the juice of plants with adults and nymphs, causing the leaves to fade, turn yellow, wilt, and even die. Indirect damage is that its excrement (honeydew) can induce the occurrence of mildew and affect the photosynthesis of leaves. More importantly, it can also spread a variety of crop virus diseases such as tomato yellow leaf curl virus and cucumber green mottle mosaic virus. It is necessary to develop a biological pesticide for whiteflies in this field, which has good safety, avoids the development of drug resistance in whiteflies, and has a high prevention effect and lasting effect. Summary of the invention

[0004] The present invention relates to a Javanese Cordyceps and tea cake powder composition and a use method. The Javanese Cordyceps of the present invention is isolated from diseased whiteflies in a vegetable greenhouse in Gaoliu Town, Shushan District, Hefei City, named Cordyceps javanica, and was preserved in the General Microbiological Center of China Microbiological Culture Collection Administration on April 12, 2024, with an address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the culture collection number is CGMCC NO.41285.

[0005] The strain was isolated and identified by the drug efficacy team of Hefei Gaoer Life Science Research Institute Co., Ltd. in Hefei, Anhui Province from whiteflies infected in the vegetable greenhouse of Gaoliu Town, Shushan District, Hefei City. The specific sequencing results are as follows:

[0006] ITS sequence:

[0007] AGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTAACGAGTTTTTTCAACTCCCTAACCCTTTGTGAACATACCTATCGTTGCTTCGGCGGACTCGCCCCGGCGTCCGGACGGCCCTGCGCCGCCCGCGACCC GGACCCAGGCGGCCGCCGGAGACCCACAAATTCTGTTTCCATCAGTCTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACACCCCTTCGGGGGAGTCGGCGTTGGGGACCGGCAGCATACCGCCGGCCCCGAAAT ACAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACTCCAACGCGCACCGGGAACCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

[0008] Unless otherwise specified in the present invention, the Javanese Cordyceps sinensis is collected from susceptible whiteflies.

[0009] One of the purposes of this application is to provide a method for controlling whiteflies, comprising the following steps:

[0010] (1) Dispersing Javanese Cordyceps aqueous solution, powder and tea cake powder in water to obtain a sprayable agent; the spraying amount per mu of the combination of Javanese Cordyceps aqueous solution and tea cake powder solution is: 100-600 times of Javanese Cordyceps liquid + 200 g of tea cake powder / mu; the spraying amount per mu of the combination of powder and tea cake powder solution is: 30-60 g of Javanese Cordyceps / mu + 200 g of tea cake powder / mu.

[0011] It should be noted that in the art, tea cake powder contains rich tea saponin, which has an inhibitory effect on bacteria and fungi. Adding tea saponin and other saponin substances in the form of tea cake powder will not inhibit the germination of Javanese Cordyceps spores, but can improve the insecticidal activity of Javanese Cordyceps. This may be because, on the one hand, the concentration and purity of tea saponin are diluted by other substances in tea cake powder, reducing its inhibitory effect on Javanese Cordyceps; on the other hand, the nutrients such as protein and fat in tea cake powder provide a growth environment for Javanese Cordyceps, and also offset the inhibitory effect of saponin substances; thirdly, saponin substances increase the dispersibility of Javanese Cordyceps, improve its spraying uniformity, and improve its killing effect on whiteflies. At the same time, saponin substances can also help spores enter the whitefly body faster.

[0012] Preferably, the spore concentration of the Cordyceps javanica aqueous solution is 150 million spores / mL, and the concentration after dilution is 1.5×10 6 Spores / mL (100 times dilution), 0.75×10 6 Spores / mL (200 times dilution), 0.5×10 6 Spores / mL (300 times dilution), 0.25×10 6 Spores / mL (600 times dilution); powder spore quantity is 3.5×10 9 Spores / g, dosage per mu is 30g, 40g, 50g, 60g.

[0013] (2) Spraying the spray agent on the target pests, the appropriate period is when the greenhouse temperature is 20 to 35°C.

[0014] In the method for controlling whiteflies provided in the present application, the spores produced by Javan Cordyceps are used to germinate and invade the body of whiteflies, and the spores are attached to the host epidermis, germinate and grow, and directly penetrate the epidermis to infect the host, and grow and reproduce in the insect body, consume nutrients in the host body, and also produce a variety of toxins, which eventually lead to the death of the host. The tea cake powder contains saponins, which have insecticidal and bactericidal effects, and can improve the uniform dispersibility of spores in the solution, inhibit the activity of enzymes such as protease, amylase, and phosphatase in the insect epidermal fat body, and reduce the content of DNA and RNA in the fat body, which is conducive to the germination and growth of Javan Cordyceps spores in the host epidermis, and improve the control effect of the Javan Cordyceps on whiteflies.

[0015] It should be noted that in the art, the tea cake powder solution has no effect on the activity of Cordyceps javanica spores, which is beneficial for the spores to penetrate the epidermis of whiteflies, thereby improving the control effect on target pests.

[0016] Preferably, the spore concentration of the Cordyceps javanica amplification solution is 140 to 160 million spores / mL, and the spore amount of the powder is 3.5 to 3.8 billion / g.

[0017] Preferably, 1, the Cordyceps javanica expansion liquid is obtained by diluting the Cordyceps javanica expansion liquid with water.

[0018] Preferably 2, the Cordyceps javanica powder described in the present application is obtained by amplifying Cordyceps javanica.

[0019] Preferably, the Cordyceps javanica expansion material and powder are prepared by the following method:

[0020] (a) sampling whiteflies infected with Cordyceps javanica from greenhouse cucumber plants, isolating and culturing them on potato dextrose agar medium to obtain strains of Cordyceps javanica;

[0021] (b) amplifying the strain of Cordyceps javanica in liquid culture to obtain a Cordyceps javanica amplification material, wherein the Cordyceps javanica amplification material has a spore concentration of 140 to 160 million spores / mL; the amplification medium is 5% peptone, 20% fresh potato, and 5% glucose, and the volume is fixed to 1L with water, and the medium is sterilized at 121°C with high pressure and wet heat for 30 minutes, the amplification temperature is 28 (±2)°C, the amplification culture time is 110 to 130 hours, and the amplification culture is carried out at a temperature of less than 5×10 4 Carried out under a light intensity of lx.

[0022] (c) amplifying the strain of Cordyceps javanica on solid culture to obtain a Cordyceps javanica amplification material, wherein the Cordyceps javanica amplification material has a spore concentration of 3.5 to 3.8 billion spores / g; the amplification medium is 25% fresh potato, 5% glucose, 50% wheat grain, and 20% water, and is sterilized at 121° C. with high pressure wet heat for 30 min, the amplification temperature is 28 (±2)° C., the amplification culture time is 110 to 130 h, and the amplification culture is carried out at a temperature of less than 5×10 4 Carried out under a light intensity of lx.

[0023] Since the Javanese Cordyceps fungus strain obtained by the above method is directly isolated from greenhouse cucumber plants, the spores of Javanese Cordyceps fungus are more pathogenic to whiteflies and have better and lasting protective effects.

[0024] It should be noted that after the strain described in the present application is isolated and cultured, the strain content of the Cordyceps javanica amplification solution is at least 150 million spores / mL, and the spores of Cordyceps javanica cultured on a solid body are generally above 3.5 billion spores / g.

[0025] Preferably, the expansion culture is less than 5×10 4 The separation and culture was carried out under a light intensity of lx, the separation and culture temperature was 28 (±2)°C, and the separation and culture time was 110 to 130 hours.

[0026] Preferably, the tea cake powder is obtained by crushing oil-tea tea cake.

[0027] Preferably, the particles of the tea cake powder are 2 to 8 μm.

[0028] Preferably, the oil-tea camellia kernels are hot-pressed to obtain oil-tea camellia meal, and the oil-tea camellia meal is pressed and dehydrated to obtain the oil-tea camellia cake.

[0029] After hot pressing, tea cake is obtained. The tea cake after pressing contains higher content of crude protein and crude fat, which is easier to be used as nutrition for the germination or spore growth of Cordyceps javanica.

[0030] Preferably, the oil-tea cake powder contains 11-13wt% of saponins, 11-17wt% of crude protein, 5-7wt% of crude fat, 3-5wt% of minerals and 24-35wt% of easily hydrolyzed polysaccharides.

[0031] The composition of the oil-tea cake powder can not only improve the dispersibility of the Javanese Cordyceps, but also promote the spore production and hyphae growth of the Javanese Cordyceps, and the saponin substances have no obvious inhibitory effect on the Javanese Cordyceps.

[0032] As a preferred technical solution, step (1) of dispersing the Javanese Cordyceps sinensis amplification solution and tea cake powder in water to obtain a sprayable agent can be carried out according to the following steps:

[0033] (1a) dispersing tea cake powder in a small amount of water to obtain a tea cake powder solution;

[0034] (1b) The tea cake powder solution is added to the remaining water, and then the javanica Cordyceps amplification solution is added to obtain a sprayable agent.

[0035] As a further preferred technical solution, stearic acid is added during the treatment of step (1a).

[0036] Preferably, the total amount of stearic acid added is 2.5-3.5 wt % of the mass of the tea cake powder.

[0037] The addition of stearic acid can defoam the tea cake powder solution without affecting the germination and growth of the Javanese Cordyceps after spraying. In addition, due to the effective elimination of foam, the contact between the Javanese Cordyceps and protein and fat is improved, thereby improving the germination and growth of the Javanese Cordyceps.

[0038] Preferably, after step (1a) is completed, step (1b) is performed within 10 minutes.

[0039] After step (1a) is completed, the effect of saponins on the spores of Cordyceps javanica can be reduced by carrying out step (1b) quickly. After spraying, the water evaporates quickly, the spores of Cordyceps javanica come into contact with the nutrients, and quickly enter the body of the whitefly and germinate under the action of saponins.

[0040] The Cordyceps javanica expansion material obtained by the cultivation method of Cordyceps javanica provided in the present application has a specific effect on whiteflies of greenhouse cucumbers.

[0041] Compared with the prior art, this application has the following beneficial effects:

[0042] (1) In the method for preventing and controlling greenhouse cucumber whiteflies provided in the present application, spores produced by Javan Cordyceps are used to germinate and invade the body of whiteflies to kill the whiteflies. Tea cake powder contains fat, protein, tea saponin and other ingredients, which can improve the dispersibility of the Javan Cordyceps in water and provide nutrients for the germination of Javan Cordyceps. The 10-day prevention effect of preventing and controlling greenhouse cucumber whiteflies provided in the present application can reach 83.76%.

[0043] (2) The Cordyceps javanica expansion material obtained by the cultivation method of Cordyceps javanica provided in the present application has a specific effect on greenhouse cucumber whiteflies. DETAILED DESCRIPTION

[0044] The technical solution of the present invention is further explained below in conjunction with specific implementation methods. However, it should be noted that the specific implementation methods are only a specific implementation and explanation of the essence of the technical solution of the present invention, and should not be understood as a limitation on the protection scope of the present invention.

[0045] The reagents and instruments used in the examples can all be purchased from commercial products, and the detection methods are conventional methods well known in the art.

[0046] Culture Example 1

[0047] A method for cultivating a Javanese Cordyceps sinensis aqueous solution comprises the following steps:

[0048] (a) Diseased whitefly dead insects were collected from greenhouse cucumber plants and isolated and cultured on potato dextrose agar medium to obtain strains of Cordyceps javanica. 4 lx, culture at a temperature of 28 (± 2) ° C and a humidity of 75 ± 5% for about 120 hours, until the Cordyceps javanica fills the culture medium and produces spores sufficiently;

[0049] (b) Using a sterile pipette tip, transfer 25 mL of a 0.1% Tween 80 sterile aqueous solution into the culture medium in (a) above, use a sterile coating rod to fully elute the spores, transfer the mixture to a beaker, and stir on a magnetic stirrer for 30 min to obtain a spore suspension. Adjust the concentration of the spore suspension to 10 6 / mL, as seed solution;

[0050] (c) amplifying and culturing the strain of Cordyceps javanica to obtain amplified Cordyceps javanica material; inoculating the spore suspension obtained in (b) into the amplification medium at an inoculation amount of 5% of the medium. The amplification medium is 5% peptone, 20% fresh potato, and 5% glucose, and the volume is fixed to 1L with water, and the medium is sterilized at 121°C with high pressure and wet heat for 30 minutes, the amplification temperature is 28 (±2)°C, the amplification culture time is 110 to 130 hours, and the amplification culture is carried out at ≤5×10 4 The spore concentration of the Cordyceps javanica amplification material is about 150 million spores / mL.

[0051] Culture Example 2

[0052] A solid culture method for Cordyceps javanica comprises the following steps:

[0053] (a) collecting diseased whitefly dead insects from greenhouse cucumber plants, isolating and culturing them on potato dextrose agar medium to obtain a strain of Cordyceps javanica; culturing them at a temperature of 28 (± 2) ° C. and a humidity of 75 ± 5% for about 120 hours until the Cordyceps javanica fills the medium and produces spores sufficiently;

[0054] (b) Using a sterile pipette tip, transfer 25 mL of a 0.1% Tween 80 sterile aqueous solution into the culture medium in (a) above, use a sterile coating rod to fully elute the spores, transfer the mixture to a beaker, and stir on a magnetic stirrer for 30 min to obtain a spore suspension. Adjust the concentration of the spore suspension to 10 6 / mL, as seed solution;

[0055] (c) amplifying and culturing the strain of Cordyceps javanica to obtain amplified powder of Cordyceps javanica; inoculating the spore suspension obtained in (b) into the amplification medium at an inoculation amount of 10% of the medium. The amplification medium is 25% fresh potato, 5% glucose, 50% wheat grain, and 20% water, sterilized at 121°C with high pressure and wet heat for 30 minutes, the amplification temperature is 28 (±2)°C, the amplification culture time is 110 to 130 hours, and the amplification culture is carried out at a temperature of less than 5×10 4 The method is carried out under the condition of 1x light intensity. The spore concentration of the Cordyceps javanica expansion material is about 3.5 billion spores / g.

[0056] Test 1: Indoor biological activity assay

[0057] 1.1 Preparation of Cordyceps javanica spore suspension:

[0058] The seed solution in (b) above is inoculated into the amplification medium at an inoculation volume of 20% of the culture medium. The amplification medium is 5% peptone, 20% fresh potato, 5% glucose, and water is added to 1L, and the high pressure wet heat sterilization is carried out at 121°C for 30min, the amplification temperature is 28 (±2)°C, the amplification culture time is 110-130h, and the amplification culture is carried out at ≤5×10 4 The experiment was carried out under a light intensity of 1x to obtain a spore suspension.

[0059] 1.2 Indoor infection rate determination method: Based on the preliminary test, the above spore suspension was diluted to 1.5×10 8 Spores / mL, 1.5×10 7 Spores / mL, 1.5×10 6 Spores / mL, 1.5×10 5 Spores / mL, 1.5×10 4 5 concentration gradients of spores / mL, and a solution control was set up at the same time. The cucumber leaves with whitefly nymphs were placed in a 4℃ refrigerator for treatment. When they were inactive, they were taken out and immersed in the corresponding concentration of spore suspension for 5s. The excess spore liquid was immediately taken out and the excess test insects were swept away. 20 3rd instar nymphs were retained on each leaf. The petioles were wrapped with moistened absorbent cotton to keep them moist, and they were placed in a petri dish with moistened filter paper and marked. The petri dish was covered with plastic wrap and pierced with holes. Each treatment was repeated 4 times. The treated test insects were placed in an incubator with a temperature of (25±1)℃, a relative humidity of 80%, and a light:dark ratio of 16h:8h. The results were counted after 72h. The test insects were placed under a dissecting microscope for observation. The insect body was considered infected when hyphae grew, and the total number of insects and the number of infected insects were recorded. The mortality rate of the control group <10% was considered valid data.

[0060] Infection rate (%) = number of infected insects / total number of insects

[0061] Table 1 Effects of different concentrations of Cordyceps javanica on infection of cucumber whitefly

[0062]

[0063]

[0064] From Table 1, we can see that different concentrations of Cordyceps javanica have a certain infection effect on cucumber whitefly. The higher the concentration, the higher the infection effect. 8 Spores / mL, 1.5×10 7 Spores / mL, 1.5×10 6 The infection rate of spores / mL was above 83%, and 1.5×10 5 Spores / mL, 1.5×10 4 The infection effect of spores / mL was slightly worse, at 65.00% and 31.25% respectively.

[0065] Test 2: Indoor infection rate determination method

[0066] From the test results of test 1, it can be seen that 1.5×10 8 Spores / mL, 1.5×10 7 Spores / mL, 1.5×10 6 Spores / mL have a better infection effect, so from the perspective of cost and practical field application, we chose 1.5×10 6 The infection test of the mixture of Cordyceps javanica and tea cake powder on cucumber whitefly was carried out with spores / mL.

[0067] 2.1 Method for determining indoor infection rate

[0068] Prepare 5 portions of 100 ml 1.5×10 6 spore / mL suspension, 2.0g, 1.6g, 1.2g, 0.8g, 0.4g tea cake powder were added respectively to obtain spore suspension mixtures containing 2.0wt.% tea cake powder, 1.6wt.% tea cake powder, 1.2wt.% tea cake powder, 0.8wt.% tea cake powder and 0.4wt.% tea cake powder, respectively, and a solution control (CK) was set at the same time. The specific method is detailed in Test 1.2.

[0069] Table 2 Effect of Javanese Cordyceps and tea cake powder mixture on infection of cucumber whitefly

[0070]

[0071]

[0072] From Table 2, it can be seen that the mixture of Javanese Cordyceps and tea cake powder has a good infection effect on cucumber whitefly. The spore suspension mixture containing 2.0wt.% tea cake powder, 1.6wt.% tea cake powder, and 1.2wt.% tea cake powder has a 72h infection rate of more than 86% and a 96h infection rate of more than 91%; the spore suspension mixture containing 0.8wt.% tea cake powder and 0.4wt.% tea cake powder has the highest infection rate of more than 90%; Javanese Cordyceps 1.5×10 6 The infection rates of single dose of spores / ml were 81.25% and 85.00% at 72h and 96h respectively; while the group treated with 2.0wt.% tea cake powder solution showed no infection.

[0073] From the experimental results in Table 1 and Table 2, it can be seen that adding tea cake powder can accelerate the infection speed of Javanese Cordyceps to cucumber whitefly, increase the infection rate, and increase the rapid effect of Javanese Cordyceps. Next, we will further carry out field efficacy tests to test and evaluate the actual prevention effect of the agent in the field.

[0074] Example 1

[0075] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0076] (2) Take the Javanese Cordyceps fungus expansion material (1.5×10 8 spores / mL) was diluted with appropriate amount of water to a spore concentration of 0.25×10 6 spores / mL (600 times) of the drug solution, and then poured into the tea cake powder 200g (0.4wt.%), finally obtained 0.25×10 6 A java cordyceps fungus aqueous solution containing tea cake powder with a spore / mL content; the tea cake powder is obtained by crushing hot-pressed oil-tea tea cakes to 2-8 μm, and is determined to contain 12.5 wt% of saponins, 16.5 wt% of crude protein, 6.8 wt% of crude fat, 4.2 wt% of minerals and 28.2 wt% of easily hydrolyzed polysaccharides;

[0077] (3) The amount of liquid medicine per mu is 50 liters, and the spraying agent is sprayed in the greenhouse within 10 minutes;

[0078] (4) 3, 7, and 10 days after spraying, select 5 points in step (1) again, select 5 leaves at each point, and count the number of insects on the selected leaves.

[0079] Example 2

[0080] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0081] (2) Take the Javanese Cordyceps fungus expansion material (1.5×10 8 spores / mL) was diluted with appropriate amount of water to a spore concentration of 0.5×10 6 spores / mL (300 times) of the drug solution, and then poured into the tea cake powder 200g (0.4wt.%), finally 0.5×10 6 A java cordyceps fungus aqueous solution containing tea cake powder with a spore / mL content; the tea cake powder is obtained by crushing hot-pressed oil-tea tea cakes to 2-8 μm, and is determined to contain 12.5 wt% of saponins, 16.5 wt% of crude protein, 6.8 wt% of crude fat, 4.2 wt% of minerals and 28.2 wt% of easily hydrolyzed polysaccharides;

[0082] (3) The amount of liquid medicine per mu is 50 liters, and the spraying agent is sprayed in the greenhouse within 10 minutes;

[0083] (4) The control efficacy was investigated 3, 7, and 10 days after spraying the pesticide, and the investigation method was the same as in Example 1.

[0084] Example 3

[0085] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0086] (2) Take the Javanese Cordyceps fungus expansion material (1.5×10 8 spores / mL) was diluted with appropriate amount of water to a spore concentration of 0.75×10 6 spores / mL (200 times) of the drug solution, and then poured into the tea cake powder 200g (0.4wt.%), finally obtained 0.75×10 6 A java cordyceps fungus aqueous solution containing tea cake powder with a spore / mL content; the tea cake powder is obtained by crushing hot-pressed oil-tea tea cakes to 2-8 μm, and is determined to contain 12.5 wt% of saponins, 16.5 wt% of crude protein, 6.8 wt% of crude fat, 4.2 wt% of minerals and 28.2 wt% of easily hydrolyzed polysaccharides;

[0087] (3) The amount of liquid medicine per mu is 50 liters, and the spraying agent is sprayed in the greenhouse within 10 minutes;

[0088] (4) The control effect was investigated 3d, 7d, and 10d after spraying the agent. The investigation method was the same as in Example 1.

[0089] Example 4

[0090] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0091] (2) Take the Javanese Cordyceps fungus expansion material (1.5×10 8 spores / mL) was diluted with appropriate amount of water to a spore concentration of 1.5×10 6 spores / mL (100 times) of the drug solution, and then pour in 200g of tea cake powder (0.4wt.%), and finally get 1.5×10 6 A java cordyceps fungus aqueous solution containing tea cake powder with a spore / mL content; the tea cake powder is obtained by crushing hot-pressed oil-tea tea cakes to 2-8 μm, and is determined to contain 12.5 wt% of saponins, 16.5 wt% of crude protein, 6.8 wt% of crude fat, 4.2 wt% of minerals and 28.2 wt% of easily hydrolyzed polysaccharides;

[0092] (3) The amount of liquid medicine per mu is 50 liters, and the spraying agent is sprayed in the greenhouse within 10 minutes;

[0093] (4) The control effect was investigated 3d, 7d, and 10d after spraying the agent. The investigation method was the same as in Example 1.

[0094] Example 5

[0095] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0096] (2) Take the Javanese Cordyceps amplification powder obtained in Culture Example 2 (3.5×10 9 spores / g) 30g and tea cake powder 200g are prepared into 50L spraying agent of a certain concentration; the tea cake powder is the same as that in Example 1.

[0097] (3) The amount of liquid medicine per mu is 50 liters, and the spraying agent is sprayed in the greenhouse within 10 minutes;

[0098] (4) The control efficacy was investigated 3, 7, and 10 days after spraying the pesticide, and the investigation method was the same as in Example 1.

[0099] Example 6

[0100] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0101] (2) Take the Javanese Cordyceps amplification powder obtained in Culture Example 2 (3.5×10 9 spores / g) 40g and tea cake powder 200g are prepared into 50L spraying agent of a certain concentration; the tea cake powder is the same as that in Example 1.

[0102] (3) The amount of liquid medicine per mu is 50 liters, and the spraying agent is sprayed in the greenhouse within 10 minutes;

[0103] (4) The control efficacy was investigated 3, 7, and 10 days after spraying the pesticide, and the investigation method was the same as in Example 1.

[0104] Example 7

[0105] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0106] (2) Take the Javanese Cordyceps amplification powder obtained in Culture Example 2 (3.5×109 spores / g) 50g and tea cake powder 200g are prepared into 50L spraying agent of a certain concentration; the tea cake powder is the same as that in Example 1.

[0107] (3) The amount of liquid medicine per mu is 50 liters, and the spraying agent is sprayed in the greenhouse within 10 minutes;

[0108] (4) The control efficacy was investigated 3, 7, and 10 days after spraying the pesticide, and the investigation method was the same as in Example 1.

[0109] Example 8

[0110] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0111] (2) Take the Javanese Cordyceps amplification powder obtained in Culture Example 2 (3.5×10 9 spores / g) 60g and tea cake powder 200g are prepared into 50L spraying agent of a certain concentration; the tea cake powder is the same as that in Example 1.

[0112] (3) The amount of liquid medicine per mu is 50 liters, and the spraying agent is sprayed in the greenhouse within 10 minutes;

[0113] (4) The control efficacy was investigated 3, 7, and 10 days after spraying the pesticide, and the investigation method was the same as in Example 1.

[0114] Comparative Example 1

[0115] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0116] (2) Javanese Cordyceps amplification solution (1.5×10 6 spores / mL) 300 times, 50 liters of liquid per mu;

[0117] (3) The control effect was investigated 3d, 7d, and 10d after spraying the agent. The investigation method was the same as in Example 1.

[0118] Comparative Example 2

[0119] (1) Select the cucumber greenhouses planted with Zhongnong No. 8 and implement 10m 2 , a total of 4 replicates, 5 points were selected in each replicate, 5 leaves were selected in each point, and the insect population base was investigated before spraying the pesticide;

[0120] (2) Prepare a certain amount of spraying agent according to the ratio of 200g tea cake powder per mu and 50 liters of liquid medicine;

[0121] (3) within 10 minutes, spray the spray agent in the greenhouse;

[0122] (4) The control effect was investigated 3d, 7d, and 10d after spraying the agent. The investigation method was the same as in Example 1.

[0123] Comparative Example 3

[0124] Clear water was used as blank control.

[0125] Test Results

[0126] The population reduction rate and corrected control efficacy were calculated based on the live whiteflies counts in the treated and control areas before and after pesticide application. Duncan's new multiple range "DMRT" method was used for the significance test.

[0127]

[0128] Table 3 Field control results of the embodiments and comparative examples for controlling greenhouse cucumber whiteflies

[0129]

[0130] As can be seen from Table 3, each embodiment of the present application has a certain control effect on greenhouse cucumber whiteflies, and its control effect can reach more than 71%, especially Example 4 (Javan Cordyceps Aqueous Agent 100 times liquid + tea cake powder 200g) and Example 8 (Javan Cordyceps Aqueous Agent 60g + tea cake powder 200g), whose highest control effects are 81.03% and 83.76% respectively, and there is no significant difference between the two. As can be seen from the field efficacy test results in Table 3, the quick-acting property of Javan Cordyceps Aqueous Agent can be improved by adding tea cake powder, but from the perspective of economic benefits and control requirements, Example 2 (Javan Cordyceps Aqueous Agent 300 times liquid + tea cake powder 200g) and Example 3 (Javan Cordyceps Aqueous Agent 40g + tea cake powder 200g) can meet the field control requirements.

[0131] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Javanese Cordyceps, characterized in that: It was deposited on April 12, 2024 at the General Microbiology Center of China Culture Collection Administration, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the culture collection number is CGMCC NO.41285.

2. Use of the Cordyceps javanica according to claim 1 for controlling cucumber whitefly.

3. The use of tea cake powder for increasing the infection rate of Cordyceps javanica on cucumber whiteflies, characterized in that: The Javanese Cordyceps is the Javanese Cordyceps described in claim 1.

4. A composition comprising Cordyceps javanica and tea cake powder, characterized in that: The Javanese Cordyceps is the Javanese Cordyceps according to claim 1; the spore concentration of the Javanese Cordyceps is 1×10 4 —1×10 7 spores / mL; tea cake powder concentration is 0.4-2.0wt.%.

5. The composition according to claim 4, characterized in that The spore concentration of the Javanese Cordyceps javanica is 1-9×10 6 spores / mL; tea cake powder concentration is 0.4-2.0wt.%.

6. The composition according to claim 4, characterized in that The spore concentration of the Javanese Cordyceps javanica is 1.5×10 6 spores / mL; tea cake powder concentration is 0.4-2.0wt.%.

7. Use of the composition according to any one of claims 4 to 6 for controlling cucumber whitefly.

8. A method for controlling cucumber whiteflies using a composition comprising Cordyceps javanica and tea cake powder, characterized in that: The steps include: (1) Dispersing Javanese Cordyceps aqua and tea cake powder in water to obtain a sprayable agent; the dispersion ratio of Javanese Cordyceps aqua and tea cake powder in water is: Javanese Cordyceps 100-600 times liquid + tea cake powder 100-300g / mu; (2) dispersing Javanese Cordyceps powder and tea cake powder in water to obtain a sprayable agent; the dispersion ratio of Javanese Cordyceps powder and tea cake powder in water is: Javanese Cordyceps powder 30-60 g / mu + tea cake powder 100-300 g / mu; (3) spraying the spray agent on the cucumbers; The Javanese Cordyceps is the Javanese Cordyceps described in claim 1; The spore concentration of the Javanese Cordyceps sinensis aqueous solution is 100-300 million spores / mL, and the spore amount of the Javanese Cordyceps sinensis powder is 10-50 million spores / g.

9. The method according to claim 8, characterized in that The tea cake powder is 200g / mu; the spore concentration of the Javanese Cordyceps sinensis aqueous solution is 150 million spores / mL, and the spore amount of the Javanese Cordyceps sinensis powder is 3.5 billion spores / g.

Images