Low-temperature-resistant heterotrophic nitrification-aerobic denitrification pseudomonas and application thereof

Abstract

The invention discloses a low-temperature-resistant heterotrophic nitrification-aerobic denitrification pseudomonas and application thereof, and belongs to the technical field of microorganisms, the strain of the pseudomonas is pseudomonas JL-1 (Pseudomonas silesiensis JL-1), the pseudomonas silesiensis is preserved in China General Microbiological Culture Collection Center on August 23, 2024, and the preservation number is CGMCC NO: 31730. The invention further discloses a preparation method of the low-temperature-resistant heterotrophic nitrification-aerobic denitrification pseudomonas and an application of the low-temperature-resistant heterotrophic nitrification-aerobic denitrification pseudomonas for the low-temperature-resistant heterotrophic nitrification-aerobic denitrification pseudomonas for the low-temperature-resistant heterotrophic nitrification-aerobic denitrification pseudomonas for the low-temperature-resistant heterotrophic nitrification-aerobic denitrification pseudomonas. The JL-1 strain can still effectively carry out nitrification and denitrification processes at the temperature as low as 5 DEG C, the JL-1 strain is especially suitable for sewage treatment in cold regions due to the efficient denitrification characteristic in the cold environment, and the problem that a traditional sewage treatment strain is insufficient in denitrification efficiency under the low-temperature condition is solved. Under different temperatures and conditions, the JL-1 can significantly remove nitrate nitrogen and ammonia nitrogen in a water body, the nitrogen removal rates exceed 90% under the conditions of 5 DEG C and 10 DEG C, and extremely high nitrogen removal efficiency is shown.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and more specifically to a low-temperature resistant heterotrophic nitrification-aerobic denitrification Pseudomonas and application thereof. Background Art

[0002] With the rapid development of agriculture and industry and the acceleration of urbanization, nitrogen emissions are increasing, which will cause water pollution and ecological balance damage, thus restricting ecological environmental protection and high-quality development. Therefore, there is still a long way to go to improve water environment quality and solve the problem of nitrogen pollution.

[0003] At present, the technologies for wastewater denitrification mainly include chemical methods (flocculation sedimentation, ion exchange), physical methods (adsorption, electrodialysis) and biological methods. Among them, microbial denitrification technology is widely used due to its advantages such as economy, high efficiency and environmental friendliness. Common biological denitrification processes include A 2 O, SBR, MBR, etc., mainly use microbial nitrification and denitrification metabolic pathways to achieve the conversion and removal of organic nitrogen and inorganic nitrogen in sewage. In traditional wastewater biological treatment processes, nitrification and denitrification are usually designed as two independent processes, which are carried out in different reactors or conditions. This not only increases the complexity and operating costs of the process, but also limits the improvement of treatment efficiency. With the deepening of microbiological research, some microorganisms can directly use nitrate or nitrite as electron acceptors for denitrification under aerobic conditions, thereby simplifying the treatment process and improving treatment efficiency. However, most of the known heterotrophic nitrification-aerobic denitrification microorganisms are sensitive to temperature, and their activity is significantly reduced under low temperature conditions, which limits their application in cold areas or low temperature conditions in winter. In particular, the winter in cold areas in northern my country is long, and the water temperature can drop to 6-15℃, or even below 5℃, which significantly inhibits the growth rate and metabolic activity of microorganisms, leading to poor biological denitrification efficiency and poor effluent quality.

[0004] In recent years, the application of low-temperature tolerant microorganisms in sewage treatment has gradually become a hot topic. Low-temperature tolerant heterotrophic nitrification-aerobic denitrification bacteria have the ability to complete nitrification and denitrification through a single microorganism at low temperatures, which provides the possibility for efficient denitrification under low temperature conditions. This type of microorganism can not only maintain metabolic activity at lower temperatures, but also reduce the accumulation of intermediate products and improve denitrification efficiency, thereby significantly optimizing the effect of sewage treatment in cold regions. Summary of the invention

[0005] 1. Technical problems to be solved

[0006] In view of the problems existing in the prior art, the purpose of the present invention is to provide a low-temperature resistant heterotrophic nitrification-aerobic denitrification Pseudomonas and its application, which can maintain metabolic activity at a relatively low temperature, reduce the accumulation of intermediates, and improve the denitrification efficiency, thereby significantly optimizing the effect of sewage treatment in cold regions.

[0007] 2. Technical solution

[0008] To solve the above problems, the present invention adopts the following technical solutions.

[0009] A low-temperature resistant heterotrophic nitrification-aerobic denitrifying Pseudomonas, the strain of which is Pseudomonas silesiensis JL-1 (Pseudomonas silesiensis JL-1), which was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on August 23, 2024, with the deposit address in Beijing, China, and the deposit number is: CGMCC NO: 31730.

[0010] Furthermore, the strain was subjected to PCR amplification of 16S rDNA of the strain using universal primers (27F: 5'-AGAGTTTGATCCTGGCTCAG-3 and 1492R 5'-GGTTACCTTGTTACGACTT-3').

[0011] According to the above characteristics, a sterile inoculation loop was used to gently pick up an appropriate amount of the medium on the aerobic denitrification solid culture medium for multiple streaking on the plate in a sterile operating table, and the medium was inverted and cultured at 20°C, and refrigerated at -80°C for later use.

[0012] In some embodiments, the culture medium includes an enrichment medium, an aerobic denitrification medium, and an aerobic denitrification BTB solid screening medium.

[0013] According to the above characteristics, the formula of the enrichment medium is as follows: Na3C6H5O7·2H2O4.05g / L, (NH4)2SO40.16g / L, KNO30.24g / L, NaNO20.16g / L, K2HPO40.2g / L, NaCl 0.12g / L, MgSO4·7H2O0.05g / L, CaCl20.02g / L, FeSO4·7H2O0.01g / L, MnSO40.01g / L, trace elements 1mL, pH 7.0.

[0014] According to the above characteristics, the formula of the aerobic denitrification culture medium is as follows: Na3C6H5O7·2H2O4.05g / L, KNO30.72g / L, K2HPO40.2g / L, NaCl 0.12g / L, MgSO4·7H2O0.05g / L, CaCl20.02g / L, FeSO4·7H2O 0.01g / L, MnSO40.01g / L, trace elements 1mL, pH 7.0.

[0015] According to the above characteristics, the formula of aerobic denitrification BTB solid screening medium is as follows: 0.1% bromothymol blue (BTB) solution, Na3C6H5O7·2H2O 4.05 g / L, (NH4)2SO4 0.16 g / L, KNO3 0.24 g / L, NaNO2 0.16 g / L, K2HPO4 0.2 g / L, NaCl 0.12 g / L, MgSO4·7H2O 0.05 g / L, CaCl2 0.02 g / L, FeSO4·7H2O 0.01 g / L, MnSO4 0.01 g / L, trace elements 1 mL, pH 7.0.

[0016] Furthermore, the trace element formula is as follows: H3BO3 1.5 g / L, ZnSO4·7H2O 0.06 g / L, MgSO4·7H2O 0.8 g / L, CuSO4·5H2O 0.1 g / L, CoSO4·7H2O 0.01 g / L, KI 0.18 g / L.

[0017] Preferably, low-temperature resistant heterotrophic nitrification-aerobic denitrifying Pseudomonas is used in the treatment of inorganic nitrogen-contaminated water bodies in cold regions.

[0018] 3. Beneficial effects

[0019] Compared with the prior art, the advantages of the present invention are:

[0020] 1) The JL-1 strain can still effectively carry out nitrification and denitrification processes at temperatures as low as 5°C. Its efficient denitrification characteristics in cold environments make it particularly suitable for sewage treatment in cold areas, solving the problem of insufficient denitrification efficiency of traditional sewage treatment strains under low temperature conditions.

[0021] 2) Under different temperatures and conditions, JL-1 can significantly remove nitrate nitrogen and ammonia nitrogen in water. At 5°C and 10°C, its nitrogen removal rate exceeds 90%, showing extremely high denitrification efficiency.

[0022] 3) The strain can effectively remove nitrogen under different carbon source conditions (such as sodium citrate, sodium acetate, glucose, and sodium succinate), especially when sodium succinate is used as a carbon source, it shows the best denitrification effect and lower nitrite nitrogen accumulation. Under the condition of C / N of 15, the denitrification removal rate of JL-1 strain is the best, indicating that it can achieve more effective nitrogen removal under a specific nutrient ratio.

[0023] 4) Under different rotation speeds (corresponding to different oxygen solubility), the denitrification efficiency of JL-1 strain did not change much, showing good adaptability to oxygen concentration. The optimized rotation speed of 120r / min could achieve a higher nitrate nitrogen removal rate.

[0024] 5) Due to its strong denitrification ability under a variety of conditions, the JL-1 strain has broad potential in practical sewage treatment applications, especially in applications under low temperature and variable conditions, and provides an efficient and feasible biological treatment technology for the control of inorganic nitrogen pollution in water bodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The NO3 in the nitrate nitrogen simulated sewage of different carbon sources in the present invention - -Schematic diagram of N concentration changes;

[0026] Figure 2 The NO3 in the nitrate nitrogen simulated sewage under different C / N ratios in the present invention - -Schematic diagram of N concentration changes;

[0027] Figure 3 The NO3 in the nitrate nitrogen simulated sewage at different speeds in the present invention - -Schematic diagram of N concentration changes. DETAILED DESCRIPTION

[0028] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention; it is obvious that the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments, and all other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making creative work are within the scope of protection of the present invention.

[0029] Example 1: Screening, identification and preservation of strain JL-1

[0030] Sample enrichment and screening: The sample was inoculated into a conical flask containing 100 mL of enrichment medium at 5% (w / v). Incubate at 20°C, 140 r / min for 48 hours, then transfer 5 mL of the culture medium to a new enrichment medium. Repeat the transfer and enrichment three times. Take 0.1 mL of the enrichment medium and inject it into a centrifuge tube containing 0.9 mL of sterile saline. Shake thoroughly to evenly distribute the bacteria, then press 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 Gradient dilution suspension. Take 100uL of dilutions of different gradients and add them to aerobic denitrification enrichment solid medium. Spread them evenly with a sterile coating rod, mark the numbers, and place them in a 20℃ constant temperature and humidity incubator for inversion cultivation until a single colony visible to the naked eye grows on the plate. Pick a single colony for subsequent experiments.

[0031] Strain purification: The aerobic denitrification strains obtained by screening were purified by the plate streak method. In the sterile operating table, a sterile inoculation loop was used to gently pick an appropriate amount of aerobic denitrification solid culture medium for multiple plate streaking, and then placed inverted for culture at 20°C. When the colony on the solid culture medium was single and there were no abnormal colonies, a single colony was picked and inoculated into the aerobic denitrification liquid culture medium for 24 hours. The cultured pure bacterial solution was diluted and plated, and it was verified that the screened pure bacterial solution had a consistent morphology on the aerobic denitrification solid culture medium and no mixed abnormal bacteria; it was placed under an optical microscope for observation, and the 129 aerobic denitrification strains obtained were all single strains. The purified strains were stored and refrigerated at -80°C for future use.

[0032] Rescreening of bacterial strains: The 129 bacterial strains obtained by screening and purification were separated by streaking on BTB solid plates, and then placed in a 20°C constant temperature incubator for inverted culture until single colonies visible to the naked eye grew on the plates and blue halos appeared on all bacterial strains on the plates.

[0033] Bacteria screening: 129 strains screened and purified were inoculated into aerobic denitrification liquid culture medium at 1% (v / v). Under aerobic conditions at 140 r / min and 20°C, the NO3 of each strain was measured after 24 hours of cultivation. - -N, NO2 - -N change value, the strain with the highest nitrate nitrogen removal rate and the least nitrite nitrogen accumulation was selected, and it was numbered JL-1.

[0034] Identification of strains: PCR amplification of 16S rDNA of strains was performed using universal primers (27F: 5'-AGAGTTTGATCCTGGCTCAG-3 and 1492R5'-GGTTACCTTGTTACGACTT-3'), and the amplified products were sequenced by Nanjing Paisono Biotechnology Co., Ltd. The sequence obtained was compared with the NCBI database, and the results showed that the sequence identity of JL-1 and Pseudomonas silesiensis reached 99%, but they were not exactly the same. Combined with the morphological characteristics of the strains, it was confirmed that the strain belonged to a new strain of Pseudomonas, and the strain was named Pseudomonas silesiensis JL-1.

[0035] The gene sequence of strain JL-1 is:

[0036] CCGTCCTCCCGAAGGTTAGACTAGCTACTTCTGGTGCAACCCACTCCCATGGTGTGACGGGCGGTG

[0037] TGTACAAGGCCCGGGAACGTATTCACCGCGACATTCTGATTCGCGATTACTAGCGATTCCGACTTC

[0038] ACGCAGTCGAGTTGCAGACTGCGATCCGGACTACGATCGGTTTTTCTGGGATTAGCTCCACCTCGCG

[0039] GCTTGGCAACCCTCTGTACCGACCATTGTAGCACGTGTGTAGCCCAGGCCGTAAGGGCCATGATGA

[0040] CTTGACGTCATCCCCACCTTCCTCCGGGTTTGTCACCGGCAGTCTCCTTAGAGTGCCCACCTTAACG

[0041] TGCTGGTAACTAAGGACAAGGGTTGCGCTCGTTACGGGACTTAACCCAACATCTCACGACACGAGC

[0042] TGACGACAGCCATGCAGCACCTGTCTCAATGTTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCATTGGATGTCAAGGCCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCAACTTAATGCGTTAGCTGCGCCACTAAGAGCTCAAGGCTCCCAACGGCTAGTTGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATCAGTCCAGGTGGTCGCCTTCGCCACTGGTGTTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACCCTCTACCATACTCTAGCTTGTCAGTTTTGAATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCCAACTTAACAAACCACCTACGCGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCTGTATTACCGCGGCTGCTGGCACAGAGTTAGCCGGTGCTTATTCTGTCGGTAACGTCAAAACACCTACGTATTAGGTAAATGCCCTTCCTCCCAACTTAAAGTGCTTTACAATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCAGGCTTTCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGACTGATCATCCTCTCAGACCAGTTACGGATCGTCGCCTTGGTGAGCCATTACCTCACCAACTAGCTAATCCGACCTAGGCTCATCTGATAGCGCAAGGCCCGAAGGTCCCCTGCTTTCTCCCGTAGGACGTATGCGGTATTAGCGTCCGTTTCCGAGCGTTATCCCCCACTACCAGGCAGATTCCTAGGCATTACTCACCCGTCCGCCGCTCGCCACCAGGTACAAGTACCCGTGCTGCCGCTCGACTT

[0043] Strain preservation: The strain JL-1 is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration with the deposit number: CGMCC NO: 31730.

[0044] Example 2: Evaluation of denitrification effect of strain JL-1 under low temperature conditions

[0045] Simulated sewage was prepared: Nitrate nitrogen simulated sewage (g / L): Na3C6H5O7·2H2O4.05, KNO30.72, K2HPO40.2, NaCl 0.12, MgSO4·7H2O0.05, CaCl20.02, FeSO4·7H2O0.01, MnSO40.01, trace elements 1mL, pH 7.0. Ammonia nitrogen simulated sewage: Na3C6H5O7·2H2O4.05, (NH4)2SO40.47, K2HPO40.2, NaCl 0.12, MgSO4·7H2O0.05, CaCl20.02, FeSO4·7H2O0.01, MnSO40.01, trace elements 1mL, pH 7.0. The bacterial solution cultured to the logarithmic phase (OD600=1) was taken and inoculated into nitrate nitrogen simulated sewage and ammonia nitrogen simulated sewage at an inoculum amount of 1% (v / v). The culture was carried out for 48h and 72h at a speed of 140r / min, pH 7.0, and a temperature of 5°C and 10°C. After the culture period, the water sample in the bottle was filtered with a 0.22μm filter membrane, and the filtrate was removed to determine the concentrations of ammonia nitrogen, nitrate nitrogen and nitrite nitrogen. The results are shown in Table 1.

[0046]

[0047] As shown in Table 1, the removal rate of nitrate nitrogen by JL-1 strain increased significantly with the increase of culture time under 5℃ culture conditions, and the removal rate of nitrate nitrogen by the strain reached 90.74% after 3 days of culture. When the temperature was raised to 10℃, the nitrate nitrogen removal efficiency of JL-1 strain was greatly improved compared with that under 5℃, showing efficient denitrification ability, and the strain had heterotrophic nitrification at both 10℃ and 5℃, and the removal rate of ammonia nitrogen was higher than 90% within 3 days of culture. Although temperature affects the growth, reproduction and metabolism of microorganisms by affecting solute transport, microbial metabolism, the structure and function of proteins and nucleic acids, as well as cell division, gene regulation and RNA synthesis, the experimental results show that JL-1 strain has good heterotrophic nitrification-aerobic denitrification function in a shorter culture time.

[0048] Example 3: Effect of carbon source on denitrification efficiency of strain JL-1

[0049] Sodium citrate, sodium acetate, glucose, and sodium succinate were selected as the only carbon source in the nitrate nitrogen simulated wastewater. The bacterial solution cultured to the logarithmic phase (OD600 = 1) was taken and inoculated into the nitrate nitrogen simulated wastewater at an inoculum of 1% (v / v). The culture was carried out under a carbon-nitrogen ratio of 10:1, a speed of 140 r / min, a pH of 7.0, and a temperature of 10°C under aerobic conditions. Samples were taken every 6 hours and shaken for 48 hours to determine the NO3 - -N concentration, the results are as follows Figure 1 As shown in the figure, the carbon source utilization and nitrogen removal effects of the strains vary greatly. Sodium succinate, sodium citrate, glucose growth and NO3 - -N removal effect was good, especially when sodium succinate was used as the carbon source. After 48h of culture, strain JL-1 and - -N removal rate can reach 100%, and NO2 - -N accumulation was relatively small, indicating that sodium succinate as a carbon source was more conducive to the growth of bacteria and the degradation of NO3 - Removal of -N.

[0050] Example 4: Effect of different C / N on the denitrification efficiency of strain JL-1

[0051] Sodium succinate was used as the carbon source. The corresponding simulated wastewater was prepared with C / N values ​​of 5, 10, 15, 20, and 25. The bacterial solution cultured to the logarithmic phase (OD600 = 1) was taken and inoculated into the nitrate nitrogen simulated sewage at an inoculum of 1% (v / v). The culture was carried out at a speed of 140 r / min, pH 7.0, and temperature of 10 ° C. Samples were taken every 6 hours and cultured for 48 hours to determine the NO3 - -N concentration, the results are as follows Figure 2 As shown in the figure, under different C / N conditions, the denitrification capacity of the strains is also different. Under the condition of C / N of 15, the removal rate of strain JL-1 is 95.69%, which is relatively good.

[0052] Example 5: Effect of different rotation speeds on the denitrification efficiency of strain JL-1

[0053] The simulated sewage was prepared with sodium succinate as the carbon source, C / N=15, and pH=7. The bacterial solution cultured to the logarithmic phase (OD600=1) was aspirated and inoculated into the nitrate nitrogen simulated sewage at an inoculum of 1% (v / v). The temperature was 10°C and the rotation speed was 90r / min, 120r / min, 150r / min, 160r / min, and 170r / min for 48h. Samples were taken every 6h to measure the NO3 - -N concentration, the results are as follows Figure 3As shown. In the process of aerobic denitrification and nitrification, dissolved oxygen is one of the main control parameters. After setting different speeds, it was found that the speed had little effect on aerobic denitrification, nitrification and growth. When the speed was 120r / min, the nitrate nitrogen removal rate was higher.

[0054] The above is only a preferred specific implementation of the present invention; however, the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solution and its improved conception within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A low-temperature resistant heterotrophic nitrification-aerobic denitrification Pseudomonas, characterized in that: The Pseudomonas strain is Pseudomonas silesiensis JL-1, which was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on August 23, 2024, with the deposit number: CGMCC NO: 31730.

2. The low-temperature resistant heterotrophic nitrification-aerobic denitrification Pseudomonas according to claim 1, characterized in that: The strain was subjected to PCR amplification of 16S rDNA using universal primers (27F: 5'-AGAGTTTGATCCTGGCTCAG-3 and 1492R 5'-GGTTACCTTGTTACGACTT-3').

3. The method for culturing a low-temperature resistant heterotrophic nitrification-aerobic denitrifying Pseudomonas according to claim 1, characterized in that: In a sterile operating table, use a sterile inoculation loop to gently pick up an appropriate amount of aerobic denitrification solid culture medium and streak it multiple times on the plate, place it in an inverted culture at 20℃, and refrigerate it at -80℃ for later use.

4. The method for culturing a low-temperature resistant heterotrophic nitrification-aerobic denitrifying Pseudomonas according to claim 3, characterized in that: The culture medium comprises an enrichment culture medium, an aerobic denitrification culture medium and an aerobic denitrification BTB solid screening culture medium.

5. Use of the low-temperature resistant heterotrophic nitrification-aerobic denitrification Pseudomonas as claimed in claim 1 in the treatment of inorganic nitrogen polluted water in cold regions.

Images