Klebsiella LBTRJ-TB3 and application thereof
Klebsiella LBTRJ-TB3 obtained from soil samples was solved by screening and mutagenesis of Klebsiella LBTRJ-TB3 in the prior art, which was costly, difficult to operate and limited resources when dealing with organic pollutants in the environment, efficient degradation of catechol was achieved, and the resources of degraded strains were enriched.
Patent Information
- Application Number
- CN202510067609.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-16
- Publication Date
- 2025-04-25
AI Technical Summary
In the prior art, when dealing with organic pollutants in the environment, especially catechol, there are problems such as high cost, difficulty in operation and easy to cause secondary pollution, and the resources for degrading strains are limited.
By screening and mutagenesis from soil samples that have been immersed in organic waste environment for a long time, a mutant strain Klebsiella LBTRJ-TB3, which has a high-efficiency degradation of catechol was obtained and inoculated into a specific liquid culture medium, and efficient degradation of catechol was achieved.
Klebsiella LBTRJ-TB3 can completely degrade 10mM of catechol within 24 hours and completely degrade 5mM of catechol within 48 hours, showing strong degradation ability and enriching the resources of catechol microbial degradation bacteria.
Smart Images
Figure CN119875910A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a Klebsiella LBTRJ-TB3 strain and an application thereof. Background Art
[0002] Catechol, also known as catechol or pyrocatechol, exists in nature in the form of various derivatives. It is an important fine chemical raw material and is widely used in pesticides, medicines, spices, dyes, photosensitive materials, rubber and other industries. Catechol can also be used as a rubber hardener, electroplating additive, skin preservative and bactericidal agent, hair dye, photographic developer, color photography antioxidant, fur dyeing developer, and paint anti-skinning agent. Although catechol has extremely wide applications in industrial production, it is a type of highly toxic and difficult to decompose carcinogenic organic matter. On October 27, 2017, the World Health Organization's International Agency for Research on Cancer announced that catechol was on the list of Class 2B carcinogens.
[0003] Traditional physical and chemical methods, such as adsorption and redox methods, for treating organic pollutants in the environment have disadvantages such as high cost, difficult operation, and easy to cause secondary pollution. In contrast, microorganisms have many advantages such as fast reproduction speed, targeted transformation and decomposition of pollutants, and in-situ repair at the pollution point, and have great potential in the field of organic matter degradation. As a common organic pollutant, the strains of catechol degradation bacteria are relatively fixed, and the strain resources are in urgent need of expansion and exploration. Summary of the invention
[0004] The purpose of the present invention is to provide a Klebsiella LBTRJ-TB3 strain and an application thereof, and to provide a new strain for degrading catechol.
[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0006] The present invention provides a Klebsiella sp. LBTRJ-TB3, which is deposited in Guangdong Microbiological Culture Collection Center, with the address of Building 59, 5th Floor, No. 100 Xianlie Middle Road, Guangzhou, the preservation date of which is October 21, 2024, and the preservation number of which is GDMCC No: 65305.
[0007] Preferably, the 16S rRNA of Klebsiella LBTRJ-TB3 is shown as SEQ ID NO.1.
[0008]
[0009] The present invention provides a preparation comprising the Klebsiella LBTRJ-TB3.
[0010] The present invention provides an application of the Klebsiella LBTRJ-TB3 or the preparation in degrading catechol.
[0011] Compared with the prior art, the present invention has the following beneficial effects:
[0012] The present invention screened and mutated a mutant strain, Klebsiella LBTRJ-TB3, which has a highly efficient degradation effect on catechol from soil samples that have been immersed in an organic waste environment for a long time. The strain was inoculated into an M9 liquid culture medium containing 10mM catechol as a sole carbon source, and the catechol was completely converted and degraded within 24 hours; and the strain was inoculated into an M9 liquid culture medium containing 5mM catechol and glycerol as a second carbon source, and the catechol was completely converted and degraded within 48 hours.
[0013] The Klebsiella LBTRJ-TB3 provided by the present invention enriches the resources of catechol microbial degradation bacteria, provides strain resources and method references for the biological treatment of organic pollutants such as catechol, and has feasible application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.
[0015] Figure 1 The growth condition of the efficient degradation mutant strain in Example 2 on LB solid medium;
[0016] Figure 2 The results of electron microscope observation of the highly efficient degradation mutant strain in Example 2, the scale bar in the figure is 5 μm;
[0017] Figure 3 The change of catechol concentration after the efficient degradation mutant strain in Example 3 was inoculated in M9 liquid culture medium with 5 mM catechol and 50% glycerol as carbon sources;
[0018] Figure 4 The change of catechol concentration after the efficient degradation mutant strain in Example 3 was inoculated into M9 liquid culture medium with 10 mM catechol as the sole carbon source;
[0019] Figure 5 This is a diagram showing the state of the natural degradation strain and the efficient degradation mutant strain before mutagenesis in Example 3 after being inoculated and cultured on LB solid culture medium containing a final concentration of 10 mM catechol.
[0020] Collection Instructions
[0021] Klebsiella sp. LBTRJ-TB3, the strain is deposited in the Guangdong Microbiological Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The deposit date is October 21, 2024, and the deposit number is GDMCC No: 65305. DETAILED DESCRIPTION
[0022] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0023] Example 1
[0024] The steps for obtaining Klebsiella LBTRJ-TB3 are as follows:
[0025] (1) Soil samples near the factory that had been immersed in an organic waste environment for a long time were used as the source of bacterial strains and inoculated into M9 liquid culture medium with 2 mmol / L catechol as the sole carbon source. The culture medium formula was as follows: 1 g NH4Cl, 12.8 g Na2HPO4·7H2O, 0.5 g NaCl, 3 g KH2PO4, 1 mol / L MgSO4·7H2O, 0.1 mol / LCaCl2 and 1 mol / L VB1 per liter of liquid culture medium. After enrichment culture at 30°C and 160 rpm in a shaker until obvious turbidity appeared, 500 μL of the bacterial suspension was taken and cultured in 20 mL of the above new culture medium, and the screening was repeated 3 times;
[0026] (2) diluting the bacterial suspension obtained after screening in step (1) and applying it on an M9 solid plate containing 2 mmol / L catechol as the sole carbon source, wherein the solid plate is obtained by adding 16 g / L agar to the liquid culture medium in step (1);
[0027] (3) A single clone on the solid plate was picked and purified by the plate streak method on a new M9 solid plate containing 2 mmol / L catechol as the sole carbon source to obtain a natural degrading bacteria.
[0028] (4) The natural degrading bacteria obtained in step (3) were inoculated into LB liquid culture medium and cultured at 37°C and 160 rpm until the late logarithmic growth period, and the OD of the bacterial suspension was 600>1; wherein the formula of the LB liquid culture medium used is: 5g NaCl, 5g yeast extract powder and 10g tryptone per liter of liquid culture medium;
[0029] (5) Take 20 mL of the bacterial suspension obtained in step (4), centrifuge at 12000 rpm for 3 min, wash the bacterial precipitate twice with deionized water, and suspend the bacterial precipitate with 5% glycerol to adjust the OD 600 Between 0.6 and 0.8;
[0030] (6) Take 10 μL of the bacterial suspension obtained after treatment in step (5) and spread it on a round iron sheet with a diameter of 1 cm. Place the iron sheet in a plasma mutagenesis instrument, treat the bacterial suspension with a normal pressure and room temperature plasma source using helium as the working gas for 40 seconds, then place it in 1 mL of LB liquid culture medium and shake it at 37°C and 160 rpm for 4 hours;
[0031] (7) using a plate spreading method to spread the mutagenized bacterial solution obtained in step (6) onto an LB solid medium containing catechol at a final concentration of 10 mmol / L; wherein the LB solid medium is obtained by adding 16 g / L agar to LB liquid medium;
[0032] (8) A single clone was picked and purified using the plate streak method on a new LB solid medium containing a final concentration of 10 mmol / L catechol to obtain a mutant strain with high efficiency in degrading catechol.
[0033] Example 2 Observation of strain morphological characteristics and molecular biological identification
[0034] 1. Morphological characteristics
[0035] The highly efficient degradation mutant strain obtained in Example 1 was inoculated on LB solid medium and the colony growth was observed after overnight culture for 16 hours. The results are as follows: Figure 1 .
[0036] At the same time, the shape of the colonies was observed under an electron microscope. Figure 2 As shown. Figure 2 It can be seen that the colony morphology of the strain is short and thick rod-shaped or irregular in shape, without flagella and spores, and the colony size is about 1-1.2 μm × 7-8 μm. Gram staining found that the bacteria were negative.
[0037] 2. Molecular Biology Identification
[0038] The 16S rRNA gene sequence of the strain was amplified and sequenced by PCR using 16S universal primers (the forward primer is shown in SEQ ID NO.2 (AGAGTTTGATCCTGGCTCAG), and the reverse primer is shown in SEQ ID NO.3 (TAGGGTTACCTTGTTACGACTT)). The PCR amplification system used was: Taq enzyme 10μL, ddH2O 8μL, forward primer 0.5μL, reverse primer 0.5μL, bacterial DNA 1μL, and the PCR reaction conditions were: 95℃3min; 95℃30s, 60℃30s, 72℃60s, 35 cycles; 72℃10min; 4℃ storage. The bands after PCR amplification were detected by agarose gel electrophoresis, and the single amplification results of the bands were sent to Qingke Biotechnology Company for gene sequencing. The 16S rRNA sequence obtained by sequencing was compared and analyzed with the existing sequences in the NCBI database.
[0039] The sequence of the 16S rRNA of the obtained efficient degradation mutant is shown in SEQ ID NO.1, and the results show that the 16S rRNA of the strain has more than 99% sequence identity with the 16S rRNA of the genus Klebsiella. Based on the colony morphological characteristics, the strain was identified as Klebsiella sp., named Klebsiella LBTRJ-TB3, and preserved in the Guangdong Provincial Microbiological Culture Collection Center, with an address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and a preservation date of October 21, 2024, and a preservation number of GDMCC No: 65305.
[0040] Example 3
[0041] The purpose of this example is to study the degradation of catechol by a highly efficient degradation mutant strain (Klebsiella LBTRJ-TB3) in an M9 liquid medium with 1-10 mM (mM = mmol / L) catechol as the sole carbon source or an M9 liquid medium with 1-8 mM catechol and 50% glycerol as the carbon source. The results of the study on the highest concentration of catechol that the highly efficient degradation mutant strain can degrade are as follows:
[0042] The highly efficient degradation mutant strain was inoculated in M9 liquid culture medium with 5 mM catechol and 50% glycerol as carbon sources, and the M9 liquid culture medium with 5 mM catechol as the sole carbon source inoculated with other bacteria isolated in step (3) of Example 1 was used as a control. The culture was carried out at 30°C and 160 rpm, and the concentration of catechol in the culture medium was counted every 4 or 8 hours. The results are shown in FIG. Figure 3 shown.
[0043] The highly efficient degradation mutant strain was inoculated in M9 liquid culture medium with 10 mM catechol as the sole carbon source, and the M9 liquid culture medium with 10 mM catechol as the sole carbon source inoculated with other bacteria isolated in step (3) of Example 1 was used as a control. The culture was carried out at 30°C and 160 rpm, and the concentration of catechol in the culture medium was counted at 4, 8, 12, 18 and 24 h of culture. The results are shown in FIG. Figure 4 shown.
[0044] Depend on Figure 3 and Figure 4 It can be seen that when cultured in M9 liquid medium with catechol as the only carbon source, the efficient degradation mutant strain can degrade up to 10mM catechol and maintain growth; when cultured in M9 liquid medium with catechol as the first carbon source and glycerol as the second carbon source, the efficient degradation mutant strain can degrade up to 5mM catechol (the reason why the strain's ability to degrade catechol decreases when glycerol is used as the second carbon source is that in the presence of glycerol, the strain is more inclined to preferentially use the existing carbon source rather than obtaining the carbon source by degrading catechol). It can be seen that the efficient degradation mutant strain can grow under the selection pressure of high concentration of catechol; and in the presence of other carbon sources, it still has a good degradation ability for catechol.
[0045] The inventors also inoculated the natural degradation bacteria (i.e., the strain before mutation) and the efficient degradation mutant strain obtained in step (3) of Example 1 into LB solid medium containing a final concentration of 10 mM catechol, and observed the growth of the colonies after culturing at 30°C for 48 h. The results are as follows: Figure 5 As shown, it can be seen that the natural degradation bacteria obtained in step (3) of Example 1 cannot grow normally on the LB solid medium containing a final concentration of 10 mM catechol, while the efficient degradation mutant strain can grow normally on the LB solid medium containing a final concentration of 10 mM catechol. This indicates that the mutant strain obtained by mutating the natural degradation bacteria has a stronger ability to degrade catechol.
[0046] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A strain of Klebsiella sp. LBTRJ-TB3, which is deposited in the Guangdong Provincial Microbiological Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The deposit date is October 21, 2024, and the deposit number is GDMCC No: 65305.
2. The Klebsiella LBTRJ-TB3 according to claim 1, characterized in that The 16S rRNA of Klebsiella LBTRJ-TB3 is shown as SEQ ID NO.
1.
3. A preparation comprising the Klebsiella LBTRJ-TB3 according to claim 1 or 2.
4. Use of the Klebsiella LBTRJ-TB3 according to claim 1 or 2 or the preparation according to claim 3 in degrading catechol.