Breeding of gellan gum producing strain and method for producing gellan gum by using strain fermentation method

Abstract

The invention discloses breeding of a gellan gum producing strain and production of gellan gum by using the strain or a recombinant strain thereof through a fermentation method, and belongs to the technical field of biology. According to the present invention, a sphingomonas paucimobilis FMME-GG374 is screened, the preservation number is CCTCC M 20242350, gene editing is performed on the sphingomonas paucimobilis FMME-GG374 by using a Crispr-Cas9 tool, and key genes gelK, gelA and gelL in a gellan gum synthesis path are respectively or simultaneously integrated to by-product path genes ldhA, poxB and crtI sites so as to obtain the recombinant strain with the high yield of gellan gum. The invention also discloses a method for producing the gellan gum by fermenting the strain or the recombinant strain thereof. The yield of the gellan gum is 20.0 g / L after the gellan gum is fermented for 60 hours in a 15L fermentation tank by adopting the method.

Description

Technical Field

[0001] The invention relates to the breeding of a strain producing gellan gum and the production of gellan gum by a fermentation method using the strain, belonging to the field of biotechnology. Background Art

[0002] Gellan gum is a bacterial extracellular polysaccharide with excellent physical and chemical properties. Its main chain is composed of four monosaccharide molecules, namely β-1,3-D-glucose, β-1,4-D-glucuronic acid, β-1,4-D-glucose, and α-1,4-L-rhamnose. The relative molecular mass can reach 5×10 5 Da. Gellan gum has good stability, gelling, compatibility, dispersibility and transparency. It has been approved by the United States, the European Union, China and other countries to be used as a food additive. As a gelling agent, stabilizer, adhesive, thickener and film-forming agent, it is widely used in sausages, ice cream, jelly, dairy products, eye drops, sustained-release drugs, toothpaste, air fresheners, etc. It has broad application prospects in the fields of food, medical treatment, chemical industry, etc., and the global demand is growing. The development and production of gellan gum has extremely high commercial value and market prospects.

[0003] The production of gellan gum mainly depends on the fermentation process of Sphingomonas paucimobilis Spau. However, the yield of gellan gum produced by fermentation of wild strains of Sphingomonas paucimobilis Spau is low, resulting in a high price of gellan gum on the market, which limits the large-scale application of gellan gum. This strain is a non-model strain. Up to now, except for the three-parent conjugation method, there is no efficient gene editing tool that can be used to genetically modify Sphingomonas paucimobilis Spau. The editing efficiency of the three-parent conjugation method is low, and it is currently only used to edit limited genes, and the yield improvement effect of the obtained engineered strain is limited. Therefore, how to construct an efficient gene editing tool suitable for this species, so as to perform gene editing on it to obtain a high-yield strain, so as to improve production efficiency and reduce production costs, is a problem that needs to be solved. Summary of the invention

[0004] [Technical issues]

[0005] The yield of gellan gum produced by fermentation of wild Sphingomonas paucimobilis strains is low, and there is a lack of efficient gene editing tools to modify strains to increase yields. The low yield of gellan gum makes the price of gellan gum high in the market, limiting the large-scale application of gellan gum.

[0006] [Technical solution]

[0007] In order to solve the above problems, the present invention provides a recombinant Sphingomonas paucimobilis strain capable of efficiently producing gellan gum and a method for producing gellan gum by fermentation using the strain.

[0008] The first object of the present invention is to provide a recombinant Sphingomonas paucimobilis, which is based on a gellan gum-producing Sphingomonas paucimobilis FMME-GG374 as a starting strain, and gelA, gelL and gelK are integrated into its genome separately or simultaneously, gelA is integrated into the ldhA gene site, gelL is integrated into the poxB gene site, and gelK is integrated into the crtI gene site;

[0009] The gellan gum-producing Sphingomonas paucimobilis FMME-GG374 was deposited in the China Center for Type Culture Collection (CCTCC) on October 28, 2024, with a deposit number of CCTCCM20242350, and the deposit address is Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The Sphingomonas paucimobilis FMME-GG374 is a Sphingomonas paucimobilis that can produce gellan gum obtained by screening from the surface soil sample of Lihu Lake in Wuxi City.

[0010] The gelA is a gene encoding a regulatory protein of the gellan gum synthesis gene cluster, the gelL is a gene encoding a glucosyl glucuronyl transferase, the gelK is a gene encoding a regulatory protein of the gellan gum monosaccharide assembly gene, the ldhA is a gene encoding a lactate dehydrogenase, the poxB is a gene encoding a pyruvate dehydrogenase, and the crtI is a gene encoding a phytoene dehydrogenase.

[0011] The second object of the present invention is to provide a method for constructing the recombinant Sphingomonas paucimobilis, comprising the following steps:

[0012] (1) Preparing the competent cells of Sphingomonas paucimobilis FMME-GG374, mainly comprising the following steps:

[0013] ① First, streak the Sphingomonas paucimobilis FMME-GG374 on a YM solid plate and culture it at 30°C for 24 hours. Then, wash the bacteria on the plate with sterile water, and treat the collected bacterial solution with an ice bath to inhibit bacterial growth;

[0014] ② Then, collect the cells by centrifugation and wash them twice with pre-cooled 10% glycerol;

[0015] ③Finally, add pre-cooled 10% glycerol to the centrifuge tube, resuspend the bacteria, and dispense into 100 μL of competent cells per tube;

[0016] The temperature of the pre-cooled 10% glycerol is -40°C;

[0017] (2) Using the Crispr-Cas9 dual plasmid system, gelA, gelL and / or gelK were integrated into the genome of Sphingomonas paucimobilis FMME-GG374, with gelA integrated into the ldhA gene locus, gelL integrated into the poxB gene locus, and gelK integrated into the crtI gene locus;

[0018] The Crispr-Cas9 dual plasmid system, i.e., the recombinant pCas plasmid and the recombinant pN20 plasmid, wherein the recombinant pCas plasmid is a pCas9 replicon replaced by an oriV replicon (SEQ ID NO: 5) derived from pBBR1 MCS2, and the recombinant pN20 plasmid is a pSGN20 replicon replaced by a pSC101ori replicon (SEQ ID NO: 1) derived from pSC101, and both plasmids can replicate in Sphingomonas paucimobilis;

[0019] ① The recombinant pCas plasmid was electroporated into the competent cell of Sphingomonas paucimobilis FMME-GG374 to obtain the FMME-GG374-pCas strain, and the FMME-GG374-pCas competent cells were prepared according to step (1);

[0020] ② Use primers with upstream and downstream homology arm sequences of the integration site to amplify pSGN20 to obtain the recombinant pN20 plasmid;

[0021] ③ Perform fusion PCR on the gene fragment to be integrated and the upstream and downstream homologous arms of the integration site to obtain the gene integration frame;

[0022] ④ The recombinant pN20 plasmid amplified in ② and the gene integration frame obtained in ③ were transferred into FMME-GG374-pCas competent cells to obtain a strain after gene integration, and then the recombinant pN20 plasmid and the recombinant pCas plasmid were removed to obtain the recombinant Sphingomonas paucimobilis.

[0023] In some embodiments of the present invention, gelA, gelL, and gelK are successively integrated into the ldhA gene site, the poxB gene site, and the crtI gene site, respectively, to obtain recombinant bacteria: FMME-GG001, FMME-GG002, and FMME-GG003, respectively.

[0024] In some embodiments of the present invention, when FMME-GG374 or FMME-GG374-pCas competent cells are electroporated, the voltage used is 2500 V / mm.

[0025] The third object of the present invention is to provide a method for producing gellan gum, which comprises using sucrose as a carbon source and soybean meal powder as a nitrogen source, and fermenting using the Sphingomonas paucimobilis FMME-GG374 or its recombinant strains FMME-GG001, FMME-GG002, and FMME-GG003.

[0026] In one embodiment of the present invention, the initial concentration of sucrose in the fermentation medium is 30-40 g / L, and 10 g / L sucrose is added after 18-20 hours of fermentation.

[0027] In one embodiment of the present invention, the concentration of the soybean meal powder in the fermentation medium is 3 g / L.

[0028] In one embodiment of the present invention, the fermentation medium specifically comprises (per L): 30-40 g sucrose, 3 g soybean meal powder, 1 g ammonium chloride, 2 g potassium dihydrogen phosphate, 1.2 g magnesium sulfate heptahydrate, and 1 g light calcium carbonate. 10 g / L sucrose is added after 18-20 h of fermentation.

[0029] In one embodiment of the present invention, the initial ventilation volume of fermentation is 1 vvm, and the initial stirring speed is 300 r / min; when the dissolved oxygen is lower than 30% during the fermentation process, the stirring and speed are linked to the dissolved oxygen control at 30% to 100%.

[0030] In one embodiment of the present invention, the fermentation temperature is 30°C.

[0031] In one embodiment of the present invention, the pH of the fermentation broth is controlled to be 7.0 during the fermentation process.

[0032] In one embodiment of the present invention, 500 μg / mL cyclo(L-Pro-L-Phe) is added during the fermentation process.

[0033] The fourth object of the present invention is to provide the use of the method for producing gellan gum by Sphingomonas paucimobilis FMME-GG374 or its recombinant strain in the production of gellan gum and / or its derivatives.

[0034] [Beneficial Effects]

[0035] The present invention obtains Sphingomonas paucimobilis FMME-GG374 through breeding, and uses Crispr-Cas9 tool to edit its gene, and integrates gelK, gelA, gelL, the key genes of gellan gum synthesis pathway, into the sites of ldhA, poxB, crtI, the byproduct pathway genes, respectively or simultaneously, to obtain recombinant strains FMME-GG001, FMME-GG002, and FMME-GG003, which show high gellan gum production capacity. By optimizing the fermentation medium components and fermentation conditions, and adding signal molecules exogenously, in the fermentation of 15L fermenter level, the yield and yield of gellan gum after fermentation for 60h reach 20.0g / L and 0.5g / g, respectively, and the strain has the potential for industrial application of efficient production of gellan gum.

[0036] Sphingomonas paucimobilis produces gellan gum. Since the product gellan gum is a macromolecular polysaccharide and is wrapped on the surface of the bacteria, conventional shaking flask bacterial liquid centrifugation cannot effectively separate the required bacteria, which will significantly affect the preparation of competent cells. In the process of preparing the competent state of Sphingomonas paucimobilis, the present invention uses a solid plate culture medium to culture the bacteria, uses sterile water to wash and collect the bacteria, and washes the bacteria with pre-cooled 10% glycerol to remove residual culture medium and impurities such as polysaccharides. After the competent state is prepared, the present invention uses electrotransformation to transfer the plasmid into the competent state, and the voltage is selected to be 2500V / mm, which has better transformation efficiency.

[0037] When the Crispr-Cas9 dual plasmid system is used to transform Sphingomonas paucimobilis, the replicons of the Cas9 plasmid and the pSGN20 plasmid are replaced, so that the transformed plasmid can be stably replicated and expressed in Sphingomonas paucimobilis.

[0038] Biomaterial Deposit

[0039] Sphingomonas paucimobilis FMME-GG374 was deposited in the China Center for Type Culture Collection (CCTCC) on October 28, 2024, with the deposit number CCTCC M 20242350, and the deposit address is Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 : Schematic diagram of pCas plasmid and pN20 plasmid;

[0041] Figure 2 :FMME-GG374ΔcrtI::Egfp strain fluorescence colorimetric plate;

[0042] Figure 3 : Gellan gum biosynthetic pathway;

[0043] Figure 4 : Growth curves of FMME-GG003 and FMME-GG374 strains;

[0044] Figure 5 : Gellan gum production of FMME-GG003 and FMME-GG374 strains. DETAILED DESCRIPTION

[0045] The yield of gellan gum was detected by ethanol precipitation method: 5-10 mL of fermentation liquid was diluted 5 times with deionized water, boiled in water bath for 15 minutes, centrifuged at 8000 rpm and 4°C for 30 minutes, and the precipitated bacteria were removed; the supernatant was collected and 2-3 times the volume of anhydrous ethanol solution was added to it, placed in a refrigerator at 4°C for overnight precipitation, centrifuged at 8000 rpm and 4°C for 10 minutes, the precipitate was collected on a pre-dried and weighed tin foil, and dried in an oven at 80°C to constant weight. The yield of gellan gum was calculated.

[0046] Sucrose determination method: Analyze using phenol-sulfuric acid colorimetric method.

[0047] Calculation of sucrose yield: sucrose yield (%) = maximum gellan gum yield (g / L) / total sucrose addition (g / L) × 100%.

[0048] YPG medium: 20 g glucose, 3 g yeast extract, 5 g peptone, adjust pH to 6.8-7.2 with sodium hydroxide, make up to 1 L with distilled water, and sterilize at 121°C for 20 min.

[0049] Slant culture medium: sucrose 10g, peptone 5g, yeast extract 3g, beef extract 2g, sodium chloride 5g, agar powder 20g, adjust pH to 6.8-7.2 with sodium hydroxide, make up to 1L with distilled water, and sterilize at 121℃ for 20min.

[0050] Seed culture medium: 20 g sucrose, 5 g soy peptone, 3 g yeast extract powder, 5 g sodium chloride, adjust pH to 6.8-7.2 with sodium hydroxide, make up to 1 L with distilled water, and sterilize at 121°C for 20 min.

[0051] YM solid culture medium: 10 g glucose, 5 g tryptone, 3 g malt extract, 3 g yeast powder, 20 g agar powder, adjust the pH to 6.8-7.2 with sodium hydroxide, make up to 1 L with distilled water, and sterilize at 121°C for 20 min.

[0052] Fermentation medium: 40 g sucrose, 3 g soybean meal, 1 g ammonium chloride, 2 g dipotassium hydrogen phosphate, 1.2 g magnesium sulfate heptahydrate, 1 g light calcium carbonate, adjust pH to 6.8-7.2 with sodium hydroxide, make up to 1 L with distilled water, and sterilize at 121°C for 20 min.

[0053] Example 1: Screening and identification of the gellan gum producing strain Sphingomonas paucimobilis FMME-GG001

[0054] (I) Screening of gellan gum producing strains

[0055] 1. Enrichment culture and initial screening of strains

[0056] In order to obtain wild strains that produce gellan gum, 10g of fresh Lihu surface soil samples were taken, shaken in sterile saline for 10min, and then transferred to a total volume of 100mL YPG medium. After culturing at 30℃ for 24h, the inoculation volume was transferred once according to 30%. The enriched bacterial solution was gradient diluted, spread on YPG agar medium, and cultured at 30℃. After 32h, some colonies turned yellow, and yellow strains were selected for strain preservation and further verification and fermentation.

[0057] 2. Rescreening of strains

[0058] 196 strains of yellow strains (single colony yellow, neat edges) were inoculated in the seed culture medium of 24 deep-well plates and cultured at 30°C for 48 hours, and then transferred to the fermentation medium in 24 deep-well plates at a 10% inoculation amount, and cultured at 30°C for 48 hours. The gellan gum was qualitatively detected by high-performance liquid phase mass spectrometry (LC / MS). A total of 7 strains can produce gellan gum, and preliminary microscopic examination showed that they were Sphingomonas. Further shake flask fermentation culture was used, and one of the strains, Sphingomonas FMME-GG001, had the highest yield, with gellan gum accumulation reaching 4.69 g / L.

[0059] (II) Identification of gellan gum producing strains

[0060] (1) Colony and physiological and biochemical characteristics

[0061] The FMME-GG001 strain was cultured in YM medium for 48 hours, and formed a round, uniform, smooth and moist surface with neat edges of yellow single colonies. Microscopic examination showed that the bacteria were long rod-shaped. It was able to ferment and utilize sucrose, glucose, fructose, and maltose syrup, and the culture solution contained flocculent colloidal substances.

[0062] (2) 16S rRNA sequence analysis

[0063] The genomic DNA of the strain was extracted using a bacterial DNA extraction kit, and the genome was used as a template for amplification using bacterial 16SrRNA universal primers. The amplified products were sequenced and compared by Blast, and the results showed that the strain was Sphingomonas.

[0064] Based on the colony morphological characteristics and 16S rRNA analysis, the strain was confirmed to be Sphingomonas paucimobilis and named Sphingomonas paucimobilis FMME-GG374.

[0065] Example 2: Establishment and verification of gene editing method

[0066] (1) Preparation of competent cells of Sphingomonas paucimobilis

[0067] Since the product gellan gum is a macromolecular polysaccharide and is wrapped on the surface of the bacteria, conventional shaking flask bacterial liquid centrifugation cannot effectively separate the required bacteria. If the traditional competent preparation method is used, it will significantly affect the preparation of competent cells. To solve this problem, first streak inoculation on the YM solid culture medium plate and culture it at a constant temperature of 30°C for 24h. Subsequently, the bacteria on the plate were washed with sterile water, and the collected bacterial liquid was treated with an ice bath for 15min to inhibit bacterial growth. Then, the bacteria were collected by centrifugation at 4°C and 6000rpm for 5min, and the bacteria were washed twice with pre-cooled 10% glycerol. Finally, 200μl of pre-cooled 10% glycerol was added to the centrifuge tube, and the bacteria were resuspended and divided into 100μL competent cells per tube.

[0068] (2) Determination of transformation conditions

[0069] The transformation conditions of the strain were optimized using the kanamycin-resistant plasmid pBBR1 MCS2 plasmid, which can stably replicate and express in Sphingomonas paucimobilis. Five gradient voltages of 1600, 1800, 2000, 2200, and 2500 V / mm were set. After the transformation was completed, the bacteria were cultured in a shaker at 30°C and 220 rpm for 1 hour, and then the bacteria were collected by centrifugation and spread on a YM solid culture medium plate containing 50 μg / L kanamycin. The control group was an empty electro-transformed strain without adding plasmids. After 48 hours of constant temperature culture at 30°C, bacterial growth was observed under all five gradient voltages, especially the experimental group treated with 2500 V / mm voltage, which showed the most bacterial proliferation, while no bacterial growth was detected on the control plate. Therefore, the subsequent experiments used 2500 V / mm voltage to electro-transform the bacteria.

[0070] (3) Construction of Crispr-Cas9 dual plasmid system

[0071] At present, there is a relative lack of research on the methods of editing the gellan gum gene, especially in terms of the replicons available in Sphingomonas paucimobilis, which lack reliable literature support. Therefore, it is necessary to screen out effective replicons that can stably replicate and express in Sphingomonas paucimobilis in order to lay the foundation for the construction and application of new gene editing methods.

[0072] Replicons (sequences are SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4) from 4 different plasmids (pSC101, pK18, RK2, ColE1) were selected and cloned into the pBBR1 MCS2 plasmid to replace its original replicons Rep and oriV, and plasmids pBBR1-101ori, pBBR1-pk18ori, pBBR1-RK2ori and pBBR1-ColE1ori were obtained. Subsequently, the constructed recombinant plasmids were electrotransformed into Sphingomonas paucimobilis, respectively, and spread on YM solid culture medium plates containing kanamycin resistance and cultured at 30°C for 48h. Among them, positive transformants grew on the resistance plate of the transformed plasmid pBBR1-101ori, indicating that the replicon derived from the plasmid pSC101 can replicate and express in Sphingomonas paucimobilis.

[0073] Using pBBR1 MCS2 as a template, the primer pair pBBR1-ori-F / R was used to amplify the replicon oriV fragment (SEQID NO: 5); using the pCas9 plasmid as a template, the primer pair pCas9-F / R was used to amplify the linearized fragment. The vector linearized fragment and the oriV fragment were recovered by agarose gel electrophoresis, connected by homologous recombination, and then transformed into E. coli JM109 to obtain the recombinant pCas plasmid.

[0074] Using pSC101 as a template, the primer pair pSC101-ori-F / R was used to amplify the replicon pSC101 ori fragment (SEQ ID NO: 1); using the pSGN20 plasmid as a template, the primer pair pSGN20-F / R was used to amplify the linearized plasmid fragment, the vector linearized fragment and the pSC101 ori fragment were recovered by agarose gel electrophoresis, connected by homologous recombination, and then transformed into E. coli JM109 to obtain the recombinant plasmid pN20 ( Figure 1 ).

[0075] (4) Verification of editing efficiency of Crispr-Cas9 dual plasmid system

[0076] Genomic integration of genes using the Crispr-Cas9 system:

[0077] ① The recombinant pCas plasmid was transformed into Sphingomonas paucimobilis by electroporation to obtain the FMME-GG001-pCas strain.

[0078] Specifically, the pCas plasmid was introduced into FMME-GG374 competent cells by electroporation, and the transformed strain was spread on a YM solid culture medium plate containing chloramphenicol resistance, cultured at 30°C for 48 hours, and positive transformants were selected for colony PCR identification to obtain FMME-GG374-pCas strains. A single FMME-GG374-pCas colony was inoculated into a YPG liquid culture medium containing chloramphenicol resistance, cultured at 30°C and 140rpm for 24 hours, and the cultured bacterial solution was spread on a YM solid culture medium containing chloramphenicol and arabinose, and cultured at 30°C for 48 hours. The colonies on the plate were washed with sterile water to prepare FMME-GG374-pCas competent cells.

[0079] ②Select crtI site and construct P tac The EGFP fluorescent protein gene integration frame pTac-EGFP (SEQ ID NO: 6) and pN20-crtI plasmid with promoter were electroporated into FMME-GG374-pCas competent cells, and the fluorescence produced by the recombinant strain was observed under a fluorescence microscope.

[0080] Specifically,

[0081] Using pN20 as a template, primers pN20-crtI-F / R were used for PCR amplification to obtain a linearized plasmid fragment, which was recovered after separation by agarose gel electrophoresis. The recovered linearized vector was digested with DPN1 and then transformed into E. coli JM109 to obtain the recombinant plasmid pN20-crtI.

[0082] Using the FMME-GG374 genome as a template, the upstream and downstream 500 bp of the crtI gene were amplified as homology arms (SEQ ID NOs: 7 and 8) using primer pairs UP-crtI-F / R and Down-crtI-F / R, respectively; the EGFP gene fragment pTac-EGFP driven by the pTac promoter was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.; using primer pairs UP-crtI-F and Down-crtI-R, the upstream and downstream homology arms of the crtI gene and the pTac-EGFP sequence as templates, fusion PCR was performed to construct a pTac-EGFP integration frame containing the upstream and downstream homology arms of crtI.

[0083] The pTac-EGFP integration frame was mixed with the plasmid pN20-crtI at a ratio of 3:1, and the FMME-GG374-pCas competent cells were transformed by electroporation, and then spread on YM solid plates containing chloramphenicol and kanamycin, and cultured at 30°C for 48 hours, and positive transformants were selected for colony PCR verification. The recombinant strain with successful integration of the EGFP gene was removed by adding 15% sucrose to the YPG medium to remove the pN20-crtI plasmid, and further cultured at 42°C for 24 hours to remove the pCas plasmid.

[0084] The recombinant strain was placed under a fluorescence microscope to observe its fluorescence production. The results showed that the Crispr-Cas9 dual-plasmid system successfully integrated the EGFP fluorescent protein gene into the genome, and the editing efficiency reached more than 95% (the percentage of fluorescent colonies to the number of colonies on the resistant plate) ( Figure 2 ).

[0085] Example 3: Construction of a high-yield strain of gellan gum

[0086] In order to improve the synthesis efficiency of gellan gum, according to the biosynthetic pathway of gellan gum, referring to the method of integrating the EGFP fluorescent protein gene in Example 2, the Crispr-Cas9 dual-plasmid system constructed in Example 2 was used to gradually integrate the native gelL (encoding glucose syl glucuronyl transferase), gelA (encoding gellan gum synthesis gene cluster regulatory protein) and gelK (encoding gellan gum monosaccharide assembly gene regulatory protein) genes driven by the pTac promoter into the FMME-GG374 genome to construct engineered strains FMME-GG001, FMME-GG002 and FMME-GG003.

[0087] Specifically, the gelL gene fragment driven by the pTac promoter (SEQ ID NO: 9) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.; the 500bp homology arms (SEQ ID NO: 7, 8) and gelL amplified in Example 2 were used as templates, and the primer pair UP-crtI-F / Down-crtI-R was used to perform fusion PCR to obtain the gelL gene integration frame UP-gelL-Down. The integration frame UP-gelL-Down and the pN20-crtI plasmid constructed in Example 2 were transferred into the FMME-GG374-pCas competent state prepared in Example 2, coated on a YM solid plate containing chloramphenicol resistance and kanamycin resistance, and cultured at 30°C for 72 hours, and the single colonies grown on the plate were verified. The recombinant strain with successful integration of the gelL gene was removed by adding 15% sucrose to the YPG medium to remove the pN20-crtI plasmid to obtain the strain FMME-GG001-pCas containing the pCas plasmid. The pCas plasmid was further removed by culturing at 42°C for 24 h to obtain the engineered strain FMME-GG001.

[0088] Using the FMME-GG374 genome as a template, the primer pairs UP-ldhA-F / R and Down-ldhA-F / R were used to amplify the 500bp sequence upstream and downstream of the ldhA site as homology arms (SEQ ID NO: 10, 11); the gelA gene driven by the pTac promoter (SEQ ID NO: 12) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.; using the upstream and downstream homology arms of ldhA and gelA as templates, the primer pair UP-ldhA-F / Down-ldhA-R was used to perform fusion PCR to obtain the gelA gene integration frame UP-gelA-Down. Using the pN20 plasmid as a template, the primer pair pN20-ldhA-F / R was used for linear amplification, and the obtained target vector fragment was digested and transferred into E. coli JM109 to obtain the recombinant plasmid pN20-ldhA. Finally, the integration frame UP-gelA-Down and pN20-ldhA plasmid were transferred into the FMME-GG001-pCas competent state, coated on a YM solid plate containing chloramphenicol resistance and kanamycin resistance, and cultured at 30°C for 72 hours, and the single colonies grown on the plate were verified. The recombinant strain with successful integration of the gelA gene was obtained by adding 15% sucrose to the YPG medium to remove the pN20-ldhA plasmid, and the strain FMME-GG002-pCas containing the pCas plasmid was obtained. 15% sucrose was added to the YPG medium, and the pCas plasmid was removed by culturing at 42°C for 24 hours to obtain the engineered strain FMME-GG002.

[0089] Using the FMME-GG374 genome as a template, the primer pairs UP-poxB-F / R and Down-poxB-F / R were used to amplify the 500bp sequences upstream and downstream of the poxB site as homology arms (SEQ ID NO: 13, 14); the gelK gene driven by the pTac promoter (SEQ ID NO: 15) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.; using the upstream and downstream homology arms of poxB and gelK as templates, the primer pair UP-poxB-F / Down-poxB-R was used to perform fusion PCR to obtain the gelK gene integration frame UP-poxB-Down. Using the pN20 plasmid as a template, the primer pair pN20-poxB-F / R was used for linear amplification, and the obtained target vector fragment was digested and transferred into E. coli JM109 to obtain the recombinant plasmid pN20-poxB. Finally, the integration frame UP-gelK-Down and pN20-poxB plasmid were transferred into FMME-GG002-pCas competent cells, plated on YM solid plates containing chloramphenicol resistance and kanamycin resistance, and cultured at 30°C for 72 hours, and the single colonies grown on the plates were verified. The recombinant strain with successful integration of the gelK gene was added with 15% sucrose in the YPG medium to remove the pN20-poxB plasmid, and further cultured at 42°C for 24 hours to remove the pCas plasmid, and the engineered strain FMME-GG003 was obtained.

[0090] The engineered strains FMME-GG001, FMME-GG002 and FMME-GG003 were inoculated into 500 ml shake flasks containing 100 ml fermentation medium, respectively, and cultured at 28°C and 140 rpm for 60 h. The gellan gum production reached 7.27 g / L, 8.44 g / L and 9.9 g / L, respectively.

[0091] Table 1 Strains used in the examples of the present invention

[0092] strain Genetic modification FMME-GG374 Wild-type Sphingomonas paucimobilis FMME-GG001 FMME-GG374ΔcrtI::gelL FMME-GG002 FMME-GG001△ldhA::gelA FMME-GG003 FMME-GG002△poxB::gelK

[0093] Table 2 Primers used in the embodiments of the present invention

[0094]

[0095]

[0096] Example 4: Fermentation production of gellan gum by engineered strain FMME-GG003

[0097] (1) Seed solution preparation

[0098] FMME-GG003 and FMME-GG374 were activated by streaking on YM solid plate culture medium, respectively, and cultured in a constant temperature incubator at 30°C for 2 days. A ring of colonies was picked with a sterile inoculation loop and inoculated into 50mL / 500mL seed culture medium for culture, and cultured at 30°C and 180r / min with shaking for 15h.

[0099] (2) Fermentation culture in 15L fermenter

[0100] The seed liquid prepared in step (1) is inoculated into a fermentation tank at a 10% inoculation amount, the volume of the fermentation medium is 10.5 L, the pH is adjusted to 7.0 using sodium hydroxide, the fermentation temperature is 30° C., the ventilation volume is 1 vvm, the initial stirring speed is 300 r / min, and when the dissolved oxygen is lower than 30% during the fermentation process, the stirring and speed are linked to the dissolved oxygen and controlled at 30-100%. During the fermentation process, the fermentation liquid is taken, the bacterial cells are removed by centrifugation, and the gellan gum content is determined by ethanol sedimentation method.

[0101] The results showed that under the conditions of 30-100% dissolved oxygen, the growth of the two strains was basically the same ( Figure 1 ), after 60h of fermentation, the gellan gum production of strain FMME-GG003 reached 10.8g / L, which was 131.2% higher than that of the original strain FMME-GG374 (4.67g / L). Figure 2 The glucose yields of gellan gum in FMME-GG003 and FMME-GG374 were 0.27 g / g and 0.12 g / g, respectively, and the glucose yields were increased by 15.0%.

[0102] Example 5: Effect of different carbon sources on the production of gellan gum by FMME-GG003 fermentation

[0103] The seed solution prepared in step (1) of Example 4 was inoculated into a fermenter at an inoculation rate of 10%, the organic nitrogen source in the fermentation medium was 3 g / L corn syrup, the initial carbon source was 40 g / L glucose, sucrose, and maltose syrup, respectively, the initial culture medium volume in the fermenter was 10.5 L, sodium hydroxide was used to control pH 7.0, the fermentation temperature was 30°C, the ventilation volume was 1 vvm, the initial stirring speed was 300 r / min, and when the dissolved oxygen was lower than 30% during the fermentation process, the stirring and speed were linked to the dissolved oxygen control at 30-100%. During the fermentation process, the fermentation liquid was extracted, the bacterial cells were removed by centrifugation, and the gellan gum yield was determined by ethanol sedimentation method.

[0104] The results showed that the strain fermented for 60h under three different carbon source conditions with the same concentration, and the gellan gum yields were 10.8g / L, 13.5g / L, and 8.1g / L respectively. Therefore, under the condition of 40g / L initial carbon source concentration, the best carbon source for gellan gum production is sucrose, and the sucrose yield of gellan gum is 0.34g / g.

[0105] Table 3 Effect of different types of carbon sources on gellan gum production by FMME-GG003

[0106]

[0107] Example 6: Effects of different nitrogen sources on the production of gellan gum by FMME-GG003 fermentation

[0108] The seed solution prepared in step (1) of Example 4 was inoculated into a fermenter at an inoculation rate of 10%, the organic nitrogen sources in the fermentation medium were 3 g / L corn steep liquor, peptone, yeast extract, and soybean meal powder, respectively, the initial carbon source was 40 g / L sucrose, the initial culture medium volume in the fermenter was 10.5 L, sodium hydroxide was used to control pH 7.0, the fermentation temperature was 30°C, the ventilation volume was 1 vvm, the initial stirring speed was 300 r / min, and when the dissolved oxygen was lower than 30% during the fermentation process, the stirring and speed were linked to the dissolved oxygen control at 30% to 100%. During the fermentation process, the fermentation liquid was extracted, the bacterial cells were removed by centrifugation, and the gellan gum yield was determined by ethanol sedimentation method.

[0109] The results showed that the strain was fermented for 60 hours under four different nitrogen sources with the same concentration, and the gellan gum production was 13.5g / L, 16.7g / L, 14.3g / L, and 16.4g / L, respectively. Therefore, under the condition of 3g / L initial organic nitrogen source concentration, the best nitrogen source for gellan gum production is peptone, and the sucrose yield of gellan gum is 0.42g / g. When soybean meal powder is used as the organic nitrogen source, the sucrose yield of gellan gum is 0.41g / g, which is similar to the sugar yield when peptone is used as the nitrogen source. In addition, soybean meal powder is cheap and has higher economic benefits.

[0110] Table 4 Effect of different types of nitrogen sources on gellan gum production by FMME-GG003

[0111]

[0112] Example 7: Effects of different carbon source supplementation methods on the production of gellan gum by FMME-GG003 fermentation

[0113] The seed solution prepared in step (1) of Example 4 was inoculated into a fermenter at an inoculation rate of 10%, the organic nitrogen source in the fermentation medium was 3 g / L soybean meal powder, the initial carbon source was 30 g / L sucrose, 10 g / L sucrose was added during the fermentation process, and the addition time was 12 h, 16 h, 20 h, and 24 h, respectively. The initial culture medium volume in the fermenter was 10.5 L, sodium hydroxide was used to control pH 7.0, the fermentation temperature was 30 ° C, the ventilation volume was 1 vvm, the initial stirring speed was 300 r / min, and when the dissolved oxygen was lower than 30% during the fermentation process, the stirring and speed were linked to the dissolved oxygen control at 30-100%. During the fermentation process, the fermentation liquid was extracted, the bacterial cells were removed by centrifugation, and the gellan gum yield was determined by ethanol sedimentation method.

[0114] The results showed that the strains were fermented for 60 hours under the conditions of carbon source supplementation at four different fermentation times, and the gellan gum production was 17.5g / L, 17.8g / L, 18.3g / L, and 18.0g / L respectively. Therefore, under the condition of 30g / L initial carbon source concentration, the best carbon source supplementation time for gellan gum production was 20h of fermentation, at which time the sucrose yield of gellan gum was 0.46g / g.

[0115] Table 5 Effect of adding carbon source at different times on gellan gum production by FMME-GG003

[0116]

[0117]

[0118] Example 8: Effect of exogenous addition of ring (L-Pro-L-Phe) on the production of gellan gum by FMME-GG003 fermentation

[0119] The seed solution prepared in step (1) of Example 4 was inoculated into a fermenter at an inoculation rate of 10%, the organic nitrogen source in the fermentation medium was 3g / L soybean meal powder, the initial carbon source was 30g / L sucrose, 10g / L sucrose was added after 20h of fermentation, and 500μg / mL cyclo(L-Pro-L-Phe) was added at the same time; the initial culture medium volume in the fermenter was 10.5L, sodium hydroxide was used to control pH7.0, the fermentation temperature was 30°C, the ventilation volume was 1vvm, the initial stirring speed was 300r / min, and when the dissolved oxygen was lower than 30% during the fermentation process, the stirring and speed were linked to the dissolved oxygen control at 30-100%. During the fermentation process, the fermentation liquid was extracted, the bacterial cells were removed by centrifugation, and the gellan gum yield was determined by ethanol sedimentation method.

[0120] The results showed that when the strain was fermented for 60 hours with the addition of 500 μg / mL cyclo(L-Pro-L-Phe) exogenously, the gellan gum production was 20.0 g / L, and the sucrose yield of gellan gum was 0.50 g / g.

[0121] Sequence Listing

[0122] SEQ ID NO: 1 Replicon pSC101ori from pSC101

[0123] gagttatacacagggctgggatctattctttttatctttttttattctttctttattctataaattataaccacttgaatataaacaaaaaaaacacacaaagg

[0124] tctagcggaatttacagagggtctagcagaatttacaagttttccagcaaaggtctagcagaatttacagatacccacaactcaaaggaaaagga

[0125] ctagtaattatcattgactagcccatctcaattggtatagtgattaaaatcacctagaccaattgagatgtatgtctgaattagttgttttcaaagcaaat

[0126] gaactagcgattagtcgctatgacttaacggagcatgaaaccaagctaattttatgctgtgtggcactactcaaccccacgattgaaaaccctaca

[0127] aggaaagaacggacggtatcgttcacttataaccaatacgttcagatgatgaacatcagtagggaaaatgcttatggtgtattagctaaagcaacc

[0128] agagagctgatgacgagaactgtggaaatcaggaatcctttggttaaaggctttgagattttccagtggacaaactatgccaagttctcaagcgaa

[0129] aaattagaattagtttttagtgaagagatattgccttatcttttccagttaaaaaaattcataaaatataatctggaacatgttaagtcttttgaaaacaaat

[0130] actctatgaggatttatgagtggttattaaaagaactaacacaaaagaaaactcacaaggcaaatatagagattagccttgatgaatttaagttcatg

[0131] ttaatgcttgaaaataactaccatgagtttaaaaggcttaaccaatgggttttgaaaccaataagtaaagatttaaacacttacagcaatatgaaattg

[0132] gtggttgataagcgaggccgcccgactgatacgttgattttccaagttgaactagatagacaaatggatctcgtaaccgaacttgagaacaacca

[0133] gataaaaatgaatggtgacaaaataccaacaaccattacatcagattcctacctacataacggactaagaaaaacactacacgatgctttaactgc

[0134] aaaaattcagctcaccagttttgaggcaaaatttttgagtgacatgcaaagtaagtatgatctcaatggttcgttctcatggctcacgcaaaaacaac

[0135] gaaccacactagagaacatactggctaaatacggaaggatctga

[0136] SEQ ID NO:2 Replicon pk18ori from pK18

[0137] AacggaatagctgttcgttgacttgatagaccgattgattcatcatctcataaataaagaaaaaccaccgctaccaacggtggttttctcaaggttcgctgagctaccaactctttgaaccaaggtaagtgggttggaggaccgcactcaccaaaatctgttctttcagtttagccttaacaggtgcataacttcaagacaaagtcctctaaatcagttaccaatggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagataccaacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctggcttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgcctgcggcgttggcttcttccggtgctttgctttttgctcacatgttctttccggctttatcccctgattctgtggataaccgtattaccgcttttgagtgagctgacaccgctcgccgcagtcgaacgaccgagcgtagcgagtcagtgagcgaggaagcggaagSEQ ID NO:3Replicon RK2ori from RK2

[0138] ggccgccggcgttgtggatacctcgcggaaaacttggccctcactgacagatgaggggcggacgttgacacttgaggggccgactcacccg

[0139] gcgcggcgttgacagatgaggggcaggctcgatttcggccggcgacgtggagctggccagcctcgcaaatcggcgaaaacgcctgattttac

[0140] gcgagtttcccacagatgatgtggacaagcctggggataagtgccctgcggtattgacacttgaggggcgcgactactgacagatgaggggc

[0141] gcgatccttgacacttgaggggcagagtgctgacagatgaggggcgcacctattgacatttgaggggctgtccacaggcagaaaatccagcat

[0142] ttgcaagggtttccgcccgtttttcggccaccgctaacctgtcttttaacctgcttttaaaccaatatttataaaccttgtttttaaccagggctgcgccc

[0143] tgtgcgcgtgaccgcgcacgccgaaggggggtgcccccccttctcgaaccctcccggcccgctaacgcgggcctcccatccccccaggggc

[0144] tgcgcccctcggccgcgaacggcctcaccccaaaaatggcagcgctggcagtccttgccattgccgggatcggggcagtaacgggatgggc

[0145] gatcagcccgagcgcgacgcccggaagcattgacgtgccgcaggtgctggcatcgacattcagcgaccaggtgccgggcagtgagggcgg

[0146] cggcctgggtggcggcctgcccttcacttcggccgtcggggcattcacggacttcatggcggggccggcaatttttaccttgggcattcttggca

[0147] tagtggtcgcgggtgccgtgctcgtgttcgggggtgaattaattccccggatccgtcagcttcacgctgccgcaagcactcagggcgcaaggg

[0148] ctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaaggg

[0149] aaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccg

[0150] gaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcagg

[0151] ggatcaagatcgacggatccggggaattccggggcaatcccgcaaggagggtgaatgaatcggacgtttgaccggaaggcatacaggcaag

[0152] aactgatcgacgcggggttttccgccgaggatgccgaaaccatcgcaagccgcaccgtcatgcgtgcgccccgcgaaaccttccagtccgtc

[0153] ggctcgatggtccagcaagctacggccaagatcgagcgcgacagcgtgcaactggctccccctgccctgcccgcgccatcggccgccgtgg

[0154] agcgttcgcgtcgtctcgaacaggaggcggcaggtttggcgaagtcgatgaccatcgacacgcgaggaactatgacgaccaagaagcgaaa

[0155] aaccgccggcgaggacctggcaaaacaggtcagcgaggccaagcaggccgcgttgctgaaacacacgaagcagcagatcaaggaaatgc

[0156] agctttccttgttcgatattgcgccgtggccggacacgatgcgagcgatgccaaacgacacggcccgctctgccctgttcaccacgcgcaacaa

[0157] gaaaatcccgcgcgaggcgctgcaaaacaaggtcattttccacgtcaacaaggacgtgaagatcacctacaccggcgtcgagctgcgggccg

[0158] acgatgacgaactggtgtggcagcaggtgttggagtacgcgaagcgcacccctatcggcgagccgatcaccttcacgttctacgagctttgcca

[0159] ggacctgggctggtcgatcaatggccggtattacacgaaggccgaggaatgcctgtcgcgcctacaggcgacggcgatgggcttcacgtccg

[0160] accgcgttgggcacctggaatcggtgtcgctgctgcaccgcttccgcgtcctggaccgtggcaagaaaacgtcccgttgccaggtcctgatcg

[0161] acgaggaaatcgtcgtgctgtttgctggcgaccactacacgaaattcatatgggagaagtaccgcaagctgtcgccgacggcccgacggatgtt

[0162] cgactatttcagctcgcaccgggagccgtacccgctcaagctggaaaccttccgcctcatgtgcggatcggattccacccgcgtgaagaagtg

[0163] gcgcgagcaggtcggcgaagcctgcgaagagttgcgaggcagcggcctggtggaacacgcctgggtcaatgacctggtgcattgcaaacg

[0164] ctag

[0165] SEQ ID NO:4 Replicon ColE1ori from ColE1

[0166] ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactc

[0167] tttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagc

[0168] accgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagtta

[0169] ccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctac

[0170] agcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgc

[0171] acgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcag

[0172] gggggcggagcctatggaaa

[0173] SEQ ID NO: 5 oriV of the pBBR1 MCS2 origin of replication:

[0174] gcggccaccggctggctcgcttcgctcggcccgtggacaaccctgctggacaagctgatggacaggctgcgcctgcccacgagcttgaccac

[0175] agggattgcccaccggctacccagccttcgaccacatacccaccggctccaactgcgcggcctgcggccttgccccatcaatttttttaattttctc

[0176] tggggaaaagcctccggcctgcggcctgcgcgcttcgcttgccggttggacaccaagtggaaggcgggtcaaggctcgcgcagcgaccgc

[0177] gcagcggcttggccttgacgcgcctggaacgacccaagcctatgcgagtgggggcagtcgaagggcgaagcccgcccgcctgccccccga

[0178] gcctcacggcggcgagtgcgggggttccaagggggcagcgccaccttgggcaaggccgaaggccgcgcagtcgatcaacaagccccgga

[0179] ggggccactttttgccggagggggagccgcgccgaaggcgtgggggaaccccgcaggggtgcccttctttgggcaccaaagaactagatat

[0180] agggcgaaatgcgaaagacttaaaaatcaacaacttaaaaaaggggggtacgcaacagctcattgcggcaccccccgcaatagctcattgcgt

[0181] aggttaaagaaaatctgtaattgactgccacttttacgcaacgcataattgttgtcgcgctgccgaaaagttgcagctgattgcgcatggtgccgca

[0182] accgtgcggcacccctaccgcatggagataagcatggccacgcagtccagagaaatcggcattcaagccaagaacaagcccggtcactggg

[0183] tgcaaacggaacgcaaagcgcatgaggcgtgggccgggcttattgcgaggaaacccacggcggcaatgctgctgcatcacctcgtggcgca

[0184] gatgggccaccagaacgccgtggtggtcagccagaagacactttccaagctcatcggacgttctttgcggacggtccaatacgcagtcaagga

[0185] cttggtggccgagcgctggatctccgtcgtgaagctcaacggccccggcaccgtgtcggcctacgtggtcaatgaccgcgtggcgtggggcc

[0186] agccccgcgaccagttgcgcctgtcggtgttcagtgccgccgtggtggttgatcacgacgaccaggacgaatcgctgttggggcatggcgacc

[0187] tgcgccgcatcccgaccctgtatccgggcgagcagcaactaccgaccggccccggcgaggagccgcccagccagcccggcattccgggc

[0188] atggaaccagacctgccagccttgaccgaaacggaggaatgggaacggcgcgggcagcagcgcctgccgatgcccgatgagccgtgttttc

[0189] tggacgatggcgagccgttggagccgccgacacgggtcacgctgccgcgccggtag

[0190] SEQ ID NO: 6 pTac promoter-driven EGFP gene sequence:

[0191] Ttgacaattaatcatcggctcgtataatgactagtaaagaggagaaaaagcttatggtgagcaagggcgaggagctgttcaccggggtggtgc

[0192] ccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctga

[0193] ccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgcta

[0194] ccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaa

[0195] ctacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaa

[0196] catcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaa

[0197] gatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcc

[0198] cgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccg

[0199] ccgggatcactctcggcatggacgagctgtacaagtaa

[0200] 500 bp homologous arm upstream of the crtI gene of SEQ ID NO:7

[0201] Gcatcgtctcgcagacctcgaggctggtcagccccttgtgcgcgacctcggcattgaccagcagggtgggaatcacgccgatcacctcgccg

[0202] ccggcttccagcgccgcatcggcgaccgcgcccatcagcccgagccggccaccaccatagacgacgccgatgccacgctcggcgagcgtg

[0203] cggccaagggtgcgggcggcttcgatatagaccggatcggccgggctggccgaaccgcaatagacggcgatacgcttcattgcatgctcctg

[0204] tggcggggctgatagcgtgttttcgccgggagggagagcctcttcttcttagcccctcctccttggaggaggggttggggggtggagggtttcc

[0205] agaccagaagttggtctcggtgagacacagccccaccccaaccccgcatcaggtgaacagcgccccgcgctgttcaggcgctgccgggggc

[0206] agcaccgacctgatgcgcctgaaggggaggggcttggatgt

[0207] 500 bp homologous arm downstream of the crtI gene of SEQ ID NO:8

[0208] Cagcggctccagatcgcggaaagggcgcgccccaccggcaccggcggcttgcccgaaagcacccgcacgcgatcgccgaaggtcgact

[0209] ggccggcatagaagcgctggatcagacctgcatccagacgatagaaacgttccagcacgcgatagcgctcctcgggttcggccgccttgaac

[0210] agcatcgcggcgagcatgcgatagaagccgcgcttgcgccagagcccacgggaatagccatacagcatttggtgcagcgcctcgcccgaat

[0211] agtcgcgcgcgtcggcgatcagcgcggcggtgcggatcgcatcggggaaggaatagccggtcatcgggtggaacagcccggccttcatcc

[0212] cggccttggcgatgccgcgcccgccggccgcccaataggcggcatggtcgccgcccatcgcgacgggcaggctgcccacttcctcgcgca

[0213] gcacgcggtcgaccttccagcccgcggcatcggcataggcttcgatccg

[0214] SEQ ID NO:9 GelL gene fragment driven by pTac promoter

[0215] Ttgacaattaatcatcggctcgtataatgactagtaaagaggagaaaaagcttatgaccgggccgcggatcagcgtcgtcatcccgcactacaa

[0216] cgatctcgagggtctgacgaaatgcctggaatcgatcgaccggcagacgatcgaccgcggcagttttgagatcatcgtcggcgacaacaactc

[0217] cccttgcggcatcgccgcggtggaagccgtggtcgccgggcgcgggcgcgttgtccccgtgctggaaaagggtgccggcccggcgcgcaa

[0218] cggtgccgcggcggcagcgcgcggcgaagtgctcgccttcaccgacagcgactgcgtggtcgctcccggctggctggccggcggcgtggc

[0219] gcaggtcgcacccgggcggttcgtcggcggccacatgttcgtcatcaagcccgagggcccgttgagcggtgccgaggcgctggagcttgcg

[0220] gtcgccttcgacaatgagggctatgtgcgccgcgcccagtacaccgtgaccgccaacctgttcgtcatgcgggcggatttcgagcgcgtgggc

[0221] gagttcaggaccggcgtgtccgaggacatggaatggtgccaccgcgcaatcgcgaagggcctgaccatcgactatgccgcccaggcgtccg

[0222] tcggccacccgccacggcgcgactgggaggccctgctggtcaagacgcgccgaatccagcgcgagctgtacctgttctacaaggagcgtcc

[0223] gcaggggcgactgcgctggctggcgcgctcggccctgcagccggcgctgctgccttcggacgcggccaagatcctccggacgtccaccac

[0224] gcagggcgcgcgcgcaaaggcgctgttgaccgcgtgccggctgcggttctggaagagcggggtcggactgctccagctgctcgggcgccc

[0225] cgcctga

[0226] 500 bp homologous arm upstream of the ldhA gene, SEQ ID NO:10

[0227] Caccaccgagttgatttcctggatgccgggcagcttgctcagcttttcgaagaagaagcgctcataggcgtcgatatcctcggcgacgattcgg

[0228] agcatgaagtccacggtccccatcagcacataggcgtcgagcacctcggggaagccctggatcgcgacactgaattcgtcgagattggcgcg

[0229] gccgtgcgcgttcagcttcacctgcgcgaagatgtgtgcgttgagccccaccttgcgccgatcgaccagcgccacgcgcttgcggatcacgcc

[0230] ttcgcgctccagccggtcgacccgccgccagcagggggagggggaaagcccgatccgctccgccagctcggccgtggtcaggctggaatc

[0231] gcgctgcagctcgcggagaatcttgcgctcctggggatctaggtcggtcataattaccggttatagcgaagtactaggataaaataacccaaaaa

[0232] tagctgtcctgcgcccaattccggcaagcattgcccggtcgcccctgccagaatcgcggcaacgaaaggaaggctcacg

[0233] The 500 bp homologous arm downstream of the ldhA gene, SEQ ID NO:11

[0234] tcagcccggccgcttctcgaacgtcgcgaggcggcgcgccgcatccgctcggacattcgcccagaacaggctgtagtcgaacacatgatagtt

[0235] gttccccggcagcacatactggccgaagtccggcggggcggtgccgatcgtcagaatgccgcgcccgtcgcagcgggcaggcacacggcc

[0236] cggctccagatgcgcggactggaggttcatgtccgggatcagcgaaccgagattggcgcttgcgggggccgagtcgctgggcttgccggtga

[0237] tcggattggtgcagagcatcttcgtgcccgcccgcggctggccggtgaagcccttggtcgcgtcgaaggtatcgacgatcagcgccgggtcg

[0238] gctgggtcggcgaagctctgccaggagaggatgcagccggcctggtccggccccgaacaggcgggcaggcccatcttcggcaggtccgcg

[0239] gtcagcgacacgggccagccgacgacataggcggcgaccacgcgggcagcgaccggcgtgcccgcgactcgctcggccagtaggcggg

[0240] ccaggtgcagcgcgccctggctgtgtccggcgagaatgatcggccgatcgcccgcttcgtggaggaactcctcgaac

[0241] SEQ ID NO:12 gelA gene driven by pTac promoter

[0242] ttgacaattaatcatcggctcgtataatgactagtaaagaggagaaaaagcttatgtcgagtcgcccgacgatcaaggaagtatcgaagatcgcg

[0243] ggcgtgtcgttcaagaccgtctcccgggtgctgaacaacgagaagcatgtaagcgaggagactcggcggcgtgtagaggaggtggtggcgc

[0244] agctgaacttccggcccagccacgccgcgcggacgctcgccgggcgacgctcgttccaggtcgcgctgctatacgacaatcccagcccctat

[0245] tacgtcttccacatccaggccggcgcactggagcggtgccatgagctcggctaccgcctgctgatgcagccgctggaaagcgcggcgcccg

[0246] atctggtgccggaagtgatggcgctggtcgacgaggcgcatctcgacgggctgatcctctcgccgccgctgaccgagatgccggagctgatc

[0247] gaggcgctggacaagcgcaagctgccctatgtccgcatcgcgccgggcctgcgcaaggatcacggcctcgccacgacgatggacgacgtg

[0248] gccgccgcgcgcgagatcacccgccatctgatccatctcggtcaccgcgcgatcgctttcgtccgcggcccggaaagccatgtgtcctcggcg

[0249] gatcgcctcgccggctatcggcaggagctggaggcgcacggcatcgcgttcgatccggcgctggtgatcgcgggcgactacagcttccagtc

[0250] cgggggggctgcggcacgcgcgctgttcgcccgggcgccgcggccgacggcgatcttcgccggcaatgacgacatggccgccggcgcgc

[0251] tggcggcggcacacgaggccgacgttgcggtgcccgaggcgctgtcgatcgccggctttgacgattccgatctggcccgcgcggtttggccg

[0252] ccgctcaccaccatccgccagccggtgcgcgaactcgcctatgcggcggcggacctgatgctggcgggcaatgcgattacgccgcaggtga

[0253] cgcttgagcacgaactcaaggtccgggcgaccacggggccggcgcccaagggctgatccaacctcgcccgtgccatcccatcctggcacag

[0254] cgttaaccatgcttgtcgctgggcg

[0255] 500bp homologous arm upstream of the poxB gene, SEQ ID NO:13

[0256] Accgtagcagcgttgatgaccgacattcttgccgccgcgggggtgcgccggatctacggccttgtcggcgacagtctcaacggcattaccgat

[0257] gcgttgcgggcgcgggacgacatggcgtgggtccatgttcgccacgaggaggtcgccgcgttcgccgccggcgccgaggcggcgctgacc

[0258] ggggagctggcggtgtgtgccggatcgtgcgggccgggcaatctccacctgatcaacggcctgtacgattgccaccgcacccgcgtgccggt

[0259] gctggcgatcgccgcgcagatcccttccgccgagatcggccgcggctatttccaggagaccaagcccgaggcgctgttccgcgaattgcgga

[0260] ggatcgcgacggcgatcaccttgaaaccagcgtcgcccgctatcgcaaggcccgcgccgggctcgacaagctcgccagtggcgcatcggg

[0261] ccgccgtcccatccacccccagcagctcgccgagcggctgagc

[0262] 500bp homologous arm downstream of the poxB gene, SEQ ID NO:14

[0263] ccgggcgcggcggggctcagccggtgcggccttgcgcctcttcccccggcgtccagcgcaggaaacggtgggtggcatgcgcggagggc

[0264] gcgtcgacaaagcccagccgcgcatagaggcgcagggcctgatggttgccggtctcgacatgcagggtcaccgcgtcggcggcggcggcg

[0265] cgggcggctgcctgaacccagtggatcagcgcagtgccgagcccgttgccgcgcgcccggggcagcagcagcagttccaggatgcgccac

[0266] gccgtgtcgctgcggtcgagcgaaagtcggccgatcggcgcggcggggcccttctccaccagccaatagtcggcgtgcggacgggtctgcc

[0267] ggtagtgcgtctgctgaaggtggaactgctcggcgatgaaggcgcgcttctgtgccgcgtcccatggcagtgccgcgagatcgggtgcgcgc

[0268] agcgtgccgtacaggcgcagcaggaagggctcgtcgctcgggcggacc

[0269] SEQ ID NO:15 gelK gene driven by pTac promoter

[0270] ttgacaattaatcatcggctcgtataatgactagtaaagaggagaaaaagcttatggcagaagcgaccgaggcggcgcacacgacgggcaag

[0271] cgactgaaaatgtgcctcgcagcgtccggcgggggccatctgcggcagatcctggatctggagtcggtctggcgcgaacacgattacttcttcg

[0272] tcaccgaagatacggcccttggccgcagtctcgcggagaaacatccggtggagctggtcggccattatgcgcttggccaggcccggctgggc

[0273] caccccttcaagatgctcggcggcgccctgcgcaacctgcggcagagcctcgccatcgtccgcaggcacaagccggacgtcgtaatctcgac

[0274] aggtgccggcgcggtctatttcaccgcgctgttcgccaagctgttcggcgcgaagttcatccatatcgaaagcttcgcccgcttcgatcacccctc

[0275] cgccttcggcaagatggtgaagggcatcgccacgatctcgatcgtccagtcgccggcgctgaagcagatctggcccgacgccgaacttttcga

[0276] tccgttccggatgctggacacgccgcgcccgcccaagcaggcgctgaccttcgccacggtgggcgccaccctgcccttcccgcgactggtgc

[0277] aggcggtgctcgacctgaagcgtgcgggcggcctgccgggcaagctgatcctgcaatatggcgatcaggccctgaccgatcccggcatccc

[0278] cgacgtcgagatccgccccaccatcccgttcgacgaattgcagctgatgctgcgcgacgccgacatcgtgatctgccacggcggcaccggct

[0279] cgctggttaccgcgctgcgtgccggctgccgggtgatcgccttcccgcgccgcttcgacctcggcgaacattatgacgatcaccaggaagaga

[0280] tcgcccagaccttcgccgaccgcggcctgctccaggcggtgcgcgacgaacgagaactcggcgcggcggtcgccgccgccaaggcgacg

[0281] gagcccaggctcgccaccaccgatcacaccgcgcttgccgcccggctgcgcaccctgctggccgaatggggggcgaagcgatgaccggg

[0282] ccgcggatcagcgtcgtcatcccgcactacaa

[0283] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Sphingomonas paucimobilis, characterized in that: A gellan gum-producing Sphingomonas paucimobilis FMME-GG374 was used as the starting strain, and gelA, gelL and gelK were integrated into its genome separately or simultaneously, gelA was integrated into the ldhA gene site, gelL was integrated into the poxB gene site, and gelK was integrated into the crtI gene site; The gellan gum-producing Sphingomonas paucimobilis FMME-GG374 was deposited in the China Center for Type Culture Collection (CCTCC) on October 28, 2024, with a deposit number of CCTCC M 20242350, and the deposit address is Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. A method for constructing the recombinant Sphingomonas paucimobilis according to claim 1, characterized in that: The following steps are involved: (1) Preparation of competent cells of Sphingomonas paucimobilis FMME-GG374: ① First, streak inoculation of Sphingomonas paucimobilis FMME-GG374 on a YM solid plate and culture at a constant temperature, wash the bacteria on the plate with sterile water, and treat the collected bacterial liquid with an ice bath to inhibit bacterial growth; ② Then, collect the bacteria by centrifugation and wash the bacteria twice with pre-cooled 10% glycerol; ③ Finally, resuspend the bacteria with pre-cooled 10% glycerol to obtain competent cells; (2) Using the Crispr-Cas9 dual plasmid system, gelA, gelL and / or gelK were integrated into the genome of Sphingomonas paucimobilis FMME-GG374, with gelA integrated into the ldhA gene locus, gelL integrated into the poxB gene locus, and gelK integrated into the crtI gene locus; The Crispr-Cas9 dual plasmid system is a recombinant pCas plasmid and a recombinant pN20 plasmid, wherein the recombinant pCas plasmid is a pCas9 replicon replaced by an oriV replicon derived from pBBR1 MCS2, and the recombinant pN20 plasmid is a pSGN20 replicon replaced by a pSC101ori replicon derived from pSC101; The method for transforming the Crispr-Cas9 dual plasmid system into Sphingomonas paucimobilis FMME-GG374 competent cells is electrotransformation with a voltage of 2500 V / mm.

3. A method for preparing gellan gum using the recombinant Sphingomonas paucimobilis or Sphingomonas paucimobilis FMME-GG374 according to claim 1, characterized in that: Gellan gum is produced by fermentation using sucrose as carbon source and soybean meal as nitrogen source.

4. The method according to claim 3, characterized in that The initial concentration of sucrose in the fermentation medium is 30-40 g / L, 10 g / L sucrose is added after 20 hours of fermentation, and the initial concentration of soybean meal powder in the fermentation medium is 3 g / L.

5. The method according to claim 3 or 4, characterized in that: The formula of the fermentation medium is as follows: each L contains: 30-40 g sucrose, 3 g soybean meal powder, 1 g ammonium chloride, 2 g potassium dihydrogen phosphate, 1.2 g magnesium sulfate heptahydrate, and 1 g light calcium carbonate.

6. The method according to any one of claims 3 to 5, characterized in that: During the fermentation process, the pH of the fermentation broth was controlled at 7.

0.

7. The method according to any one of claims 3 to 6, characterized in that: The initial ventilation volume of fermentation is 1vvm, and the initial stirring speed is 300r / min; when the dissolved oxygen during fermentation is lower than 30% of the initial dissolved oxygen amount of fermentation, the dissolved oxygen is controlled at 30% to 100% of the initial dissolved oxygen amount of fermentation by adjusting the stirring speed.

8. The method according to any one of claims 3 to 7, characterized in that: The fermentation temperature was 30°C.

9. The method according to any one of claims 3 to 8, characterized in that: 500 μg / mL cyclo(L-Pro-L-Phe) was added during the fermentation.

10. Use of the recombinant Sphingomonas paucimobilis or Sphingomonas paucimobilis FMME-GG374 according to claim 1 in the production of gellan gum, gelling agents, stabilizers, adhesives, thickeners and film-forming agents.

Images