High-yield beta-alanine engineering bacterium constructed based on I-type CRISPRi screening system and method

Abstract

The invention discloses a high-yield beta-alanine engineering bacterium constructed based on an I-type CRISPRi screening system and a method. PckA genes encoding oxaloacetic acid to phosphoenolpyruvic acid and nadB genes encoding L-aspartic acid to oxaloacetic acid are knocked out, so that a countercurrent path for synthesizing beta-alanine is blocked, and carbon loss is reduced; the ldhA gene and the poxB gene are knocked out, so that the content of synthesized pyruvic acid is increased; through overexpression of the NCgl0580 gene, the tolerance of EcN to a product is improved; by knocking out lacI genes in a genome, the adding cost of an inducer in the fermentation process is reduced; a target gene influencing the yield of beta-alanine in engineering bacteria is screened in a high-throughput manner by optimizing an I-type CRISPRi system, so that the screening efficiency and accuracy are remarkably improved, the aspartic acid tRNA ligase gene aspS capable of improving the yield of beta-alanine is obtained, the PanD enzyme activity is increased by overexpressing the aspS, and the yield of beta-alanine is further improved.

Description

(I) Technical field

[0001] The present invention relates to a high-yield beta-alanine engineering bacterium and a method thereof constructed based on a type I CRISPRi screening system. (II) Background technology

[0002] Escherichia coli Nissle 1917 (EcN) is a Gram-negative probiotic that has no enterotoxins or cytotoxins associated with other pathogenic E. coli. It is a recognized safe strain that can prevent pathogen infection by strengthening the intestinal mucosal barrier and stimulating the immune system. It can be used to prevent and treat gastrointestinal dysfunction and immune diseases. In addition, EcN has the characteristics of rapid growth and is considered to be an ideal platform for producing metabolites, suitable for industrial production and fermentation.

[0003] The CRISPR-Cas system is a defense mechanism in nature that prokaryotes use to resist the invasion of foreign genetic elements. It is also widely used as a tool for gene editing and regulation. There are currently six known types of CRISPR-Cas systems, of which Type II stands out for its wide application. In this system, the Cas9 protein can recognize and cut target DNA sequences under the guidance of specific guide RNA (sgRNA), which are complementary to the sgRNA and adjacent to a specific PAM sequence. The inactive mutant of Cas9, dCas9, has lost the ability to cut DNA, but can still locate specific DNA sequences. By locating dCas9 to the promoter region of a gene or its non-coding strand, the transcriptional activity of the gene can be inhibited, achieving a silencing effect on the gene. In the Type I system, mature crRNA and CasA-D proteins assemble into a Cascade complex, which can recognize and bind to specific sites of the target DNA, and in the process recruit Cas3 protein for DNA cutting. When Cas3 function is lost, crRNA and the Cascade complex can still locate the target site and inhibit the transcription process of the gene by physical obstruction. Although type I CRISPR-Cas systems have been found in a variety of bacteria, relatively few studies have been conducted on developing genetic screening tools based on this system.

[0004] β-Alanine, also known as 3-aminopropionic acid, is a non-essential amino acid with a molecular formula of C3H7O2N and a relative molecular mass of 89.09. It is widely used in the pharmaceutical, chemical, food and feed industries. In the pharmaceutical field, it is used as a precursor for the treatment of diseases such as gastroenteritis and tumors. In the chemical industry, it is used as an electroplating anti-corrosion agent and flocculant to effectively treat sewage and prevent material corrosion. In the food industry, it is used as an additive to improve the taste and antioxidant capacity of food and extend the shelf life. Adding β-alanine to feed can increase the carnosine content of animals, enhance antioxidant and anti-fatigue abilities, and improve meat quality. The synthesis methods of β-alanine include chemical synthesis, enzyme catalysis and fermentation. There are various chemical synthesis methods, but there are problems such as high energy consumption, many by-products and environmental pollution. The enzyme catalysis method has the advantages of environmental protection and high efficiency, but the raw material cost is relatively high. The fermentation method uses glucose as raw material, has low cost and high efficiency, is in line with environmental protection and sustainable development, and has good industrial application prospects. There are relatively few studies on the development of E. coli EcN as a chassis cell. The metabolic pathway of EcN in producing β-alanine is different from that of other chassis strains, which increases the difficulty of research. However, as a probiotic, EcN has the advantage of not producing virulence factors, so the engineered strain constructed by it can be directly used in animal husbandry feed as a nutritional additive. Preliminary experiments have shown that the growth rate of EcN is relatively fast, and its OD 600 The value is higher than that of other Escherichia coli strains and it shows extremely high tolerance to β-alanine, which further highlights the development value of EcN as a chassis cell. (III) Summary of the invention

[0005] The present invention aims to provide a high-yield β-alanine engineering bacteria and method based on type I CRISPRi screening system. First, the lacI gene regulating the lactose operon is knocked out on the EcN genome to obtain an engineering strain that does not require IPTG induction. Secondly, in order to increase the carbon flux of synthesizing β-alanine, the countercurrent pathway is blocked by deleting pckA (OAA to phosphoenolpyruvate, PEP) and nadB (L-ASP to OAA). Again, by expressing the β-alanine efflux gene NCgl0580 from Corynebacterium glutamicum, the tolerance of EcN to β-alanine is improved, and the yield of β-alanine is increased. Afterwards, in order to further increase the carbon flux of synthesizing β-alanine, the byproduct pathway is blocked by deleting ldhA (pyruvate to lactate) and poxB (pyruvate to acetate), and the engineered bacteria constructed use glucose as a carbon source, and its β-alanine yield is increased to 1.45g / L. Finally, the present invention uses this strain as a basis to construct a high-throughput screening system based on type I CRISPRi screening system, and uses it to screen metabolic genes that affect β-alanine production. By overexpressing the gene on the plasmid, the β-alanine production is further increased.

[0006] The technical solution adopted by the present invention is:

[0007] The invention provides an engineering bacterium with high beta-alanine production, wherein the engineering bacterium is based on E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA is a chassis bacterium (disclosed in patent application CN115927142A), which is constructed by knocking out one or more of the lacI gene, pckA gene, nadB gene, ldhA gene, and poxB gene in the genome, and overexpressing one or more of the NCgl0580 gene and the aspartate tRNA ligase gene aspS; the NCgl0580 gene is a β-alanine efflux gene derived from Corynebacterium glutamicum.

[0008] Preferably, the nucleotide sequence of the aspartate tRNA ligase gene aspS is shown in SEQ ID NO.15.

[0009] Preferably, the nucleotide sequence of the NCgl0580 gene is shown in SEQ ID NO.9.

[0010] Preferably, the NCgl0580 gene and the aspartate tRNA ligase gene aspS are overexpressed using plasmid pGLO.

[0011] Preferably, the ppC and aspA promoters P are expressed in the chassis bacteria J23100 Replaced with promoter P tac , the promoter P tac The nucleotide sequence is shown in SEQ ID NO.8.

[0012] Preferably, the engineered bacteria are one of the following: (1) knocking out the lacI gene in the genome of the chassis bacteria to construct the engineered bacteria ECN-7. (2) knocking out the pckA gene in the genome of the engineered bacteria ECN-7 and simultaneously removing the promoter P of the ppC-aspA expression in the chassis bacteria. J23100 Replace with P tac , construct the engineered bacterium ECN-8. (3) Knock out the nadB gene in the genome of the engineered bacterium ECN-8 to construct the engineered bacterium ECN-9. (4) The engineered bacterium ECN-9 was constructed using plasmid pGLO and promoter P J23100 Overexpression of NCgl0580 gene, namely, engineered bacteria ECN-10. (5) Knockout of ldhA gene in the genome of engineered bacteria ECN-10, namely, engineered bacteria ECN-11. (6) Knockout of poxB gene in the genome of engineered bacteria ECN-11, namely, engineered bacteria ECN-12. (7) Engineered bacteria ECN-12, using PJ23100 Promoter and pGLO plasmid overexpressed aspartate tRNA ligase gene aspS to construct the engineered bacterium ECN-24.

[0013] The most preferred engineered bacterium ECN-24 for high β-alanine production of the present invention is constructed by the following method:

[0014] (1) The panD gene from Bacillus subtilis and the J23100 promoter were connected to the pGLO vector by one-step cloning to obtain pGLO-P J23100 -panD;

[0015] (2) The amino acid 43 encoded by the panD gene from Bacillus subtilis on the plasmid vector was mutated by PCR to obtain the plasmid pGLO-P that can express high enzyme activity L-aspartate-α-decarboxylase. J23100 -panD K43Y ;

[0016] (3) Using the λ-RED recombination system, the cycA gene in the genome of E. coli Nissle 1917 was knocked out to obtain E. coli Nissle 1917ΔcycA with enhanced tolerance to intracellular β-alanine concentration;

[0017] (4) Using the λ-RED recombination system, the fumB1 gene, aspC gene, and pyk gene in the E. coli Nissle 1917ΔcycA gene were knocked out to obtain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk;

[0018] (5) The aspA gene from E. coli and the J23100 promoter were connected to the pSU19 vector by one-step cloning to obtain pSU19-P J23100 -aspA;

[0019] (6) The ppC gene fragment from the Corynebacterium glutamicum genome was obtained by PCR and cloned into pSU19-P J23100 -aspA was connected by one-step cloning to obtain pSU19-P J23100 -aspA-ppC;

[0020] (7) The fragment obtained by PCR from the aspB gene on the Corynebacterium glutamicum genome was fused to the vector pGLO-P J23100 -panD K43YThrough one-step cloning, pGLO-P J23100 -panD K43Y -aspB;

[0021] (8) Plasmid pSU19-P J23100 The J23100 promoter on the aspA-ppC was replaced with P by PCR and one-step cloning. tac promoter, resulting in pSU19-P tac -aspA-ppC;

[0022] (9) The NCgl0590 gene from the Corynebacterium glutamicum genome and the P J23100 The promoter was connected to the pGLO vector by one-step cloning to obtain pGLO-P J23100 -panD K43Y -aspB-NCgl0580;

[0023] (10) Using the λ-RED recombination system, the lacI gene, pckA gene, nadB gene, ldhA gene, and poxB gene in the genome of E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk were knocked out in sequence to obtain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB;

[0024] (11) The aspS gene from the E. coli Nissle 1917 genome and the P J23100 The promoter was connected to the pGLO vector by one-step cloning to obtain pGLO-P J23100 -panD K43Y -aspB-aspS-NCgl0580;

[0025] (12) Plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580-aspS and plasmid pSU19-P tac -aspA-ppC was transferred into Nissle1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB competent cells to obtain the engineered bacteria Nissle1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pGLO-P J23100 -panD K43Y-aspB-NCgl0580-aspS / pSU19-P tac -aspA-ppC, i.e. the engineered bacteria with high β-alanine production.

[0026] The present invention provides a method for constructing an engineering bacterium with high β-alanine production based on a type I CRISPRi screening system, the method comprising:

[0027] (1) The type I CRISPRi system includes Cascade protein and crRNA; the Cascade protein is expressed by a stringent promoter P J23100 -araC-P ara Induce expression; the crRNA is composed of P J23100 Promoter expression; the crRNA structure is repeat1-spacer-repeat2, the length of repeat1 is 8bp; the length of repeat2 is 21bp; the spacer is a random mutation base N, with a length of 32bp;

[0028] (2) knocking out the endogenous plasmid pMUT1 of the engineered bacteria by CRISPR / Cas9 gene editing, transferring to the type I CRISPRi system in step (1), and using the β-alanine dual fluorescence detection method to screen the target gene that affects β-alanine production;

[0029] (3) Overexpressing the target gene in the engineered bacteria and screening for engineered bacteria that produce high β-alanine yields.

[0030] Preferably, the nucleotide sequence of repeat1 is: ATAAACCG. The nucleotide sequence of repeat2 is: GAGTTCCCCGCGCC AGCGGGG.

[0031] Preferably, the knockout of the endogenous plasmid pMUT1 is accomplished by replacing it with plasmid pTargetF.

[0032] The present invention also provides an application of the engineered bacteria with high beta-alanine production in fermentation to produce beta-alanine, wherein the application comprises: inoculating the engineered bacteria into a fermentation medium, and performing shake flask fermentation culture for more than 12 hours at 37°C and 200-220 rpm, and obtaining a fermentation liquid containing beta-alanine after the fermentation is completed; the fermentation medium comprises: 14 g / L K2HPO4·3H2O, 5.2 g / L KH2PO4, 2 g / L (NH4)2SO4, 0.3 g / L MgSO4, and 1 g / L tryptone, the solvent is ddH2O, the pH value is 7.0, and the solvent is water. Preferably, the fermentation is carried out in a fermenter, and after fermentation for 10 hours at 37°C, pH 6-8, and maintaining a dissolved oxygen value of 20%-50%, feed culture medium is added at a rate of 40-60mL / min until the fermentation is completed to obtain a fermentation broth containing β-alanine; the fermenter culture medium comprises: 50g / L glucose, 28g / L K2HPO4·3H2O, 10.4g / L KH2PO4, 4g / L NH4Cl, 0.6g / L MgSO4, 2g / L tryptone, 4g / L YEAST EXTRACT (yeast powder), 1mL 10× metal ions, 1mL / L organic silica gel defoamer, and the solvent is water.

[0033] The feed medium comprises: 50 g / L glucose, 28 g / L K2HPO4·3H2O, 10.4 g / L KH2PO4, 4 g / L NH4Cl, 0.6 g / L MgSO4, 2 g / L tryptone, 4 g / L YEAST EXTRACT (yeast powder), 1 mL 10× metal ion, 1 mL / L organic silica gel defoamer, and the solvent is water. The amount of feed medium added is to maintain the residual glucose concentration in the fermentation broth at 2-4 g / L.

[0034] Preferably, the engineered bacteria are first activated on a slant and cultured for seed expansion before fermentation, and then the seed solution is inoculated into the fermentation medium at an inoculum concentration of 1-2% by volume, as follows:

[0035] (1) inoculating the engineered bacteria on an LB plate and culturing in a 37°C incubator overnight; LB plate medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 2 g / L, solvent is water, pH value is natural; (2) picking a single colony of step (1) and inoculating it into LB liquid medium, culturing it in a 37°C incubator at a speed of 200 rpm overnight to obtain seed liquid; LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, solvent is water, pH value is natural; (3) inoculating the seed liquid of step (2) into a basic salt M9 medium at an inoculum concentration of 1-5% by volume, culturing it in a 37°C incubator at a speed of 200 rpm for 24 hours to obtain a fermentation liquid containing β-alanine; basic salt M9 medium composition: K2HPO4·3H2O 14 g / L, KH2PO4 5.2g / L, (NH4)2SO4 2g / L, MgSO40.3g / L, trypsin 1g / L, solvent is ddH2O, pH value is 7.0, solvent is water.

[0036] In the present invention, in order to reduce carbon loss, the pckA gene encoding oxaloacetate to phosphoenolpyruvate and the nadB gene encoding L-aspartate to oxaloacetate are knocked out, so that the countercurrent pathway for synthesizing beta-alanine is blocked. In order to increase the content of synthesized pyruvate, the ldhA gene and the poxB gene for synthesizing byproducts such as lactic acid and acetic acid in the fermentation broth are knocked out. Finally, in order to reduce the fermentation cost, an induction agent is not required for induction, and an engineered strain that does not require IPTG induction is obtained by knocking out the lacI gene on the Nissle 1917 genome.

[0037] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: (1) the present invention reduces the cost of adding an inducer (IPTG) in the fermentation process by knocking out the lacI gene in the genome, and blocks the countercurrent pathway for synthesizing β-alanine by knocking out the pckA gene encoding oxaloacetate to phosphoenolpyruvate and the nadB gene encoding L-aspartate to oxaloacetate, thereby reducing carbon loss; by overexpressing the NCgl0580 gene, the tolerance of EcN to the product is improved; by knocking out the ldhA gene and the poxB gene, the content of synthesized pyruvate is increased; and a small-scale fermentation production process for β-alanine production bacteria is established;

[0038] (2) The present invention optimizes the type I CRISPRi system to perform high-throughput screening of target genes that affect β-alanine production in chassis bacteria. The optimized system solves the quality problem of screening mutant libraries and significantly improves the screening efficiency and accuracy.

[0039] (3) By overexpressing the aspartate tRNA ligase gene aspS, the panD enzyme activity was increased, further improving the β-alanine production.

[0040] (4) The present invention uses engineered bacteria to ferment and produce β-alanine. The fermentation production process is safe and pollution-free. The fermentation liquid can not only be used to prepare industrial and food-grade β-alanine chemical raw materials, but also can be directly used for feeding farmed animals. (IV) Description of the drawings

[0041] Figure 1 Figure 2 shows the metabolic diagram of β-alanine synthesis in Escherichia coli Nissle 1917.

[0042] Figure 2 The electrophoresis diagram of the construction process of the engineering bacteria EcN-7 in Example 1 and the biomass and β-alanine production diagram; A represents the electrophoresis diagram of the colony PCR of the chassis bacteria EcN-6 with the lacI gene knocked out, lane 1 represents 5K Marker, lane 2 represents the chassis bacteria EcN-6, and lanes 3 and 4 represent the lacI gene knockout strain; B represents the biomass and β-alanine production diagram of the engineering bacteria EcN-6 and EcN-7.

[0043] Figure 3 The electrophoresis diagram of the construction process of the engineered bacteria EcN-8 in Example 2 and the biomass and β-alanine yield diagram; A represents the electrophoresis diagram of the colony PCR of E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacI knocking out the pckA gene, lane 1 represents 5K Marker, lanes 2-12 represent pckA gene knockout strains, and lane 13 represents the chassis bacteria EcN-6; B represents the electrophoresis diagram of the colony PCR after eliminating resistance, lane 1 represents 5K Marker, lanes 2-8 represent pckA gene knockout strains, and lane 9 represents the chassis bacteria EcN-6; C represents the biomass and β-alanine yield diagram of the engineered bacteria EcN-7 and EcN-8.

[0044] Figure 4The electrophoresis diagram of the construction process of the engineered bacteria EcN-9 in Example 3 and the biomass and β-alanine production diagram; A represents the colony PCR verification gel diagram of E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckA knocking out the nadB gene; Lane 1 represents 5K Marker, Lane 8 represents the engineered bacteria EcN-6, and Lanes 2-7 represent the elimination of Kan resistance on the genome of the nadB knockout strain; B represents the colony PCR electrophoresis diagram after eliminating the Kan resistance gene on the EcN genome, Lane 1 represents 5KMarker, Lane 2 represents the engineered bacteria EcN-6, and Lanes 3-10 represent the elimination of Kan resistance on the genome of the nadB knockout strain. C represents the biomass and β-alanine production diagram of the engineered bacteria EcN-8 and EcN-9.

[0045] Figure 5 The sequencing results of the recombinant plasmid in the engineered bacteria EcN-10 in Example 4 and the biomass and β-alanine production diagram; A represents the recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580 sequencing results; B represents the biomass and β-alanine production of EcN-9 and EcN-10.

[0046] Figure 6 The electrophoresis diagram of the construction process of the engineered bacteria EcN-11 in Example 5 and the diagram of biomass and β-alanine production; A represents the colony PCR verification gel image of E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB knocking out the ldhA gene, lane 1 represents 5K Marker, and lanes 2-11 represent the ldhA gene knockout strain; B represents the colony PCR electrophoresis diagram after eliminating the Kan resistance gene on the EcN genome, lane 1 represents 5K Marker, lane 2 represents the chassis bacteria EcN-6, and lanes 3-6 represent the elimination of Kan resistance on the genome of the ldhA knockout strain.

[0047] Figure 7The electrophoresis diagram of the construction process of the engineered bacteria EcN-12 in Example 6 and the biomass and β-alanine production diagram; A represents the colony PCR verification gel diagram of E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA knockout of the poxB gene, lane 1 represents 5K Marker, and lanes 2-7 represent poxB gene knockout strains; B represents the colony PCR elimination of the Kan resistance gene on the EcN genome. The gel diagram, lane 1 represents 5K Marker, lane 2 represents the engineered bacteria EcN-6, and lanes 3-6 represent the elimination of Kan resistance on the poxB knockout strain genome; C represents the biomass and β-alanine production diagram of the engineered bacteria EcN-11 and EcN-12.

[0048] Figure 8 This is a diagram of the production of β-alanine by batch fed-batch culture in a fermentation tank of the engineered bacteria EcN-12 in Example 8.

[0049] Fig. 9 This is the experimental process of constructing a type I CRISPRi high-throughput screening system using the engineered bacterium EcN-12 as the chassis bacterium in Example 9 and using it to screen β-alanine metabolic genes.

[0050] Fig.10 The construction and sequencing results of the random library and the β-alanine yield in Example 9. A represents the plate colony count after the plasmid library is electrotransformed into the high-throughput screening chassis strain; B is the result of Sanger sequencing of a randomly selected single colony; C is the result of the biomass and β-alanine yield of the random mutant strain detected by the dual fluorescence method.

[0051] Fig.11 The biomass and β-alanine yield results of the mutant strains tested in Example 10 are shown.

[0052] Fig.12 This is a graph showing the results of measuring the activity of the enzyme encoded by the panD gene in Example 11.

[0053] Fig.13 The biomass and β-alanine yield results of EcN-12 and EcN-24 in Example 12. (V) Specific implementation methods

[0054] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0055] The experimental methods in the examples are conventional methods unless otherwise specified. The experimental materials used in the examples are conventional biochemical reagents unless otherwise specified.

[0056] The E. coli Nissle 1917 strain used in the present invention was purchased from Hangzhou Fenghai Biotechnology Co., Ltd., and the strain was identified by Zhejiang Tianke High-tech Development Co., Ltd.

[0057] E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA, disclosed in patent application CN115927142A, denoted as EcN-6.

[0058] LB medium composition: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, ddH2O, pH natural.

[0059] LB plate medium is prepared by adding agar to LB liquid medium at a final concentration of 2 g / L.

[0060] The composition of the basic salt M9 medium is: K2HPO4·3H2O 14g / L, KH2PO4 5.2g / L, (NH4)2SO4 2g / L, MgSO4 0.3g / L, trypsin 1g / L, the solvent is ddH2O, the pH value is 7.0, and the solvent is water.

[0061] Example 1: Knockout of the lacI gene in the EcN-6 bacterium

[0062] In order to reduce the cost of adding inducers during fermentation, the λ-RED recombination system was used to knock out the chassis bacteria E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA strain, the lactose operon encodes the repressor protein gene lacI (gene accession number 945007), and the economical β-alanine-producing engineered strain EcN-7 is constructed. The specific steps are as follows:

[0063] (1) Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using primers lacI-UP-F / lacI-UP-R and primers lacI-down-F / lacI-down-R, respectively, to obtain fragments of the upstream and downstream homologous arms of the target gene lacI. The upstream nucleotide sequence is shown in SEQ ID NO.1, and the downstream nucleotide sequence is shown in SEQ ID NO.2. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 57°C for 15 s, and 72°C for 3 min, repeated for 30 cycles; and further extension at 72°C for 10 min.

[0064] (2) Resistance fragment amplification: Using pKD4 plasmid (gift from Kirill A. Datsenko & Barry L. Wanner) as a template, primers lac-Kan-F and primers lacI-Kan-R in Table 1 were used to PCR amplify the kanamycin resistance fragment with FRT site on the pKD4 plasmid. The nucleotide sequence is as shown in SEQ ID NO.3, wherein the FRT site nucleotide sequence is 1-48 bp and 1393-1427 bp in SEQ ID NO.3; the Kan resistance nucleotide sequence is 49-1392 bp in SEQ ID NO.3.

[0065] The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 57°C for 15 s, and 72°C for 4 min, repeated for 30 cycles; and further extension at 72°C for 10 min.

[0066] (3) Preparation of Donor DNA: Primers lacI-UP-F and primers lacI-down-R are used to connect the Kan resistance fragment with FRT site in step (2) and the upstream and downstream homology arms in step (1) to obtain the Kan resistance gene fragment containing the upstream and downstream homology arms, which is the Donor DNA.

[0067] (4) Competent cells: The pKD46 plasmid (gift from Kirill A. Datsenko & Barry L. Wanner) was transformed into the E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk strain by electroporation to obtain the E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk strain containing the pKD46 plasmid. The strain was inoculated into LB medium containing 0.1 mg / mL ampicillin and 30 mM arabinose and cultured at 30°C and 200 rpm until the OD reached 0. 600 When the concentration reached 0.6, the bacterial solution was centrifuged at 9000 rpm for 5 min, and the precipitate was washed four times with sterile distilled water to obtain competent cells.

[0068] (5) Strains with knockout of target gene: The Donor DNA gene fragment in step (3) was electrotransformed into competent cells in step (4) at 1.8KV, and the electrotransformed bacterial solution was incubated at 30°C for 2h. After centrifugation at 9000rpm for 1min, 900μL of supernatant was discarded for each 1mL of bacterial solution, and 50μL of the precipitate was applied to an LB plate containing 0.05mg / mL kanamycin and 0.1mg / mL ampicillin resistance, and cultured at 30°C overnight. A single colony was picked as a template, and PCR was performed using primers lacI-detection-F and primer Kan-R-detection. Under the same conditions, agarose gel electrophoresis analysis was performed using the chassis bacteria EcN-6 as a control, and the results are shown in A in 2. It was observed that the knockout strain had DNA bands in the 1.0% agarose gel, and the chassis bacteria had no bands, confirming the deletion of the lacI gene. Screening obtained strains with knockout of cycA, fumB1, aspC, pyk, and lacI.

[0069] (6) Elimination of pKD46 plasmid: The strain in step (5) was inoculated in LB liquid medium containing 0.05 mg / mL kanamycin resistance, cultured at 37°C for 12 h to eliminate pKD46, and then inoculated on LB plates containing 0.05 mg / mL kanamycin resistance and LB plates containing 0.1 mg / mL ampicillin and 0.05 mg / mL kanamycin resistance, cultured at 37°C for 12 h, and screened to obtain a knockout strain that eliminated the pKD46 plasmid. The competent cells were prepared using the method in step (4).

[0070] (7) Elimination of resistance: The pCP20 plasmid (purchased from Kirill A. Datsenko & Barry L. Wanner) was introduced into the competent cells in step (6) by electroporation, and cultured on LB plates containing 0.025 mg / mL chloramphenicol resistance at 30°C for 12 h to screen transformants. The transformants were cultured in LB liquid medium containing 0.025 mg / mL chloramphenicol resistance at 42°C for 12 h to eliminate kanamycin resistance on the genome. The cultured bacterial solution was diluted 10 4 After folding, spread on LB plate containing 0.025mg / mL chloramphenicol resistance and culture at 30℃ for 12h. The obtained single colony is first streaked on LB double-resistance plate containing 0.05mg / mL kanamycin resistance and 0.025mg / mL chloramphenicol resistance, cultured at 37℃ for 12h; then pick the single colony on the double-resistance plate and continue to streak on LB plate containing 0.025mg / mL chloramphenicol resistance, cultured at 30℃ for 12h. Pick the colony that does not grow on the double-resistance plate but grows on the single-resistance plate, that is, the kanamycin resistance on the genome is eliminated.

[0071] (8) Elimination of pCP20 plasmid: The colonies that did not grow on the dual-antibody but grew on the monoclonal antibody in step (7) were inoculated onto LB plates containing 0.025 mg / mL chloramphenicol resistance and LB plates without 0.025 mg / mL chloramphenicol resistance, respectively, and cultured at 37°C for 12 h. The knockout strain that did not grow on the LB plate containing 0.025 mg / mL chloramphenicol resistance but grew on the LB plate without chloramphenicol resistance was selected, namely, the E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacI strain. The knockout strain was prepared as competent, and the recombinant plasmid pGLO-P was transformed into the competent strain by electroporation. J23100 -panD K43Y With pSU19-P J23100 -ppC-aspA was introduced into the knockout strain to obtain the engineered bacterium E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacI / pGLO-P J23100 -pan D K43Y / pSU19-P J23100 -ppC-aspA, denoted as engineered bacteria EcN-7.

[0072] (9) Determination of biomass and β-alanine production

[0073] EcN-6 and EcN-7 were streaked on LB plates and cultured overnight in a 37°C incubator. A single colony was picked and inoculated into 5 mL of LB liquid culture medium and cultured overnight in a 37°C incubator at 200 rpm to obtain seed solution. 1 mL of seed solution was inoculated into a 250 mL shake flask with 50 mL of basic salt M9 culture medium and 0 or 100 g / L of inducer IPTG. The shake flask was then cultured in a 37°C incubator at 200 rpm for 24 h, and 1 mL of liquid was taken from the shake flask to measure OD 600 , the results are as follows Figure 2 As shown in B.

[0074] At the same time, 1 mL of liquid was taken from the shake flask, centrifuged at 9000 rpm for 1 min, the supernatant was taken, and it was derivatized. After filtering with an organic membrane with a pore size of 45 μm, the filtrate was analyzed by HPLC for the content of β-alanine in the fermentation broth. The results are shown in Figure 2 As shown in B. The results show that knocking out the lacI gene on the EcN-6 genome can further increase the production of β-alanine under both IPTG-induced and non-induced conditions. Under non-induced conditions, the production of β-alanine can reach 1.22 g / L, which is 1.0 times the original. Under induced conditions, the production can reach 1.32 g / L, which is 1.1 times the original.

[0075] HPLC detection conditions: Wanyi high performance liquid chromatography instrument; chromatographic column: XB-C18 chromatographic column (250mm×4.6nm); mobile phase is methanol: 0.05mol / L acetic acid-sodium acetate buffer solution (55:45, V / V); flow rate: 1.0mL / min; column temperature is room temperature.

[0076] Derivatization of samples: Take 100 μL of sample, add 100 μL of 0.5 mol / L NaHCO3 aqueous solution and 0.1 mL of 1% 2,4-dinitrofluorobenzene in acetonitrile solution, react at 60°C in the dark for 30 min, then add 700 μL of 0.2 mol / L pH 7 phosphate buffer.

[0077] Table 1: Primer sequences

[0078]

[0079]

[0080] Example 2: Knockout of the pckA gene in the EcN-7 genome and replacement of the promoter of ppC-aspA with P tac

[0081] In order to make more oxaloacetate flow to L-aspartate, E. coli Nissle1917ΔcycAΔfumB1ΔaspCΔpykΔlacI / pGLO-P was knocked out by λ-RED recombination system. J23100 -panD K43Y -aspB / pSU19-P J23100 The pckA gene (gene accession number: 75060023) related to oxaloacetate complementation of PEP in the -ppC-aspA strain was used to enhance the metabolic pathway of phosphoenolpyruvate to oxaloacetate, and the β-alanine-producing engineered strain EcN-8 with enhanced phosphoenolpyruvate to oxaloacetate pathway was constructed. tac The promoter (nucleotide sequence is shown in SEQ ID NO.8) is replaced. The specific steps are as follows:

[0082] (1) Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using primers pckA-up-F / pckA-up-R and primers pckA-down-F / pckA-down-R, respectively, to obtain fragments of the upstream and downstream homologous arms of the target gene pckA. The upstream nucleotide sequence is shown in SEQ ID NO.4, and the downstream nucleotide sequence is shown in SEQ ID NO.5. The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 55°C for 15 s, and 72°C for 4 min, repeated for 30 cycles; and continued extension at 72°C for 10 min.

[0083] P tac Promoter sequence: TTGACAATTAATCATCGGCTCGTATAATG (SEQ ID NO.8)

[0084] (2) Resistance fragment amplification: As in Example 1, primers pckA-Kan-F and primers pckA-Kan-R in Table 2 were used to PCR amplify the kanamycin resistance fragment with FRT site on the pKD4 plasmid. The nucleotide sequence is shown in SEQ ID NO.3.

[0085] (3) Preparation of Donor DNA: Primers pckA-UP-F and primer pckA-down-R were used to connect the Kan resistance fragment containing the FRT site and the upstream and downstream homology arms to obtain the Kan resistance gene fragment containing the upstream and downstream homology arms, which is the Donor DNA.

[0086] (4) Competent cells: E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacI was prepared in the same manner as in Example 1.

[0087] (5) Strains with knockout of target gene: Same as in Example 1, the Donor DNA fragment from step (3) was electrotransformed into competent cells from step (4) at 1.8KV, and PCR was performed with primers pckA-detect-F and primers Kan-R-detect. Under the same conditions, 1.0% agarose gel electrophoresis was performed with EcN-6 as the control, and the results are shown in A in 3. DNA bands were observed in the knockout strains, but no bands were observed in the EcN-6, confirming the absence of the pckA gene. Screening was performed to obtain strains with knockout of cycA, fumB1, aspC, pyk, lacI, and pckA.

[0088] (6) Elimination of plasmid: Same as Example 1.

[0089] (7) Elimination of resistance: As in Example 1, colony PCR was performed using primers pckA-UP-F and primers pckA-down-R. Under the same conditions, 1.0% agarose gel electrophoresis was performed with the bottom plate bacteria as the control. The results are as follows: Figure 3 As shown in B. It was observed that the size of the DNA band in the knockout strain was exactly the size of the target gene pckA compared to the base strain, which means that the kanamycin resistance on the Nissle 1917 genome was eliminated.

[0090] (8) Elimination of pCP20 plasmid: The strains selected in step (7) were subjected to elimination of pCP20 plasmid according to the method of Example 1, and the non-resistant knockout strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckA was screened and introduced into the recombinant plasmid pGLO-P J23100 -panD K43Y -aspB and pSU19-P tac -aspA-ppC, obtain the engineered bacteria E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckA / pGLO-P J23100 -panD K43Y -aspB / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-8.

[0091] Plasmid pSU19-P tac -aspA-ppC was constructed as follows: pSU19-P J23100 -ppC-aspA was used as a template, and PCR amplification was performed using primers pSU-tac-F and primers pSU-tac-R in Table 2. The PCR product was detected by 1.0% agarose gel electrophoresis and the template was eliminated with DpnI. The PCR product fragment was purified to obtain the linearized vector pSU19-P tac -aspA-ppC.

[0092] PCR reaction conditions: pre-denaturation at 95°C for 5 min, 95°C for 30 s, 57°C for 30 s, and 72°C for 4 min, for a total of 30 cycles, and a final extension at 72°C for 10 min.

[0093] (9) Determination of biomass and β-alanine production

[0094] The biomass and β-alanine production of the engineered bacteria EcN-8 after induction culture were determined using the method of Example 1, with EcN-7 as the control. The results are as follows: Figure 3 As shown in C. The results showed that blocking oxaloacetate to supplement PEP can increase the production of β-alanine. Compared with the EcN-7 strain, the production reached 1.28 g / L, which was 0.9 times that of the control strain.

[0095] Table 2: Primer sequences

[0096]

[0097]

[0098] Example 3: Knockout of the nadB gene in the engineered bacterium EcN-8

[0099] In order to reduce the loss of L-aspartate, the precursor metabolite of β-alanine, the E. coli Nissle1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckA / pGLO-P was recombined with the λ-RED system. J23100 -panD K43Y -aspB / pSU19-P tac The L-aspartate oxidase gene nadB (gene accession number 947049) in the AspC countercurrent pathway of the -ppC-aspA strain was knocked out to construct an economical and suitable β-alanine-producing engineered strain EcN-9. The specific steps are as follows:

[0100] (1) Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using primers nadB-up-F / nadB-up-R and primers nadB-down-F / nadB-down-R in Table 3, respectively, to obtain fragments of the upstream and downstream homologous arms of the target gene nadB. The upstream nucleotide sequence is shown in SEQ ID NO.6, and the downstream nucleotide sequence is shown in SEQ ID NO.7.

[0101] The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 55°C for 15 s, and 72°C for 4 min, repeated for 30 cycles; and further extension at 72°C for 10 min.

[0102] (2) Kanamycin resistance fragment with FRT site: The method of Example 1 was used, with pKD4 plasmid as template, and nadB-Kan-F and nadB-Kan-R primers were used for PCR amplification to obtain a Kanamycin resistance fragment with FRT site, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0103] (3) Preparation of Donor DNA: Primers nadB-up-F and primer nadB-down-R were used to connect the Kan resistance fragment containing the FRT site and the upstream and downstream homology arms to obtain the Kan resistance gene fragment containing the upstream and downstream homology arms, namely the Donor DNA.

[0104] (4) Competent cells: The plasmid pKD46 was transformed into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckA using the method of Example 1, and competent cells were prepared.

[0105] (5) Strains with knockout of target gene: Using the method of Example 1, the Donor DNA gene fragment of step (3) was electrotransformed into the competent cells of step (4) at 1.8KV, and PCR was performed with primers nadB-detect-F and primers Kan-R-detect. Under the same conditions, 1.0% agarose gel electrophoresis analysis was performed with the bottom plate bacteria as the control, and the results are shown in A in 4. It was observed that the knockout strain had a DNA band, while the bottom plate bacteria had no band, confirming the absence of the nadB gene. Screening obtained strains with knockout of cycA, fumB1, aspC, pyk, lacI, pckA, and nadB.

[0106] (6) Elimination of plasmid: Same as Example 1.

[0107] (7) Elimination of resistance: As in Example 1, the pCP20 plasmid was introduced into the competent cell of step (6), and colony PCR was performed using primers nadB-up-F and primers nadB-down-R. Under the same conditions, 1.0% agarose gel electrophoresis was performed with the bottom plate bacteria as the control, and the results are shown in 4B. It was observed that the size of the DNA band in the knockout strain was exactly the size of the target gene nadB missing compared to the bottom plate bacteria, which means that the kanamycin resistance on the bottom plate bacteria genome was eliminated.

[0108] (8) Elimination of pCP20 plasmid: As in Example 1, the recombinant plasmid pGLO-P J23100 -panD K43Y and pSU19-P tac -aspA-p pC was introduced into the knockout strain to obtain the engineered bacteria E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB / pGLO-P J23100 -panD K43Y / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-9.

[0109] (9) Determination of biomass and β-alanine production

[0110] The biomass and β-alanine production of the engineered bacterium EcN-9 were determined using the method of Example 1. The results are as follows: Figure 4 As shown in C. The results showed that knocking out the L-aspartate oxidase gene nadB and reducing the loss of the β-alanine precursor metabolite L-aspartate can increase the production of β-alanine. Compared with the EcN-8 strain, the production reached 1.36 g / L, which is 1.1 times that of the control strain.

[0111] Table 3: Primer sequences

[0112] nadB-up-F CCAGTATCCCGCTATCGTC nadB-up-R GCTCCAGCCTACACAATCGCTAAACACGGTTTGGTCAGC nadB-down-F TCCCATGTCAGCCGTTAAGTTGGCCCACGAATGACTAAG nadB-down-R CGCAGAACCGAGTACATCAC nadB-detect-F GAGCGATGGCAGAGAATCAA nadB-Kan-F GCTGACCAAACCGTGTTTAGCGATTGTGTAGGCTGGAGC nadB-Kan-R CTTAGTCATTCGTGGGCCAACTTAACGGCTGACATGGGA

[0113] Example 4: Overexpression of NCgl0580 gene in engineered bacteria EcN-9

[0114] (1) Recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580

[0115] The genome of Corynebacterium glutamicum (gift from Zhang Bo) was used as a template, and the primer fragment DBC-PD-F and the primer fragment DBC-PD-R in Table 4 were used for PCR amplification to obtain the NCgl0580 gene amplification product (nucleotide sequence as shown in SEQ ID NO.9), and the PCR product was detected by 1.0% agarose gel electrophoresis and the template was eliminated with DpnI. PCR reaction conditions: pre-denaturation at 95°C for 5min, 95°C for 30s, 57°C for 30s, 72°C for 3min, a total of 30 cycles, and finally 72°C for 10min extension.

[0116] pGLO-P J23100 -panD K43Y -aspB vector was used as a template, and primers DBC-ZT-F and DBC-ZT-R were used for PCR amplification to obtain pGLO-P J23100 -panD K43Y -aspB linearized vector.

[0117] One-step cloning kit was used to clone pGLO-P J23100 -panD K43Y -aspB linearized vector was connected with the purified PCR product fragment of NCgl0580 gene to obtain the cloned recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580 (sequence see Figure 5 The above recombinant plasmids were sequenced and verified to be correct plasmids.

[0118] (2) Recombinant bacteria: The recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580 and pSU19-P tac -aspA-ppC was introduced into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB to obtain the strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB / pGLO-P J23100-panD K43Y -aspB-NCgl0580 / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-10.

[0119] (3) Determination of biomass and β-alanine yield

[0120] The biomass and β-alanine production of the engineered bacteria EcN-9 and EcN-10 were determined using the method of Example 1. The results are shown in Figure 5 Figure B shows that the production of β-alanine was slightly increased by overexpressing the NCgl0580 gene from Corynebacterium glutamicum compared to the EcN-9 strain, which was 1.14 times higher than that of the control strain. This proves that the β-alanine efflux system from Corynebacterium glutamicum can function in EcN.

[0121] Table 4: Primer sequences

[0122] DBC-PD-F GTAAGCCTGCACGTTAACTAG DBC-PD-R GGCAATAATCAAGGGCATG

[0123] Example 5: Knockout of the ldhA gene in the engineered bacterium EcN-10

[0124] In order to reduce the loss of L-aspartate, the precursor metabolite of β-alanine, the E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB / pGLO-P was recombined with the λ-RED system. J23100 -panD K43Y -aspB-NCgl0580 / pSU19-P tac The lactate dehydrogenase gene ldhA (gene accession number 3939) encoding lactic acid in the -ppC-aspA strain was knocked out to alleviate the problem of low pH value in the fermentation broth. The specific steps are as follows:

[0125] (1) Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using primers ldhA-up-F / ldhA-UP-R and primers ldhA-down-F / ldhA-down-R in Table 5, respectively, to obtain fragments of the upstream and downstream homologous arms of the target gene ldhA, wherein the upstream homologous arm is shown in the nucleotide sequence SEQ ID NO.10, and the downstream homologous arm is shown in the nucleotide sequence SEQ ID NO.11.

[0126] The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 57°C for 15 s, and 72°C for 4 min, repeated for 30 cycles; and further extension at 72°C for 10 min.

[0127] (2) Kanamycin resistance fragment with FRT site: The method of Example 1 was used, with pKD4 plasmid as template, and ldhA-Kan-F and ldhA-Kan-R primers were used for PCR amplification to obtain a Kanamycin resistance fragment with FRT site, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0128] (3) Preparation of Donor DNA: Primers ldhA-UP-F and primer ldhA-down-R were used to connect the Kan resistance fragment and the upstream and downstream homology arms to obtain the Kan resistance gene fragment containing the upstream and downstream homology arms, namely, the Donor DNA.

[0129] (4) Competent cells: The plasmid pKD46 was transformed into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB using the method of Example 1, and competent cells were prepared.

[0130] (5) Strains with knockout of target gene: The Donor DNA gene fragment in step (3) was electrotransformed into competent cells in step (4) at 1.8KV, and PCR was performed with primers ldhA-detection-F and primers ldhA-R-detection. Under the same conditions, 1.0% agarose gel electrophoresis was performed with the bottom plate bacteria as the control, and the results were shown in 6A. DNA bands were observed in the knockout strains. Strains with knockout of cycA, fumB1, aspC, pyk, lacI, pckA, nadB, and ldhA were screened.

[0131] (6) Elimination of plasmid: Same as Example 1.

[0132] (7) Elimination of resistance: As in Example 1, the pCP20 plasmid was introduced into the competent cells of step (6), and colony PCR was performed using primers ldhA-up-F and primers ldhA-down-R. Under the same conditions, 1.0% agarose gel electrophoresis was performed with the bottom plate bacteria as the control. The results are as follows: Figure 6 As shown in B. It was observed that the size of the DNA band in the knockout strain was exactly the size of the target gene ldhA compared to the band in the chassis bacteria, which means that the kanamycin resistance on the chassis bacteria genome was eliminated.

[0133] (8) Elimination of pCP20 plasmid: Eliminate the pCP20 plasmid from the strain selected in step (7) according to the method of Example 1, and screen the non-resistant knockout strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA. Introduce the recombinant plasmid pGLO-P J23100 -panD K43Y-aspB-NCgl0580 and pSU19-P tac -aspA-ppC, obtained strain E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA / pGLO-P J23100 -panD K43Y -aspB-NCgl0580 / pSU 19-P tac -aspA-ppC, denoted as engineered bacteria EcN-11.

[0134] Table 5: Primer sequences

[0135]

[0136]

[0137] Example 6: Knockout of the poxB gene in the engineered bacterium EcN-11

[0138] In order to alleviate the inhibition of bacterial growth by byproducts in the fermentation broth, the E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA / pGLO-P was recombined with the λ-RED recombination system. J23100 -panD K43Y -aspB-NCgl0580 / pSU 19-P tac The pyruvate dehydrogenase gene poxB (gene accession number 946132) encoding acetate in the -ppC-aspA strain was knocked out to reduce carbon loss and further alleviate the problem of low pH in the fermentation broth. The specific steps are as follows:

[0139] (1) Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using primers poxB-up-F / poxB-up-R and primers poxB-down-F / poxB-down-R in Table 6, respectively, to obtain fragments of the upstream and downstream homologous arms of the target gene poxB. The upstream nucleotide sequence is shown in SEQ ID NO.12, and the downstream nucleotide sequence is shown in SEQ ID NO.13.

[0140] The PCR reaction conditions were as follows: 95°C for 5 min; 95°C for 15 s, 55°C for 15 s, and 72°C for 4 min, repeated for 30 cycles; and further extension at 72°C for 10 min.

[0141] (2) Kananavirus resistance fragment with FRT site: The method of Example 1 was used, with pKD4 plasmid as template, and PCR amplification was performed using primers poxB-Kan-F and poxB-Kan-R to obtain a Kananavirus resistance fragment with FRT site, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0142] (3) Preparation of Donor DNA: Primers poxB-up-F and poxB-down-R were used to connect the Kan resistance fragment with FRT site and the upstream and downstream homology arms to obtain the Kan resistance gene fragment containing the upstream and downstream homology arms, namely the Donor DNA.

[0143] (4) Competent cells: The plasmid pKD46 was transformed into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA using the method of Example 1, and competent cells were prepared.

[0144] (5) Knockout strain of target gene: Using the method of Example 1, the Donor DNA gene fragment of step (3) was electrotransformed into the competent cells of step (4) at 1.8KV, and PCR was performed with primers poxB-detect-F and primers poxB-R-detect. Under the same conditions, 1.0% agarose gel electrophoresis was performed with the bottom plate bacteria as the control. The results are as follows Figure 7 As shown in A. DNA bands were observed in the knockout strains. The strains with knockout of cycA, fumB1, aspC, pyk, lacI, pckA, nadB, ldhA, and poxB were screened and obtained.

[0145] (6) Elimination of plasmid: The method of Example 1 was used.

[0146] (7) Elimination of resistance: The method of Example 1 was used to perform colony PCR using primers ldhA-up-F and primers ldhA-down-R. Under the same conditions, 1.0% agarose gel electrophoresis was performed with the bottom plate bacteria as the control. The results are as follows: Figure 7 As shown in B. It was observed that the size of the DNA band in the knockout strain was exactly the size of the target gene poxB compared to the wild type, which means that the kanamycin resistance on the genome of the chassis bacteria was eliminated.

[0147] (8) Elimination of pCP20 plasmid: The strains selected in step (7) were subjected to elimination of pCP20 plasmid according to the method of Example 1, and the non-resistant knockout strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpox B was screened and introduced into the recombinant plasmid pGLO-P J23100-panD K43Y -aspB-NCgl0580 and pSU19-P tac -aspA-ppC, obtain the engineered bacteria E.coli Nissle 1917ΔcycAΔfumB1 aspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pGLO-P J23100 -panD K43Y -aspB-NCgl0580 / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-12.

[0148] (9) Determination of biomass and β-alanine production

[0149] The biomass and β-alanine production of the engineered bacteria EcN-9, EcN-10, EcN-11, and EcN-12 were measured using the method of Example 1. The results are as follows: Figure 7 As shown in C. When the poxB gene was further knocked out on the basis of deleting ldhA, it was found that the yield of EcN-12 was slightly increased to 1.45 g / L, which was 1.2 times that of the acid-producing strain without deletion, and the pH value was detected to be higher than that of EcN-11.

[0150] Table 6: Primer sequences

[0151] poxB-up-F CAGATGCTGACCAATGTAGC poxB-up-R GCTCCAGCCTACACAATCGCCGTCATAATAAGGACATGCC poxB-down-F TCCCATGTCAGCCGTTAAGTCCATCTCCTGAATGTGATGAC poxB-down-R ACGATTTCCCTGATTTGCC poxB-detect-F ATTTGATTCACCACCTGCC poxB-Kan-F GGCATGTCCTTATTATGACGGCGATTGTGTAGGCTGGAGC poxB-Kan-R GTCATCACATTCAGGAGATGGACTTAACGGCTGACATGGGA

[0152] Example 8: Fed-batch fermentation culture of the engineered bacteria EcN-12 in a 5 L fermenter.

[0153] (1) Activation culture:

[0154] E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔld hAΔpoxB / pGLO-P J23100 -panD K43Y -aspB-NCgl0580 / pSU19-P tac The -aspA-ppC strain was streaked on LB plate culture medium and activated and cultured overnight in an incubator at 37°C to obtain activated bacteria; LB plate culture medium: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, agar 2g / L, solvent is water, pH value is natural.

[0155] (2) Seed culture: fresh activated bacteria from step (1) were selected and inoculated into LB liquid culture medium test tubes, cultured overnight at 37°C and a shaking speed of 220 r / min, and then the culture solution was transferred to a 250 mL Erlenmeyer flask containing 50 mL of LB liquid culture medium at an inoculum concentration of 1% by volume, and cultured overnight at 37°C and a shaking speed of 220 r / min to obtain seed solution. LB liquid culture medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, the solvent is water, and the pH value is natural.

[0156] (3) Fed-batch fermentation culture:

[0157] According to the inoculation amount of 5% by volume, the seed liquid of step (2) was inoculated into a 5L fermenter with a liquid volume of 2L fermenter medium. The culture temperature was 37°C, pH 7.0, and the dissolved oxygen value was maintained at 20%. After 10 hours of fermentation, the feed medium was added at a rate of 50mL / min to maintain the residual glucose concentration in the fermenter at 3-4g / L until the fermentation was completed. The total fermentation time was 60 hours, and a total of 1L of feed medium was consumed. During the feeding process, samples were taken every 3 hours to measure the cell growth OD 600 , glucose residual sugar content (residual sugar analyzer) and β-alanine concentration (same as Example 1 HPLC). Figure 8 As shown, at about 60h, OD 600 The content of residual glucose was 4.8 g / L and the production of β-alanine reached 24.5 g / L.

[0158] Fermentation tank culture medium: 50 g / L glucose, K2HPO4·3H2O 28 g / L, KH2PO4 10.4 g / L, NH4Cl 4 g / L, MgSO4 0.6 g / L, tryptone 2 g / L, YEAST EXTRACT (yeast powder) 4 g / L, 1 mL 10× metal ion, 1 mL / L organic silica gel defoamer, the solvent is water.

[0159] 10× metal ion formula: weigh 10g CaCl2, 10g FeSO4·7H2O, 1g ZnSO4·7H2O, 0.2g CuSO4 and 0.02g NiCl2·7H2O and dissolve in 100mL ddH2O.

[0160] The composition of the feed medium: glucose 250 g / L, glycerol 250 g / L, yeast extract 4 g / L, KH2PO4 14 g / L, NH4Cl 10 g / L, MgSO4 0.3 g / L, defoamer 1 mL / L, the defoamer is an organic silica gel defoamer, and the solvent is water.

[0161] Example 9: Screening of genes affecting β-alanine production in EcN-12 strain based on type I CRSPRi high-throughput screening system Fig. 9 , test as follows:

[0162] (1) Construction of experimental strains capable of expressing Cascade protein: The recombinant plasmid pSU19-P J23100 -araC-P ara -cascade (same as Example 1 in patent application CN117210436A) was used to transform the engineered bacteria E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB in an electroporation competent state to obtain the strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -cascade, recorded as engineered bacteria EcN-13.

[0163] (2) Construction of negative strain without inhibitory function: The recombinant plasmid pGLO-P J23100 -panD-aspB (Hu S, et al. Appl Microbiol Biotechnol. 2023, 107 (7-8)) was transformed into the engineering bacteria EcN-13 electroporation competent cells to obtain the strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -cascade / pGLO-P J23100 -panD-aspB, denoted as engineered bacteria EcN-14.

[0164] (3) Construction of a positive strain expressing highly efficient targeted ptsG: The recombinant plasmid pGLO-P J23100 -panD-aspB-crRNAptsG (the same plasmid Z16 in patent application CN117210436A) was transformed into the engineering bacteria EcN-13 electroporation competent cells to obtain the strain E. col i Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -cascade / pGLO-P J23100-panD-aspB-crRNAptsG, denoted as engineered bacteria EcN-15.

[0165] The nucleotide sequence of crRNA targeting ptsG is: ATAAACCG AATGCATTTGCTAACCTGCAAAAGGTCGGTAA GAGTTCCCCGCGCCAGCGGGGATAAACCG , where 1-8bp is repeat1, 9-40bp is spacer, and 41-69bp is repeat2.

[0166] (4) Construction of random library

[0167] pGLO-P J23100 -PanD-aspB-crRNAptsG plasmid was used as a template, and the plasmid was amplified by reverse PCR using primers crispri-sx-F and crispri-sx-R in Table 7. The 32bp spacer sequence in crRNA was randomly mutated to N (N represents A / C / G / T), and then the linear product was transformed into DH5α, coated on an LB plate containing 0.05mg / mL ampicillin resistance, and cultured at 37°C for 12h. All the monoclones obtained were inoculated into a 5ml LB test tube containing 0.05mg / ml ampicillin resistance, cultured at 37°C for 12h, and the plasmid was extracted. After sequencing and comparison with the template plasmid, random mutations did occur. The results are as follows Fig.10 As shown in B. Then, the randomly mutated plasmid was transformed into the electrocompetent state of the engineering bacterium EcN-13, coated on a double-resistance LB plate containing 0.1 mg / ml ampicillin and 0.025 mg / ml chloramphenicol, and cultured at 37°C for 12 hours to obtain the corresponding monoclonal transformant on the double-resistance plate.

[0168] Cultivation of test strains: Culture the monoclonal transformants in LB tubes at 37°C overnight.

[0169] (5) Determination of β-alanine production in random mutant strains

[0170] After the culture, 1 mL of bacterial solution was taken to determine the OD of each group of bacteria. 600 The results are as follows: Fig.10 As shown in C. The β-alanine dual fluorescence detection method (Mingyue Fei, et al. Acta Biochim Biophys Sin, 2020, 52(00), 1–7) was used to detect each single clone transformant (library capacity was 4 32 ) was screened, with engineered bacteria EcN-14 as a negative control and engineered bacteria EcN-15 as a positive control. After the initial screening, hundreds of strains were obtained, and the results were as follows Fig.10As shown in A, these strains showed significant differences in β-alanine production compared with EcN-14 or EcN-15.

[0171] These hundreds of transformed strains were further screened (detection of OD 600 Then, the target strain obtained by screening was subjected to Sanger sequencing using the detection primer spacer-JC-F in Table 7 to obtain the gene sequence of its spacer region. In SnapGene software, we searched and compared these sequences with reference to the gene map of E. coli Nissle1917 to determine the targeted gene and screen for OD 600 values ​​and β-alanine production.

[0172] Table 7: Primer sequences

[0173]

[0174] Example 10: Optimization of type I CRISPRi high-throughput screening system in EcN-12 strain

[0175] (1) Construction of plasmid pTargetF targeting pMUT1:

[0176] Using plasmid pTargetF (Li Shuai. Construction of E. coli K5△pta strain and capsular polysaccharide analysis [D]. Zhejiang University of Technology, 2018) as a template, the plasmid was linearized using primers pF(pMYT1)F and pF(pMYT1)R in Table 8 and then transferred into DH5α to obtain plasmid pTargetF targeting pMUT1.

[0177] (2) Knockout of EcN endogenous plasmid pMUT1 using CRISPR / Cas9 gene editing:

[0178] The plasmid pTargetF was transformed into the electroporation competent cell of the engineering bacterium EcN-12, and was recorded as the engineering bacterium EcN-16. The plasmid pCas9 (Jiang Y et al. Applied and environmental microbiology, 2015, 81(7): 2506-2514) was transformed into the electroporation competent cell of the engineering bacterium EcN-16, and was recorded as the engineering bacterium EcN-17. The engineered bacteria EcN-17 was inoculated into a 5 ml LB test tube containing a final concentration of 20 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and 0.05 mg / mL kanamycin resistance, and cultured overnight at 30°C. The bacterial solution was diluted and spread on a double resistance plate containing 0.05 mg / ml kanamycin and 0.05 mg / ml spectinomycin and a single resistance plate containing 0.05 mg / mL kanamycin. The transformant that did not grow on the double resistance plate but grew on the single resistance plate was the strain in which pTargetF was removed and contained pCas9, and was recorded as the engineered bacteria EcN-18. The engineered bacteria EcN-18 was inoculated into a 5 ml LB test tube and cultured at 42°C overnight. The bacterial solution was diluted and spread on LB plates containing 0.05 mg / ml kanamycin resistance and LB plates without resistance. The transformants that did not grow on the resistance plate but grew on the LB plate were taken, that is, the strain with the temperature-sensitive plasmid pCas9 removed, and were recorded as engineered bacteria EcN-19.

[0179] (3) Plasmid pMUT1-P J23100 - Construction of panD-aspB:

[0180] pMUT1 is an endogenous plasmid of E. coli Nissle 1917 and has a higher copy number in E. coli Nissle 1917. Therefore, using pMUT1 to highly express panD and aspB not only does not impose an additional metabolic burden on the engineered bacteria, but also can further increase the production of β-alanine in the engineered bacteria. Using the pMUT1 plasmid as a template, the plasmid was subjected to inverse PCR using the primers pMUT1-ZT-F and pMUT1-ZT-R in Table 8 to obtain the pMUT1 vector fragment, and the pGLO-P J23100 -panD-aspB plasmid was used as a template, and PCR was performed on the plasmid using primers panD-PD-F and panD-PD-R in Table 8 to obtain P J23100 -panD-aspB fragment, the vector and fragment were connected by one-step cloning kit and transformed into DH5α to obtain the recombinant plasmid pMUT1-P J23100 -panD-aspB.

[0181] (4) Plasmid pUC-P J23119 - Construction of crptsG (3'repeat 21 bp):

[0182] Considering that the repeat regions at both ends of crRNA have the same base sequence, when the spacer region of crRNA is randomly mutated using primers, the repeat region is prone to self-recombination, resulting in the loss of the spacer region. Therefore, the repeat region at the 3' end of crRNA is truncated to 21bp to reduce the loss rate of the spacer region. J23119 -crRNAX plasmid (same as Example 4 in patent application CN117210436A) was used as a template, and the plasmid was subjected to reverse PCR using primers repeat-back-F-21 and repeat-back-R-21 in Table 8 to obtain a linear product, which was transformed into DH5α to obtain plasmid pUC-P J23119 -crP70 (3'repeat 21bp). J23119 -crP70 (3'repeat 21bp) plasmid was used as a template, and the plasmid was subjected to reverse PCR using primers ptsG-spacer-F and ptsG-spacer-R in Table 8 to obtain a linear product, which was then transformed into DH5α to obtain plasmid pUC-P J23119 -crptsG (3'repeat 21 bp), the nucleotide sequence of crptsG is shown in SEQ ID NO.14, 1-8 bp represents repeat 1, 9-40 bp represents spacer, and 41-61 bp represents repeat 2.

[0183] (5) Construction of optimized negative strains without inhibitory function

[0184] Plasmid pMUT1-P J23100 -panD-aspB was transformed into the engineering bacterium EcN-19 electroporation competent cell to obtain the strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -Cascade / pMUT1-P J23100 -panD-aspB, denoted as engineered bacteria EcN-20.

[0185] (6) Construction of an optimized positive strain expressing highly efficient targeted ptsG:

[0186] Plasmid pUC-P J23119-crptsG was transformed into the engineering bacteria EcN-20 electroporation competent cells to obtain the strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -cascade / pM UT1-P J23100 -panD-aspB / pUC-P J23119 -crptsG, denoted as engineered bacteria EcN-21.

[0187] (7) Construction of optimized random library

[0188] pUC-P J23119 -crptsG (3'repeat 21bp) plasmid was used as a template, and the primers crispri-sx-F and crispri-sx-R in Table 7 were used to perform reverse PCR on the plasmid, and the 32bp spacer sequence in crRNA was randomly mutated to N, and then the linear product was transformed into DH5α, coated on an LB plate containing 0.05mg / mL kanamycin resistance, and cultured at 37°C for 12h. All the monoclonal transformants obtained were inoculated into a 5ml LB test tube containing 0.05mg / ml ampicillin resistance, cultured at 37°C for 12h, and the plasmid was extracted. After sequencing and comparison with the template plasmid, random mutations did occur. After that, the randomly mutated plasmid was transformed into the engineering bacteria EcN-20 electrotransformation competent state, coated on a double-resistant LB plate containing 0.1mg / ml ampicillin and 0.05mg / ml kanamycin, and cultured at 37°C for 12h to obtain the corresponding monoclonal transformants on the double-resistant plate.

[0189] Cultivation of test strains: Culture the monoclonal transformants in LB tubes at 37°C overnight.

[0190] (8) Determination of β-alanine production in random mutant strains

[0191] After the culture, 1 mL of the bacterial solution was taken to determine the OD of each group of bacteria. 600 The β-alanine dual fluorescence detection method (Mingyue Fei, et al. Acta Biochim Biophys Sin, 2020, 52(00), 1–7) was used to detect the expression of each single clone transformant (library capacity was 4 32 ) were screened, with engineered bacteria EcN-20 as a negative control and engineered bacteria EcN-21 as a positive control. After the initial screening, hundreds of strains were obtained, which showed significant differences in β-alanine production or bacterial OD. 600The values ​​showed significant differences compared with the negative control or the positive control.

[0192] Further screening of these hundreds of transformed strains revealed strains with significant differences compared to the negative control group. Fig.11 As shown. Subsequently, the target strain obtained by screening was subjected to Sanger sequencing using the detection primer spacer-F to obtain the gene sequence of its spacer region. In the SnapGene software, we searched and compared these sequences with reference to the gene map of E. coli Nissle 1917 to determine the targeted gene.

[0193] Among them, screening and comparison found that the aspartate tRNA ligase gene aspS had a greater impact on the production of β-alanine.

[0194] Table 8: Primer sequences

[0195]

[0196] Example 11: Verification of the effect of aspartate tRNA ligase AspS on the yield of β-alanine

[0197] (1) Prediction of the effect of aspartate tRNA ligase AspS on β-alanine production

[0198] Aspartate tRNA ligase AspS is responsible for accurately connecting aspartate amino acids to their corresponding tRNAs. Based on this function, it is speculated that the gene aspS may affect the biosynthesis of β-alanine by regulating the activity of the enzyme encoded by the panD gene, thereby increasing its production.

[0199] (2) pGLO-P ara Construction of panD-GFP-aspS plasmid

[0200] Plasmid pGLO-P ara -panD-GFP (Fei M, Acta Biochimica et Biophysica Sinica, 2020, 52(12): 1420-1426) was used as a template and the primers pGLO-ara-ZT-F and pGLO-ara-ZT-R in Table 9 were used to perform reverse PCR on the plasmid to obtain a linear vector. The E. coli Nissle 1917 genome was used as a template and the primers aspS-F and aspS-R in Table 9 were used to perform PCR to obtain an aspS fragment, the nucleotide sequence of which is shown in SEQ ID NO. 15. The vector and the fragment were connected using a one-step cloning kit and transformed into DH5α to obtain the recombinant plasmid pGLO-P ara -panD-GFP-aspS.

[0201] (3) Construction of control group strain

[0202] Plasmid pGLO-P ara -panD-GFP-aspS was transformed into MG1655ΔpanD (Fei M, Acta Biochimica et Biophysica Sinica, 2020, 52(12):1420-1426) electroporation competent cells to obtain strain MG1655ΔpanD / pGLO-P ara -panD-GFP, denoted as the engineered bacteria EcN-22.

[0203] (4) Construction of experimental strains overexpressing aspS

[0204] Plasmid pGLO-P ara -panD-GFP-aspS was transformed into MG1655ΔpanD electroporation competent cells to obtain strain MG1655ΔpanD / pGLO-P ara -panD-GFP-aspS is denoted as the engineered bacteria EcN-23.

[0205] (5) Determination of the activity of the enzyme encoded by the panD gene using the whole-cell catalytic method

[0206] Use a multichannel pipette to add 200 μL of basic salt M9 medium to each well of a 96-well white plate. Select single colonies of engineered bacteria 22 and 23 and inoculate them into the wells, with 24 colonies of each strain inoculated. Incubate the 96-well white plate at 37°C for 12 hours, and use an ELISA reader to measure the OD 600 , when OD 600 When the OD value is about 1.0, it is used as the seed solution. Use a multichannel pipette to add 180 μL of basic salt M9 medium containing 30 mM arabinose inducer and 20 μL of the corresponding seed solution to each well of a new 96-well white plate, induce expression at 37°C for 12 h, and use an enzyme reader to detect OD 600 Then, 100 μL of the fermentation liquid was taken into a new 96-well all-black ELISA plate, and the GFP fluorescence value (excitation wavelength 395 nm, emission wavelength 509 nm) was measured using an ELISA instrument and recorded as F1.

[0207] Take 50 μL of fermentation liquid in a new 96-well white plate, keep the 96-well white plate at -80°C for 30 minutes, immediately place it at 37°C, incubate it for 30 minutes, repeat this step more than 3 times to break the cells. After breaking the cells, add 125 μL of 40g / L L-Asp aqueous solution to each well of the cell breaking liquid, mix well and place it at 37°C for 2 hours as the conversion liquid. Use a multichannel pipette to add 2.5 μL of conversion liquid and 155 μL of fluorescent agent mixture (250 μL of 5.7 mg / mL ethanol solution of mercaptoethanol, 250 μL of 10 mg / mL methanol solution of o-diacetophenone, 15 mL of 0.2 mol / L sodium borate buffer solution (pH = 9.5)) to each well of a new 96-well all-black ELISA plate, and measure the fluorescence value (excitation wavelength 355 nm, emission wavelength 445 nm) with an ELISA reader, which is recorded as F2. The relative enzyme activity of PanD protein is F1 / F2.

[0208] The results are as follows Fig.12 As shown, the results showed that the relative enzyme activity of PanD protein of the experimental strain, namely the engineered bacteria EcN-23, was higher than that of the control strain, namely the engineered bacteria EcN-22, indicating that aspartate tRNA ligase AspS can enhance the activity of PanD protein and thus increase the production of β-alanine.

[0209] Table 9: Primer sequences

[0210] pGLO-ara-ZT-F TTCAGCCTGATACAGATTAAATC pGLO-ara-ZT-R TCTCCTTCTTAAAGTTAAACAAAAATCTTCTCTCATCCGCCA aspS-F TGTTTAACTTTAAGAAGGAGAAATTAGTGGACGATTTGACCG aspS-R GATTTAATCTGTATCAGGCTGAATTACAGAAGAGGCTTAAGTTGA

[0211] Example 12: Overexpression of the aspS gene in the engineered bacteria EcN-12 and verification of β-alanine production

[0212] (1) Recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580-aspS

[0213] Using the genome of Escherichia coli Nissle 1917 (obtained from the National Standard Material Resource Platform) as a template, PCR amplification was performed using the primer fragment saspS-PD-F and the primer fragment aspS-PD-R in Table 10 to obtain the aspS gene amplification product (nucleotide sequence as shown in SEQ ID NO.15), and the PCR product was detected by 1.0% agarose gel electrophoresis and the template was eliminated with DpnI. PCR reaction conditions: pre-denaturation at 95°C for 5min, 95°C for 30s, 55°C for 30s, 72°C for 1min, a total of 30 cycles, and finally extension at 72°C for 10min.

[0214] pGLO-P J23100 -panD K43Y-aspB-NCgl0580 vector was used as a template, and primers pGLO-ZT-F and pGLO-Z TR were used for PCR amplification to obtain pGLO-P J23100 -panD K43Y -aspB-NCgl0580 vector. One-step cloning kit was used to clone pGLO-P J23100 -panD K43Y -aspB-NCgl0580 vector was connected with the purified PCR product fragment of aspS gene to obtain the cloned recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580-aspS.

[0215] (2) Recombinant bacteria: The recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580-aspS and pSU19-P tac -aspA-ppC was introduced into E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB to obtain the strain E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pGLO-P J 23100 -panD K43Y -aspB-NCgl0580-aspS / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-24.

[0216] (3) Determination of biomass and β-alanine yield

[0217] The biomass and β-alanine production of the engineered bacteria EcN-12 and EcN-24 were measured using the method of Example 1. The results are as follows: Fig.13 As shown, the overexpression of the aspS gene from E. coli Nissle 1917 slightly increased the production of β-alanine by 0.25 g compared with the EcN-12 strain. This proves that the gene aspS obtained by the high-throughput screening tool of the type I CRISPRi system can increase the production of β-alanine.

[0218] Table 10: Primer sequences

[0219] aspS-PDF TCATTGGCAGCTTGAAAAAGAGTGGACGATTTGACCGCA aspS-PD R GATCAACGTCTCATTTTCGCTTACAGAAGAGGCTTAAGTTGA pGLO-panD-R TCTTTTCAAGCTGCCAATGA pGLO-panD-F GCGAAAATGAGACGTTGATC

Claims

1. An engineered bacterium for high production of β-alanine, characterized in that: The engineering bacteria is E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA is a chassis bacterium, and one or more of the lacI gene, pckA gene, nadB gene, ldhA gene, and poxB gene in the genome are knocked out, and one or more of the NCgl0580 gene and the aspartate tRNA ligase gene aspS are overexpressed.

2. The engineered bacteria according to claim 1, characterized in that The nucleotide sequence of the aspartate tRNA ligase gene aspS is shown in SEQ ID NO.

15.

3. The engineered bacteria according to claim 1, characterized in that The nucleotide sequence of the NCgl0580 gene is shown in SEQ ID NO.

9.

4. The engineered bacteria according to claim 1, characterized in that The NCgl0580 gene and the aspartate tRNA ligase gene aspS are overexpressed using plasmid pGLO.

5. The engineered bacteria according to claim 1, characterized in that The ppC and aspA promoters are expressed in the J23100 Replaced with promoter P tac , the promoter P tac The nucleotide sequence is shown in SEQ ID NO.

8.

6. The engineered bacteria according to claim 1, characterized in that The engineered bacteria are one of the following: (1) knocking out the lacI gene in the genome of the chassis bacteria to construct the engineered bacteria ECN-7; (2) knocking out the pckA gene in the genome of the engineered bacteria ECN-7, and simultaneously knocking out the promoter P of the ppC-aspA expression in the chassis bacteria J23100 Replace with P tac , constructing the engineered bacterium ECN-8; (3) knocking out the nadB gene in the genome of the engineered bacterium ECN-8 to construct the engineered bacterium ECN-9; (4) the engineered bacterium ECN-9, using the plasmid pGLO and promoter P J23100 Overexpression of NCgl0580 gene, namely, engineered bacterium ECN-10; (5) knocking out ldhA gene in the genome of engineered bacterium ECN-10, namely, engineered bacterium ECN-11; (6) knocking out poxB gene in the genome of engineered bacterium ECN-11, namely, engineered bacterium ECN-12; (7) engineered bacterium ECN-12, using P J23100 Promoter and pGLO plasmid overexpressed aspartate tRNA ligase gene aspS to construct the engineered bacterium ECN-24.

7. A method for screening and constructing the engineering bacteria with high β-alanine production according to claim 1 based on type I CRISPRi system, characterized in that: The method comprises: (1) The type I CRISPRi system includes Cascade protein and crRNA; the Cascade protein is expressed by a stringent promoter P J23100 -araC-P ara Induce expression; the crRNA is composed of P J23100 Promoter expression; the crRNA structure is repeat1-spacer-repeat2, the length of repeat1 is 8bp; the length of repeat2 is 21bp; the spacer is a random mutation base N, with a length of 32bp; (2) knocking out the endogenous plasmid pMUT1 of the engineered bacteria by CRISPR / Cas9 gene editing, transferring to the type I CRISPRi system in step (1), and using the β-alanine dual fluorescence detection method to screen the target gene that affects β-alanine production; (3) Overexpressing the target gene in the engineered bacteria and screening for engineered bacteria that produce high β-alanine yields.

8. The method according to claim 7, characterized in that The nucleotide sequence of repeat1 is: ATAAACCG, and the nucleotide sequence of repeat2 is: GAGTTCCCCGCGCCAGCGGGG.

9. Use of the engineered bacteria with high β-alanine production according to claim 1 in fermentation to produce β-alanine, characterized in that: The application is as follows: the engineered bacteria are inoculated into a fermentation medium, and the fermentation culture is carried out in a shake flask at 37°C and 200-220 rpm for more than 12 hours. After the fermentation is completed, a fermentation liquid containing β-alanine is obtained; the fermentation medium comprises: K2HPO4·3H2O14g / L, KH2PO4 5.2g / L, (NH4)2SO4 2g / L, MgSO4 0.3g / L, and tryptone 1g / L, the solvent is ddH2O, the pH value is 7.0, and the solvent is water.

10. The use according to claim 9, characterized in that The fermentation is carried out in a fermenter, and after fermentation for 10 hours at 37° C., pH 6-8, and a dissolved oxygen value of 20%-50%, a feed medium is added at a rate of 40-60 mL / min to maintain a residual glucose concentration of 2-4 g / L in the fermentation broth until the fermentation is completed, thereby obtaining a fermentation broth containing β-alanine; The fermentation tank culture medium includes: 50 g / L glucose, 28 g / L K2HPO4·3H2O, 10.4 g / L KH2PO4, 4 g / L NH4Cl, 0.6 g / L MgSO4, 2 g / L tryptone, 4 g / L yeast powder, 1 mL 10× metal ions, 1 mL / L organic silica gel defoamer, and the solvent is water; The feed medium consists of 50 g / L glucose, 28 g / L K2HPO4·3H2O, 10.4 g / L KH2PO4, 4 g / L NH4Cl, 0.6 g / L MgSO4, 2 g / L tryptone, 4 g / L yeast powder, 1 mL 10× metal ions, and 1 mL / L organic silica gel defoamer, and the solvent is water.

Images