Recombinant escherichia coli NT1003-delta ldhA-YPK-cadA and application thereof in coproduction of pentamethylene diamine and succinate

Abstract

The invention relates to recombinant escherichia coli NT1003-delta ldhA-YPK-cadA and an application thereof in co-production of pentamethylene diamine and succinic acid. After lactic dehydrogenase is knocked out, recombinant escherichia coli NT1003-ldhA-YPK with high yield of succinic acid is constructed by introducing lactic dehydrogenase into a dynamic regulation and control system, then recombinant escherichia coli NT1003-ldhA-YPK with high yield of succinic acid is introduced into a temperature-sensitive system, a recombinant strain NT1003-delta ldhA-YPK-cadA is constructed, and co-production of pentamethylene diamine and succinic acid is realized. By investigating the influence of different reducing carbon sources and proportions, different reducing agents and concentrations and ORP parameters in the fermentation process on two-stage fermentation products and intracellular cofactors, an extracellular redox potential indication intracellular cofactor regulation and control strategy is established; by combining the regulation and control of a temperature-sensitive system, the yield of pentamethylene diamine and the yield of succinic acid are 58.23 g / L and 48.58 g / L respectively. Experiments prove that bacterial strains which are not introduced into a temperature-sensitive system accumulate 4.55 g / L of lysine and 4.51 g / L of succinic acid under the same condition respectively. The process is simple in regulation and control, mild in condition, few in by-products and free of pollution, is a rapid and efficient pentamethylene diamine succinic acid production mode, and has certain industrial potential.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA and application thereof in the co-production of pentamethylenediamine and succinate. Background Art

[0002] PA5.4 is a nylon with excellent performance. The synthesis of polymer monomers using petroleum-based materials as raw materials has caused serious environmental pollution and waste of resources. The biological production of cadaverine and succinic acid has the advantages of low pollution and environmental friendliness. The current biosynthesis of PA5.4 monomers succinic acid and pentamethylenediamine has problems such as large acid and alkali dosage and large amount of waste salt, which hinders its industrialization process. In the two-stage fermentation system of aerobic cell culture and anaerobic co-production of succinic acid and pentamethylenediamine, the anaerobic fermentation products can neutralize each other, reduce acid and alkali addition and waste salt generation, and the synergistic and efficient production of succinic acid and pentamethylenediamine is the key. ATP and NAD(P)H participate in multi-step biochemical reactions, and their levels are one of the important influencing factors of reducing products such as pentamethylenediamine and succinic acid.

[0003] When glucose is used as carbon source, 1 mol of glucose in NAD + 2 mol of PEP and 2 mol of NAD(H) are generated by oxidation. When L-lysine is produced by aerobic fermentation, 4 mol of NAD(P)H are theoretically consumed for every 1 mol of L-lysine produced. When succinic acid is synthesized by anaerobic fermentation, 2 mol of NADH are required for every 1 mol of succinic acid produced. As a reducing product, the redox environment and intracellular NAD(P)H level directly affect the synthesis of pentamethylenediaminesuccinate. The oxidation-reduction potential (ORP) can be used to reflect the control parameters of oxidation or reduction properties. As a control parameter, it can reflect the redox environment of aerobic and anaerobic fermentation stages. At the same time, it can affect intracellular NAD(P)H by regulating the ORP parameters, thereby affecting the ATP level and metabolic flux distribution. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention provides a recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA and its application in the co-production of pentamethylenediamine and succinate, with the purpose of solving the problem that the cofactor level limits the coordinated production of two products during the two-stage synthesis of pentamethylenediamine and succinate. The core content is to metabolically transform the production strain to redirect the utilization of cofactors, optimize the types of reducing carbon sources in the fermentation process, control the ORP of the fermentation broth with a reducing agent, and establish a global cofactor regulation strategy to achieve a fermentation process for the simultaneous coordinated production of pentamethylenediamine and succinic acid. The present invention uses ORP to regulate the intracellular ATP and NADH levels and thus affect the regulation strategy of the two-stage fermentation process, significantly increasing the co-production output of pentamethylenediamine and succinic acid. Based on the above problems, metabolic engineering is used to eliminate the anaerobic byproduct lactic acid to reduce NADH loss, optimize the reducing carbon source to provide more reducing power, and regulate the ORP control parameters during the process to establish a global cofactor regulation strategy to achieve the simultaneous coordinated production of pentamethylenediamine and succinic acid.

[0005] In order to solve the problems of the prior art, the technical solution adopted by the present invention is: Recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA, knocking out the lactate dehydrogenase gene (ldhA) by CRISPR-Cas9 technology, and eliminating lactic acid, a byproduct of anaerobic fermentation of Escherichia coli NT1003, specifically includes the following steps: The first step is to prepare chemical transformation competent E. coli NT1003, introduce pCas9 plasmid, and culture in an incubator at 37°C; In the second step, a single colony was picked and inoculated into LB medium, cultured at 37°C 200rpm for 18h, and then transferred to fresh LB medium and cultured until OD 600 = 0.2, arabinose was added to a final concentration of 30 mM, and Cas9 protein expression was induced to OD 600 = 0.5, to prepare the electroporation competent strain, i.e., the NT1003 strain containing the Cas9 protein; In the third step, the N20 sequence with the highest efficiency in knocking out the lactate dehydrogenase gene ldhA was used to construct ldhA-sgRNA, and the 654bp upstream of the ldhA start codon and the 610bp downstream of the stop codon were combined to construct ldhA-Donor DNA; In the fourth step, ldhA-sgRNA and ldhA-Donor DNA were transformed into the NT1003 strain containing Cas9 protein by electroporation, cultured at 37°C for 48 hours, and the gene knockout was determined by colony PCR and sequencing to obtain the recombinant E. coli NT1003-ΔldhA with successful gene knockout; In the fifth step, using the ATP dynamic regulation system, through chemical transformation, first introduce the recombinant Escherichia coli NT1003-ΔldhA in the fourth step to obtain recombinant Escherichia coli NT1003-ΔldhA-YPK, and then introduce the temperature-sensitive regulation system to obtain NT1003-ΔldhA-YPK-cadA.

[0006] The application of the above-mentioned recombinant Escherichia coli strain NT1003-ΔldhA-YPK-cadA in the co-production of pentamethylenediamine and succinic acid.

[0007] As an improvement, the application of the co-production is a two-stage fermentation, including an aerobic fermentation stage and an anaerobic fermentation stage, wherein the reducing agent and the reducing carbon source added in the two-stage fermentation jointly regulate the intracellular cofactor content, and the specific steps are as follows: Step 1, seed activation The recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA was selected and inoculated into a 50 mL shaking tube containing 10 mL of seed culture medium, and 0.025 g / L kanamycin and 0.034 g / L chloramphenicol were added to the culture medium, respectively, at 33°C and 220 r / min, until OD600 = 1.5, to obtain the first-level seed solution; Step 2, secondary seed cultivation The first-level seed solution was inoculated with 4% of the inoculum into a 2 L shake flask containing 250 mL of the second-level seed medium. The culture conditions were: 33 °C, 200 r / min, and cultured until OD600 = 2 to obtain the second-level seed solution. Step 3, fermentation in fermenter: The secondary seed liquid, sterilized glucose, membrane-filtered trace elements and antibiotics were introduced into a 5 L fermentation tank by flame inoculation. The pH of the tank was controlled at 6.8, the temperature was 33 °C, and the dissolved oxygen was maintained at 20%. After 50 g / L of glucose was consumed as the initial sugar, glucose was fed to control the glucose concentration in the tank at 1-10 g / L. After bacteria and lysine accumulated in the tank, the ventilation was turned off, the temperature was raised to 39 °C, and the rotation speed was adjusted to 200 rpm for anaerobic fermentation.

[0008] As an improvement, the reducing carbon source is glycerol, sorbitol, glycerol or acetic acid.

[0009] A further improvement is that the reducing carbon source is sorbitol, and is mixed with glucose at a ratio of 1:3.

[0010] As an improvement, the reducing agent is L-cysteine, DTT (dithiothreitol), neutral red, ascorbic acid, and methylene blue.

[0011] A further improvement is that the reducing agent is L-cysteine, and the final concentration is 0.5 mM to control the intracellular cofactor level in the anaerobic stage.

[0012] As an improvement, the components of the fermentation medium are as follows: (NH4)2SO4 10 g / L, peptone 5 g / L, yeast powder 2 g / L, KCl 0.5 g / L, MgSO4·7H2O 1.6 g / L, ZnSO4·7H2O 0.086 g / L, CuSO4 0.077 g / L, MnSO4·H2O 0.032 g / L, CaCO3 10 g / L, MoPOSNa 100mM, composite carbon source 20 g / L, FeSO4·7H2O 0.032 g / L, methionine 0.3 g / L, threonine 0.3 g / L, V b1 0.06 g / L, nicotinamide 0.01 g / L, biotin 30μg / L.

[0013] As an improvement, during the fermentation, L-cysteine ​​is added, the ORP in the fermenter is regulated every 2 hours, and the level of intracellular cofactors is detected to establish a regulation strategy in which the extracellular redox potential indicates the intracellular cofactors ATP and NADH.

[0014] As an improvement, the fermentation process control conditions are as follows: in the aerobic stage, the dissolved oxygen DO is 20%, the pH is 6.7, and the temperature is 33°C; in the anaerobic stage, the temperature is changed to 39°C, and the ORP is measured every 3 hours and controlled at -300 mV.

[0015] Beneficial effects: Compared with the prior art, the present invention optimizes the intracellular cofactor level and globally regulates the anaerobic stage by controlling ORP, thereby increasing the co-production yield of pentamethylenediamine and succinic acid and achieving a synchronous increase in the yield of the co-production products, and has the following advantages: 1. The present invention firstly constructs the co-production Escherichia coli NT1003-∆ldhA-YPK, which increases the yield of succinic acid and reduces the impact of byproduct lactic acid on the co-production yield; 2. Optimize the reducing carbon source and reducing agent in the co-production fermentation process, and use the selected L-cysteine ​​to regulate the redox potential (ORP) in the fermentation process, and establish a global cofactor regulation strategy to achieve the co-production of pentamethylenediamine and succinic acid; 3. When the present invention is used in fermentation, 4.51 g / L succinic acid is accumulated when the ORP of the anaerobic fermentation stage is controlled to -300 mV using 3:1 glucose and sorbitol as carbon sources in a shake flask, and a final concentration of 0.5 mM L-cysteine ​​is used as a reducing agent, which is 32.3% higher than the control. Pentamethylenediamine succinate is co-produced in a 5L fermenter, with a yield of up to 58.23 g / L of pentamethylenediamine and a yield of up to 48.58 g / L of succinic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the production diagram of pentamethylenediamine succinate co-produced in a 5 L fermenter; Figure 2 Effects of adding different reducing carbon sources on (A) strain growth, (B) NADH, (C) ATP, (D) lysine and succinate; Figure 3 Effects of different glucose and sorbitol ratios on (A) growth, (B) NADH, (C) ATP, (D) lysine and succinate; Figure 4 Effects of adding different reducing agents on (A) growth, (B) NADH, (C) ATP, (D) lysine and succinate of the strains; Figure 5 Effects of adding different concentrations of L-cysteine ​​on (A) ATP, (B) NADH, (C) lysine and succinate in the strains; Figure 6 To control the effects of different ORP on strain (A) growth, (B) NADH, (C) ATP, (D) lysine and succinate; Figure 7 is the cofactor concentration in a 5 L fermenter. DETAILED DESCRIPTION

[0017] The present invention is further illustrated below through the description of specific implementation modes, but this is not a limitation of the present invention. Those skilled in the art can make various modifications or improvements based on the basic idea of ​​the present invention, but as long as they do not deviate from the basic idea of ​​the present invention, they are all within the scope of the present invention.

[0018] In this experiment, Escherichia coli DH5α, plasmid pCas9, and sgRNA are all commercial items that can be purchased regularly. Chemical transformation, electroporation transformation, and plasmid construction are all routine molecular operations. The relevant primer synthesis and gene sequencing were undertaken by General Biotechnology (Anhui) Co., Ltd. Example 1 Construction of recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA

[0019] (1) Preparation of E. coli NT1003 competent NT1003-Cas9 containing Cas9 protein First, prepare the competent E. coli NT1003, add 1 μg of plasmid pCas9 to 50 μL of E. coli NT1003, ice bath for 30 minutes, incubate at 42 °C for 45 seconds, add 1 mL of LB medium containing 0.55 g / L sodium pyruvate, resuscitate at 37 °C for 1 hour, spread on LB plates containing 0.55 g / L sodium pyruvate and 2‰ kanamycin, and culture at 37 °C for 36 hours.

[0020] Pick a single colony and inoculate it into 5 mL~10 mL of LB liquid medium containing 0.55 g / L sodium pyruvate and 2‰ kanamycin, and culture it at 37 °C, 200 rpm for 18 h; the cultured bacterial liquid was inoculated into 50 mL of LB liquid medium containing 0.55 g / L sodium pyruvate and 2‰ kanamycin at a 1% inoculum, and cultured at 37 °C, 200 rpm until OD 600 = 0.2, add L-arabinose with a final concentration of 30 mM to induce and continue to culture until OD 600 About 0.5. The culture medium was transferred to a 50 mL centrifuge tube, ice bathed for 25-30 min, centrifuged at 4000-5000 rpm for 10 min at 4 °C, discarded the supernatant, and the cells were collected; the cells were pipetted and mixed with 40-50 mL pre-cooled sterile water, centrifuged at 4000-5000 rpm for 10 min at 4 °C (repeated twice), the supernatant was discarded, and the cells were collected; the cells were pipetted and mixed with 20-30 mL pre-cooled 10% (V / V) glycerol, centrifuged at 4000 rpm for 10 min at 4 °C, discarded the supernatant, and the cells were pipetted and mixed with pre-cooled 10% (V / V) glycerol of the initial bacterial liquid volume, and 100 μL per tube was dispensed into pre-cooled 1.5 mL centrifuge tubes and stored at -80 °C. The successfully constructed competent E. coli NT1003 containing Cas9 protein was recorded as NT1003-Cas9.

[0021] (2) Design and synthesis of sgRNA-ldhA The PAM region of the Escherichia coli ldhA gene was selected using the chop chop website. The N20 target site was located at 519-538 bp. The nucleotide sequence of the N20 target site is shown in SEQ ID NO.1.

[0022] SEQ ID NO.1 Cgatccgtatccaagtgcag Two primer sequences, sgRNA-ldhA-F (SEQ ID NO.2) and sgRNA-ldhA-R (SEQ ID NO.3), were designed using snap gene software and sent to General Motors for synthesis. PCR amplification was performed using the sgRNA plasmid as a template and primers sgRNA-ldhA-F and sgRNA-ldhA-R.

[0023] SEQ ID NO.2 Cgatccgtatccaagtgcaggttttagagctagaaatagcaagttaaaataaggctagtc SEQ ID NO.3 Ctgcacttggatacggatcgactagtattatacctaggactgagctagctg The PCR system was: primer sgRNA-ldhA-F (10 μM) 2 μL, sgRNA-ldhA-R (10 μM) 2 μL, sgRNA plasmid (100 ng / μL) 2 μL, 2× Phanta Max Master Mix 25 μL, and ddH2O 19 μL.

[0024] The reaction conditions were: 95°C for 3 min, 95°C for 15 s, 55°C for 15 s, 72°C for 1 min 30 s, for a total of 30 cycles; 72°C for 5 min. The PCR products were electrophoresed using 1% (1 g / 100 mL) agarose gel, and the corresponding fragments were recovered by agarose gel electrophoresis using a Tiangen Gel Recovery Kit; the recovered products were digested with Dpn I endonuclease at 37°C for 45 min. The digestion reaction system was: Dpn I enzyme 1 μL, 10× Buffer 1 μL, gel recovery product 8 μL. The product was transformed into E. coli DH5α, PCR screened positive strains DH5α-sgRNA-ldhA and DNA sequencing was performed to verify that the plasmid was constructed correctly.

[0025] (3) Construction of ldhA Donor DNA fragment The 654bp upstream of the start codon of ldhA (SEQ ID NO.4) was selected as the upper homology arm (SEQ ID NO.5), and the 610bp downstream of the stop codon was selected as the lower homology arm (SEQ ID NO.6). Primers KA-△ldhA-F1 (SEQ ID NO.7), KA-△ldhA-R1 (SEQ ID NO.8), KA-△ldhA-F2 (SEQ ID NO.9), KA-△ldhA-R2 (SEQ ID NO.10) and knockout verification primers KA-△ldhA-F (SEQ ID NO.11) and KA-△ldhA-R (SEQ ID NO.12) were designed and sent to General Motors for synthesis. Using the Escherichia coli NT1003 series genome as a template, primers KA-△ldhA-F1 and KA-△ldhA-R1, KA-△ldhA-F2 and KA-△ldhA-R2 were used to PCR amplify the upper and lower homology arms M1 and M2, respectively.

[0026] The nucleotide sequence of the ldhA gene is shown in SEQ ID NO.4 SEQ ID NO.4 atgaaactcgccgtttatagcacaaaacagtacgacaagaagtacctgcaacaggtgaacgagtcctttggctttgagctggaattttttgactttctgctgacggaaaaaaccgctaaaactgccaatggctgcgaagcggtatgtattttcgtaaacgatgacggcagccgcccggtgctggaagagctgaaaaagcacggcgttaaatatatcgccctgcgctgtgccggtttcaataacgtcgaccttgacgcggcaaaagaactggggctgaaagtagtccgtgttccagcctatgatccagaggccgttgctgaacacgccatcggtatgatgatgacgctgaaccgccgtattcaccgcgcgtatcagcgtacccgtgatgctaacttctctctggaaggtctgaccggctttactatgtatggcaaaacggcaggcgttatcggtaccggtaaaatcggtgtggcgatgctgcgcattctgaaaggttttggtatgcgtctgctggcgttcgatccgtatccaagtgcagcggcgctggaactcggtgtggagtatgtcgatctgccaaccctgttctctgaatcagacgttatctctctgcactgcccgctgacaccggaaaactatcatctgttgaacgaagccgccttcgaacagatgaaaaatggcgtgatgatcgtcaataccagtcgcggtgcattgattgattctcaggcagcaattgaagcgctgaaaaatcagaaaattggttcgttgggtatggacgtgtatgagaacgaacgcgatctattctttgaagataaatccaacgacgtgatccaggatgacgtattccgtcgcctgtctgcctgccacaacgtgctgtttaccgggcaccaggcattcctgacagcagaagctctgaccagtatttctcagactacgctgcaaaacttaagcaatctggaaaaaggcgaaacctgcccgaacgaactggtttaa The upper homologous arm nucleotide sequence is as shown in SEQ ID NO.5 SEQ ID NO.5 ggttaatgcgagagagagttttccctgccattcctgccagggagaaaaaatcagtttatcgatattgatccaggtgttaggcagcatggcctgccactgcgcgagtgtttttggagcggctggcgattgctccgtctgcggcaatttcgccagacaagcagaatcaagttctaccgtgccgacgttcaataaccagcggctgggatgtgaaaggctggcgttggtgatatgcgcaagctgacaatctcccaccagataacggagatcgggaatgattaaacctttacgcgtaatgcgtgggctttcatctaatgcaatacgtgtcccgagcggtagccagatgcccgccagcgtgggaacccacagcccgagcgtcatcagcagcgtcaacggcacaagaataatcagtaataacagcgcgagaacggctttatatttacccagcatgggtagttaatatcctgatttagcgaaaaattaagcattcaatacgggtattgtggcatgtttaaccgttcagttgaaggttgcgcctacactaagcatagttgttgatgaatttttcaatatcgccatagctttcaattaaatttgaaattttgtaaaatatttttagtagcttaaatgtgattcaacatcactggagaaagtctt The lower homologous arm nucleotide sequence is as shown in SEQ ID NO.6 SEQ ID NO.6 tcttgccgctcccctgcattccaggggagctgattcagataatccccaatgacctttcatcctctattcttaaaatagtcctgagtcagaaactgtaattgagaaccacaatgaagaaagtagccgcgtttgttgcgctaagcctgctgatggcgggatgtgtaagtaatgacaaaattgctgttacgccagaacagctacagcatcatcgctttgtgctggaaagcgtaaacggtaagcccgtgaccagcgataaaaatccgccagaaatcagctttggtgaaaaaatgatgatttccggcagcatgtgtaaccgctttagcggtgaaggcaaactgtctaatggtgaactgacagccaaagggctggcaatgacccgtatgatgtgcgctaacccgcagcttaatgaactcgataacaccattagcgaaatgctgaaagaaggtgcacaagtggatctgaccgcgaaccagttaacgctggcgaccgcaaaacagacattaacttataagctggcggatttaatgaattaatagctgccacagctcccggcggcaagtgactgttcgctacagcgtttgccgttgggtaatgcacacatcccaatcgc SEQ ID NO.7 Ggttaatgcgagagagagttttccc SEQ ID NO.8 Gcaagattaaaccagaagactttctccagtgatgttgaatcaca SEQ ID NO.9 actggagaaagtcttctggtttaatcttgccgctccc SEQ ID NO.10 gcgattgggatgtgtgcattacc SEQ ID NO.11 gccctgataacgcagttgctg SEQ ID NO.12 gaagcaaattgtgcaatgatcggc The PCR system was the same as the sgRNA-ldhA construction process.

[0027] The reaction conditions were: 95°C for 3 min, 95°C for 15 s, 55°C for 15 s, 72°C for 45 s, for a total of 30 cycles; 72°C for 5 min. The PCR products were electrophoresed using 1% (1 g / 100 mL) agarose gel, and the corresponding fragments were recovered using a Tiangen Gel Recovery Kit.

[0028] Using M1 and M2 as templates, primers KA-△ldhA-F1 and KA-△ldhA-R2 were used to synthesize ldhADonor DNA by overlap extension PCR.

[0029] The PCR system was primers KA-△ldhA-F1 (10μM) 2μL, KA-△ldhA-R2 (10μM) 2μL, M1 3μL, M2 3μL, 2×Phanta Max Master Mix 25μL, and ddH2O 15μL.

[0030] The reaction conditions were: 95°C for 3 min, 95°C for 15 s, 55°C for 15 s, 72°C for 1 min 30 s, for a total of 30 cycles; 72°C for 5 min. The PCR product was electrophoresed using 1% (1 g / 100 mL) agarose gel, and the ldhA Donor DNA was recovered by agarose gel electrophoresis using a Tiangen Gel Recovery Kit.

[0031] (4) ldhA gene knockout and verification ①Take a tube of prepared NT1003-Cas9 competent cells and place it on ice to thaw for 5 minutes; ② Take 10 μL of plasmid and add it to the thawed competent cells, mix gently, and place on ice for 1 min (ldhADonor DNA:sgRNA-ldhA=5:1, sgRNA≈100 ng / μL); ③ Add the above samples to a pre-cooled 2mm electrophoresis cup and place on ice for 5 minutes; ④ Set the voltage of the electroporator to 2.5 kV, shock for 5-6 ms, quickly add 1 mL of LB medium, and recover at 37 °C and 200 rpm for 2 h. Then, spread on a solid LB plate containing 0.55 g / L sodium pyruvate, 50 mg / mL kanamycin, and 40 mg / mL streptomycin, and culture at 37 °C for 48 h.

[0032] Several single colonies were picked from the cultured plates for PCR verification. The PCR system was as follows: primers KA-△ldhA-F (10μM) 2μL, KA-△ldhA-R (10μM) 2μL, 2 x Rapid Tag Masler Mix 25μL, ddH2O 21μL.

[0033] The PCR reaction conditions were: 95°C for 3min, 95°C for 15s, 55°C for 15s, 72°C for 45s, for a total of 30 cycles; 72°C for 5min. The PCR products were electrophoresed using 1% (1 g / 100mL) agarose gel. The PCR product band size was the same as the ldhA-Donor DNA size. The PCR product was sent for sequencing, and the base sequence was consistent with the ldhA-Donor DNA, indicating that the knockout was successful. The constructed strain was named NT1003-ΔldhA.

[0034] (5) Expression of pCWJ-ppc-ydaO-pck and pET28a-RL4-cadA plasmids Escherichia coli NT1003-ΔldhA was prepared as a competent cell for transformation, and plasmid pCWJ-ppc-ydaO-pck of the ATP dynamic regulation system and plasmid pT28a-RL4-cadA of the temperature sensitive system were introduced, wherein the construction of plasmid pCWJ-ppc-ydaO-pck was based on CN118272413A, and that of plasmid pET28a-RL4-cadA was based on CN115927495A, thereby constructing a recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA that can produce high levels of pentamethylenediaminesuccinate dynamically regulated by the intracellular ATP level. Example 2 Screening of reducing carbon source components and optimizing the ratio with glucose

[0035] The fermentation process can refer to CN118272413A, which includes an aerobic and anaerobic two-stage fermentation process. To address the problem of low yield of pentamethylenediamine synthesis, different reducing carbon sources were screened to improve the accumulation of cofactors ATP and NAD(P)H.

[0036] Specifically, in the aerobic fermentation stage, the recombinant Escherichia coli NT1003-ΔldhA-YPK was inoculated into the seed culture medium, the culture temperature was 33°C, the rotation speed was 220 rpm, and the culture was carried out for 12 hours to obtain the seed solution; the seed solution was inoculated into the fermentation medium at an inoculum amount of 4% v / v, the fermentation temperature was 33°C, the rotation speed was 220 rpm, and the fermentation was carried out until the glucose in the fermentation medium was exhausted; In the anaerobic fermentation stage, the fermentation liquid obtained after the aerobic fermentation is subjected to anaerobic fermentation, and a composite carbon source is added to a final concentration of 10 g / L, the fermentation temperature is 39° C., the rotation speed is 220 rpm, and the fermentation is performed until the glucose is exhausted.

[0037] The components of the seed culture medium are as follows: (NH4)2SO4 10g / L, sodium glutamate 5g / L, peptone 5g / L, yeast powder 10g / L, K2HPO4 0.5 g / L, sodium pyruvate 0.55g / L, sucrose 5g / L, MgSO4·7H2O 1g / L, FeSO4·7H2O0.032g / L, MnSO4·H2O 0.077g / L, methionine 0.3g / L, threonine 0.3g / L; The components of the fermentation medium are as follows: (NH4)2SO4 10g / L, peptone 5g / L, yeast powder 2g / L, KCl 0.5g / L, MgSO4·7H2O 1.6g / L, ZnSO4·7H2O 0.086g / L, CuSO4 0.077g / L, MnSO4·H2O 0.032g / L, CaCO310g / L, MoPOSNa 100mM, composite carbon source 20g / L, FeSO4·7H2O 0.032g / L, methionine 0.3 g / L, threonine 0.3 g / L, V b1 0.06 g / L, nicotinamide 0.01 g / L, biotin 30 μg / L.

[0038] The compound carbon source is a mixture of reducing carbon source and glucose in equal proportions, including acetic acid, glycerol, glycerol and sorbitol. Before the seeds are transferred to the shake flask, the reducing carbon source and glucose are added to the culture medium in a 1:1 ratio. The same applies to adding carbon source in the subsequent anaerobic stage.

[0039] Figure 2 (A) shows that, except for acetic acid, other reducing carbon sources slightly promote bacterial growth.

[0040] Figure 2 (B) shows that the addition of reducing carbon sources is helpful to the increase of intracellular NADH in the strains. Among them, the concentration of NADH in the strain with the addition of sorbitol increased the most, from 0.32 μM to 0.80 μM at 24 h, an increase of nearly 150% compared with the control group.

[0041] Figure 2 (C) shows that the addition of acetic acid can increase the ATP content of the strain in the aerobic stage, and sorbitol can reduce the ATP in the aerobic stage, but the ATP level in the anaerobic stage is maintained at a better level than the control.

[0042] Figure 2(D) shows that the addition of reducing carbon sources has different degrees of influence on the accumulation of lysine in the aerobic stage and succinic acid in the anaerobic stage of co-production fermentation. Among them, the addition of sorbitol promotes the accumulation of lysine, and the accumulation of lysine increases from 4.2 g / L to 5.9 g / L. The highest succinic acid yield with the addition of sorbitol is 4.21 g / L. The results show that glucose combined with sorbitol as a carbon source significantly improves the intracellular NADH cofactor level and increases the yield of lysine and succinic acid.

[0043] Based on the combination of glucose and sorbitol, the optimal mass ratio of glucose to sorbitol was investigated, and the ratios were 1:0 (control), 3:1, 1:1, 1:3 and 0:1 (sorbitol).

[0044] The above-mentioned method for adding the composite carbon source with optimized ratio: according to the above-mentioned method, the reducing carbon source and glucose are added to the culture medium in different ratios.

[0045] Depend on Figure 3 (A) and Figure 3 (C) It can be seen that with the increase in the addition ratio of the reducing carbon source sorbitol, the biomass and intracellular ATP concentration of the strain showed a downward trend. When sorbitol was used completely as the carbon source, the lowest biomass OD 600 It was 1.7, a decrease of 71% compared with 5.8 in the control group. The intracellular ATP concentration was the lowest, a decrease of nearly 80% compared with the control group.

[0046] Depend on Figure 3 (B) It can be seen that with the increase in the addition ratio of the reducing carbon source sorbitol, the NADH content and succinic acid production of the strain both showed an upward trend. When sorbitol was used exclusively as the carbon source, the highest NADH content was 1.22 μM, which was 312% higher than the 0.28 μM of the control group.

[0047] Depend on Figure 3 (D) It can be seen that the ratio of reducing carbon source addition has different effects on the production of lysine and succinic acid. When the ratio of glucose to sorbitol is 3:1 and 1:1, the production of lysine is higher than that of the control group, and the increase is the largest when the ratio is 3:1. However, further increasing the concentration of sorbitol leads to the inhibition of lysine accumulation; succinic acid increases continuously with the increase of sorbitol concentration. The study found that succinic acid is positively correlated with the content of intracellular NADH, while the effect on lysine synthesis is more complicated.

[0048] Therefore, based on the biomass, intracellular ATP content, and the accumulation of lysine and succinic acid, the present invention determines that the optimal compounding ratio of glucose to sorbitol is 3:1. Example 3 Screening the type of reducing agent and optimizing the added concentration

[0049] The addition of reducing agents can affect the level of intracellular cofactors. L-cysteine, DTT (dithiothreitol), neutral red, ascorbic acid, and methylene blue were selected to study the effects of different reducing agents on intracellular NADH, ATP, lysine, and succinic acid, and then investigate the effects of different reducing agents on the growth and metabolism of the strain.

[0050] The final concentration of the reducing agent was 0.5 mM. The method of adding the reducing agent was as follows: 16 h after the seeds were transferred from the shake tube to the shake flask, the sterilized reducing agent was added to the culture medium, and then the culture was continued until the initial glucose was exhausted.

[0051] The above seed culture medium is the same as that in Example 2, the fermentation medium uses 20 g / L glucose as the carbon source, and the rest is the same as that in Example 2, and the rest of the aerobic and anaerobic two-stage fermentation process is the same as that in Example 2.

[0052] Figure 4 (A) and Figure 4 (B) shows that the addition of different reducing agents has different effects on the biomass of the strains, among which the biomass of the strains with the addition of ascorbic acid has the largest increase. The addition of reducing agents all leads to an increase in intracellular NADH, among which the concentration of NADH in the strain with the addition of L-cysteine ​​increases the most, from 0.47 μM to 0.80 μM, an increase of nearly 70% compared with the control group. This shows that reducing agents can significantly improve the intracellular reducing power.

[0053] Figure 4 (C) shows that the addition of reducing agents has little effect on the intracellular ATP of the strain, among which the addition of L-cysteine ​​slightly increased the ATP concentration at 24 h and 72 h.

[0054] Figure 4 (D) shows that the addition of reducing agents has little effect on the accumulation of lysine in the co-production fermentation, but has a greater effect on the accumulation of succinic acid in the co-production fermentation. Among them, the succinic acid production of the strain with L-cysteine ​​increased the most, from 3.41 g / L to 4.43 g / L compared with the control group, an increase of nearly 29%. This shows that reducing agents can significantly increase intracellular reducing power and thus increase succinic acid production.

[0055] Based on the addition of L-cysteine ​​as a reducing agent, the optimal final concentration of L-cysteine ​​was investigated, and the concentration gradient was as follows: 0 mM, 0.3 mM, 0.5 mM, and 0.7 mM. The culture method was the same as described above.

[0056] Figure 5 (A) shows that increasing the concentration of reducing agent added did not cause significant changes in ATP concentration.

[0057] Figure 5(B) shows that as the concentration of the reducing agent added increases, the concentration of NADH in the strain cell increases accordingly. The NADH concentration is not much different when the added concentration is 0.5 mM and 0.7 mM.

[0058] Figure 5 (C) shows that the accumulation of lysine in all experimental groups is similar, and as the concentration of L-cysteine ​​increases from 0 to 0.5 mM, the concentration of succinic acid gradually increases, and the concentration of succinic acid reaches the maximum at 0.5 mM. The present invention determines that the optimal reducing agent is 0.5 mM L-cysteine. Example 4 Establishing a global regulation strategy for ORP to indicate intracellular cofactors

[0059] Examples 2 and 3 show that the compounding of reducing carbon sources and the addition of reducing agents significantly affect the level of intracellular cofactors. However, the detection process is cumbersome and not suitable for real-time regulation during fermentation. Therefore, the extracellular redox potential (ORP) is used to indicate the global regulation strategy of intracellular cofactors ATP and NADH.

[0060] The ORP of the fermentation broth was controlled to -100 mV, -200 mV, -300 mV, and -400 mV by adding L-cysteine. The ORP detection method is as follows: 2 mL of bacterial broth was centrifuged at 12000 rpm, and the supernatant was detected with an ORP electrode. The electrode model is Mettler LE510.

[0061] The ORP gradient control strategy of the shake flask fermentation broth is as follows: 16 hours after the seeds are transferred from the shake tube to the shake flask, sterilized 0.5 mM reducing agent L-cysteine ​​is added into the shake flask to control the ORP, and the ORP is maintained every 2 hours.

[0062] Figure 6 (A) shows that when the ORP potential is controlled at -100 mV, -200 mV and -300 mV, the effect on the biomass is small. When it is further increased to -400 mV, the biomass of the strain decreases significantly, from 6.6 to 4.9 in 72 h, a decrease of 16%. At this time, it has an adverse effect on the growth and metabolism of the strain.

[0063] Figure 6 (B) shows that as the redox potential decreases from 0 to -300 mV, the NADH concentration of the strain increases, and when it is further increased to -400 mV, the NADH concentration decreases.

[0064] Figure 6(C) shows that as the redox potential decreases, the intracellular ATP concentration shows a downward trend, and the lowest intracellular ATP concentration is 29.6 nmol / (L·OD) when the redox potential is -400 mV. Comparison of the effect of ORP on the production of lysine and succinic acid shows that the increase is the largest at -300 mV, producing 4.55 g / L and 4.51 g / L, respectively, which is 7% and 16.2% higher than the unregulated group. The present invention determines that the optimal redox potential during the fermentation process is -300 mV, at which the intracellular cofactor level is most suitable for the production of lysine and succinic acid. Example 5 High production of pentamethylenediamine succinate in a 5L fermenter

[0065] Combined with Examples 2, 3, and 4, the optimal two-stage co-production process and the temperature-sensitive dynamic control system were determined, and a recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA and fermentation process for high production of pentamethylenediamine and succinic acid in two stages by regulating the intracellular cofactor level were established in a 5L fermenter. In the anaerobic stage, the temperature was first raised to 39 °C, and after 24 hours, the temperature returned to the optimal growth temperature of Escherichia coli at 37 °C after the expression of lysine decarboxylase.

[0066] The optimal two-stage co-production process is as follows: glucose and sorbitol are compounded in a ratio of 3:1 and used as the initial carbon source and feed carbon source; the fermentation process ORP is regulated to -300 mV by adding 0.5 mM L-cysteine.

[0067] The above-mentioned temperature-sensitive dynamic regulation system adopts the content disclosed in CN115927495A, that is, the plasmid pET28a-RL-cadA is introduced into the recombinant Escherichia coli NT1003-ΔldhA-YPK by chemical transformation to construct the recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA.

[0068] The control conditions of the above fermentation process are as follows: in the aerobic stage, the dissolved oxygen DO is 20%, the pH is 6.7, and the temperature is 33 ℃; in the anaerobic stage, the temperature is changed to 39 ℃, and the ORP is measured every 3 hours and controlled at -300 mV.

[0069] Depend on Figure 1 It can be seen that the biomass OD of the strain in the aerobic stage 600 The highest is 48, the OD of the strain biomass in the anaerobic stage 600 The ORP level was adjusted by combining the mixed carbon source to increase the NADH / NAD + The ratio of 2-hydroxy-1-nitropropene was more balanced, so the activity of the strain was higher. In terms of product accumulation, the accumulation of lysine in the aerobic stage increased to 86.10 g / L. In the anaerobic stage, the production of pentamethylenediamine increased to 58.23 g / L, and the production of succinic acid increased to 48.58 g / L.

[0070] Figure 7 The results showed that the content of intracellular cofactor ATP was higher in the aerobic stage, and significantly decreased in the anaerobic stage. The intracellular reducing power NADH was maintained at a relatively high level in both the aerobic and anaerobic stages due to the participation of regulatory strategies, which was beneficial to increasing the production of pentamethylenediamine and succinic acid.

[0071] In summary, the present invention is actually a method for constructing a two-stage fermentation recombinant Escherichia coli without lactic acid byproducts, and optimizes the two-stage fermentation medium and process, and regulates the ORP of the fermentation broth by compounding a reducing carbon source and using a reducing agent to regulate the intracellular cofactor level. Combined with the ATP dynamic control system and the temperature-sensitive control system, the two-stage high-yield of pentamethylenediamine and succinate is achieved. The production process is efficient and economical, and has industrial potential.

[0072] The present invention and its embodiments are described schematically above, and the description is not restrictive. The drawings show only one embodiment of the present invention, and the actual structure is not limited thereto. Therefore, if a person skilled in the art is inspired by it and designs a structural method and an embodiment similar to the technical solution without creativity without departing from the purpose of the invention, they shall all fall within the protection scope of the present invention.

Claims

1. Recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA, characterized in that: The lactate dehydrogenase gene (ldhA) was knocked out by CRISPR-Cas9 technology to eliminate lactic acid, a byproduct of anaerobic fermentation of Escherichia coli NT1003. The following steps are involved: The first step is to prepare chemical transformation competent E. coli NT1003, introduce pCas9 plasmid, and culture in an incubator at 37°C; In the second step, a single colony was picked and inoculated into LB medium, cultured at 37°C 200rpm for 18h, and then transferred to fresh LB medium and cultured until OD 600 = 0.2, arabinose was added to a final concentration of 30 mM, and Cas9 protein expression was induced to OD 600 = 0.5, to prepare the electroporation competent strain, i.e., the NT1003 strain containing the Cas9 protein; In the third step, the N20 sequence with the highest efficiency in knocking out the lactate dehydrogenase gene ldhA was used to construct ldhA-sgRNA, and the 654bp upstream of the ldhA start codon and the 610bp downstream of the stop codon were combined to construct ldhA-Donor DNA; In the fourth step, ldhA-sgRNA and ldhA-Donor DNA were transformed into the NT1003 strain containing Cas9 protein by electroporation, cultured at 37°C for 48 hours, and the gene knockout was determined by colony PCR and sequencing to obtain the recombinant E. coli NT1003-ΔldhA with successful gene knockout; In the fifth step, using the ATP dynamic regulation system, through chemical transformation method, first introduce the recombinant Escherichia coli NT1003-ΔldhA in the fourth step to obtain recombinant Escherichia coli NT1003-ΔldhA-YPK, and then introduce the temperature-sensitive regulation system to obtain recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA.

2. Use of the recombinant Escherichia coli NT1003-ΔldhA-YPK-cadA according to claim 1 in the co-production of pentamethylenediamine and succinic acid.

3. The use according to claim 2, characterized in that: The application of the combined production is a two-stage fermentation, including an aerobic fermentation stage and an anaerobic fermentation stage, wherein the reducing agent and the reducing carbon source added in the two-stage fermentation jointly regulate the intracellular cofactor content, and the specific steps are as follows: Step 1, seed activation The recombinant E. coli NT1003-ΔldhA-YPK-cadA was selected and inoculated into a 50 mL shaking tube containing 10 mL of seed culture medium, and 0.025 g / L kanamycin and 0.034 g / L chloramphenicol were added to the culture medium, respectively, at 33°C and 220 r / min, until OD600 = 1.5, to obtain the first-level seed solution; Step 2, secondary seed cultivation The first-level seed solution was inoculated with 4% of the inoculum into a 2 L shake flask containing 250 mL of the second-level seed culture medium. The culture conditions were: 33 °C, 200 r / min. The culture was cultured until OD600 = 2 to obtain the second-level seed solution. Step 3, fermentation in fermenter: The secondary seed liquid, sterilized glucose, membrane-filtered trace elements and antibiotics were introduced into a 5 L fermentation tank by flame inoculation. The pH of the tank was controlled at 6.8, the temperature was 33 °C, and the dissolved oxygen was maintained at 20%. After 50 g / L of glucose was consumed as the initial sugar, glucose was fed to control the glucose concentration in the tank at 1-10 g / L. After bacteria and lysine accumulated in the tank, the ventilation was turned off, the temperature was raised to 39 °C, and the rotation speed was adjusted to 200 rpm for anaerobic fermentation.

4. The use according to claim 3, characterized in that: The reducing carbon source is glycerol, sorbitol, glycerol or acetic acid.

5. The use according to claim 4, characterized in that: The reducing carbon source is sorbitol, which is mixed with glucose at a ratio of 1:

3.

6. The use according to claim 3, characterized in that: The reducing agent is L-cysteine, DTT (dithiothreitol), neutral red, ascorbic acid, and methylene blue.

7. The use according to claim 6, characterized in that: The reducing agent was L-cysteine, and the final concentration was 0.5 mM.

8. The use according to claim 3, characterized in that: The components of the fermentation medium are as follows: (NH4)2SO4 10 g / L, peptone 5 g / L, yeast powder 2 g / L, KCl 0.5 g / L, MgSO4·7H2O 1.6 g / L, ZnSO4·7H2O 0.086 g / L, CuSO4 0.077 g / L, MnSO4·H2O 0.032 g / L, CaCO3 10 g / L, MoPOSNa 100 mM, composite carbon source 20 g / L, FeSO4·7H2O 0.032 g / L, methionine 0.3 g / L, threonine 0.3 g / L, V b1 0.06 g / L, nicotinamide 0.01 g / L, biotin 30 μg / L.

9. The use according to claim 3, characterized in that: During the fermentation, L-cysteine ​​is added to adjust the ORP in the fermenter every 2 hours, and the level of intracellular cofactors is detected to establish a regulation strategy in which the extracellular redox potential indicates the intracellular cofactors ATP and NADH.

10. The use according to claim 9, characterized in that: The fermentation process control conditions are as follows: in the aerobic stage, the dissolved oxygen DO is 20%, the pH is 6.7, and the temperature is 33°C; in the anaerobic stage, the temperature is changed to 39°C, and the ORP is measured every 3 hours and controlled at -300 mV.

Images