Macrophage with function regulated and controlled in vitro and application of macrophage

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to an in-vitro function regulation macrophage and application thereof.The preparation method of the in-vitro function regulation macrophage comprises the steps that firstly, IFN-gamma recombinant modified bacterial vesicles are prepared, then the IFN-gamma recombinant modified bacterial vesicles-IFN-gamma-E7-BBV are added into the macrophage, and the in-vitro function regulation macrophage is obtained. And co-incubating for 12-36 hours, and inducing the macrophage into the M1 type killer macrophage MAK3. Compared with CAR-M, a complex genetic engineering modification process is not involved in a macrophage in-vitro stimulation process, so that the preparation process is relatively simple, and the cost is possibly lower; meanwhile, risks such as gene insertion mutation and out-of-control gene expression possibly existing in the gene modification process are avoided, and higher safety is achieved. Besides, the macrophages directly activated in vitro can be activated according to specific treatment requirements to cope with different types of tumors or diseases, and the method has higher flexibility and can adapt to wider treatment scenes.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to an in vitro functionally regulated macrophage and an application thereof. Background Art

[0002] Adoptive cell therapy (ACT) is a therapy that uses the patient's own immune system to fight cancer. In recent years, it has made significant progress in the field of tumor treatment. A variety of technical means have been developed in the field of adoptive cell therapy. For example, using genetic engineering technology to express tumor antigen-specific recognition domains on the surface of immune cells, so that immune cells can more accurately identify and attack tumor cells; or using genetic engineering technology to transform immune cells to enhance their activity and function in a certain aspect. At present, adoptive cell therapy has been used in the treatment of many tumors, including melanoma, lymphoma, lung cancer, colon cancer, etc. Compared with traditional treatment methods, adoptive cell therapy can not only directly eliminate tumors, but also mobilize the body's own immune function to inhibit tumor growth; and it has the advantages of no toxic side effects, strong targeting and memory immunity, showing good efficacy and safety. ACT is mainly divided into three categories: tumor infiltrating lymphocytes (TILs) therapy, T cell receptor (TCR) engineered T cell therapy, and chimeric antigen receptor (CARs) T cell genetic engineering therapy. These methods all use the patient's own immune cells through amplification and transformation, so that they can more accurately identify and attack tumor cells. Through genetic engineering technology, the modified immune cells can recognize and attack tumor cells that express specific antigens, thereby achieving effective control of tumors.

[0003] Although adoptive cell therapy has made many advances, there are still some challenges and limitations, such as technical difficulty, cost, and individual differences. After entering the body, some adoptive cells are inhibited by immunosuppressive cells and their cytokines, which makes these cells unable to be effectively activated, expanded, and persist. High-dose chemotherapy is often used in the clinic to eliminate immunosuppressive cells in the body, but it can cause a series of side effects, such as nausea, vomiting, and hair loss, and some patients may not be able to tolerate it and lose the opportunity to continue treatment. In addition, ACT may cause some inflammation-related adverse events. For some patients, especially those who have received other immunotherapy or chemotherapy, the effect of ACT may be limited. At present, CAR-M therapy still needs to optimize CAR structure, improve gene editing technology, or explore new cell sources to further improve the efficacy and safety of ACT. In addition, with the in-depth understanding of the tumor immune microenvironment and the development of genetic engineering technology, although these adoptive cells can be expanded and persist, due to the lack of synergistic effects of immune cytokines in the patient's body, these cells may eventually become dysfunctional, limiting the efficacy and long-term effects of adoptive cell therapy. In the future, it is also necessary to consider combining ACT with other immunotherapy or traditional therapy to achieve better therapeutic effects. At present, clinical trials related to CAR-M therapy are still in the early stages, and many potential problems need to be further processed and verified; CAR-M structure needs further optimization research to make it better match macrophages; limited by technology and research level, genetically engineered macrophages have highly variable characteristics and are uncontrollable in complex in vivo environments, and the data supporting the safety and efficacy of CAR-M in vivo are very limited. At present, there are many studies on the anti-tumor phenotype of CAR-M. In addition, adoptive cell therapy also faces technical challenges and cost issues: the preparation and expansion of high-quality adoptive cells requires complex operating processes and higher technical proficiency, which increases the difficulty and cost of treatment. At the same time, since adoptive cell therapy is still in the early stages of research and development, its long-term safety and effectiveness need to be further verified. CAR-M therapy requires a large number of macrophages, but the number and expansion capacity of such cells in peripheral blood are limited, and excessive activation of macrophages produces serious toxic side effects; more importantly, macrophages are highly resistant to genetic engineering of standard vectors such as lentivirus, retrovirus and adeno-associated virus, gene transfection is difficult, the positive rate is low, and the engineering cycle is long.

[0004] Therefore, how to further simplify the preparation process of adoptive cell therapy, shorten its engineering cycle, reduce the toxic side effects of macrophages, and improve the safety of treatment is a problem that needs to be solved. Summary of the invention

[0005] In order to overcome the problems of the prior art, the present invention proposes an in vitro functionally regulated macrophage and its application. The present invention directly activates macrophages in vitro to obtain killer macrophages MAK3, and develops a novel adoptive cell therapy strategy for tumor immunotherapy.

[0006] The object of the present invention is achieved in that:

[0007] The first aspect of the present invention provides a macrophage with in vitro function regulation, wherein the macrophage is obtained by the following method:

[0008] Step 1, preparation of IFN-γ recombinant modified bacterial vesicles:

[0009] First, the signal peptide of mouse IFN-γ was removed, and then the mature IFN-γ region was connected to the C-terminus of ClyA through Linker, and codon optimization was performed according to the codon preference of Escherichia coli to obtain the ClyA-IFN-γ fusion gene; the tumor-specific antigen was connected to the C-terminus of Trx through Linker, and codon optimization was performed according to the codon preference of Escherichia coli to obtain the Trx-antigen fusion gene; finally, the ClyA-IFN-γ and Trx-antigen fusion genes were constructed into a plasmid to obtain the ClyA-IFN-γ+Trx-antigen fusion plasmid;

[0010] S12, Preparation of IFN-γ-BBV-antigen:

[0011] The ClyA-IFN-γ+Trx-antigen fusion plasmid obtained in S11 is transformed into Escherichia coli, and the expression of the exogenous protein is induced by adding IPTG to the culture medium, the bacterial liquid is collected and resuspended to obtain a bacterial suspension, and the bacterial suspension is treated by high-pressure homogenization. The bacteria are driven by ultra-high pressure and squeezed through the cracks to form a membrane component carrying the recombinant protein. The bacterial suspension obtained after the high-pressure homogenization treatment is subjected to preliminary centrifugation to collect the supernatant and remove the broken bacteria. The supernatant is subjected to ultracentrifugation to collect the precipitate, thereby obtaining IFN-γ-BBV-antigen, that is, IFN-γ recombinant modified bacterial vesicles;

[0012] Step 2, IFN-γ-BBV-antigen stimulation of macrophages in vitro:

[0013] The IFN-γ-BBV-antigen prepared in step 1 is added to the macrophages, and the cells are incubated for 12 to 36 hours to induce the macrophages into M1 type cytotoxic macrophages MAK3.

[0014] Furthermore, in step 1, the codon-optimized ClyA-IFN-γ fusion gene sequence is shown in SEQ ID NO.1.

[0015] Furthermore, in step 1, the tumor-specific antigen includes HPV-specific antigen E7 and breast cancer-specific antigen 4T1. When the tumor-specific antigen is HPV-specific antigen E7, the Trx-antigen fusion gene in step 1 is the Trx-E7 fusion gene, and its sequence is shown in SEQ ID NO.2.

[0016] Furthermore, in step 2, 1×10 macrophages 6 Each well was plated in a 6-well cell culture plate, and IFN-γ-BBV-antigen was added to the macrophages to control its final concentration to 1.5 μg / mL, and incubated for 24 hours.

[0017] The second aspect of the present invention provides a combined drug that can improve the therapeutic effect of tumor vaccines on tumors. The combined drug is the above-mentioned macrophage MAK3 with in vitro function regulation.

[0018] Furthermore, the in vitro functionally regulated macrophage MAK3 is administered by intravenous injection.

[0019] Furthermore, the tumor includes cervical cancer and breast cancer.

[0020] The third aspect of the present invention provides the use of the above-mentioned macrophages with regulated in vitro functions in the preparation of drugs for treating cervical cancer and / or breast cancer.

[0021] The advantages and beneficial effects of the present invention are:

[0022] 1) Currently, there are great challenges in the technical route of genetically engineering macrophages: macrophages are highly resistant to genetic engineering of standard vectors such as lentivirus, retrovirus and adeno-associated virus, gene transfection is difficult, and the engineering cycle is long. In view of the above technical defects, the present invention proposes another idea for tumor immunotherapy, using in vitro functionalized macrophages induced by inducers. Experiments have found that the function of macrophages induced in vitro by IFN-γ-BBV-E7 is adjusted to the M1 type, which can efficiently kill tumor cells and retain strong phagocytic ability, have the ability to intervene in tumor models, and show excellent synergistic effects in combination with tumor vaccines. The present invention provides a preparation method and a joint strategy for the macrophage, providing new ideas and technical means for tumor immunotherapy.

[0023] 2) Adoptive immunotherapy using lymphokine-like activated killer cells provides a method for preparing in vitro activated macrophages that can be used for cancer treatment and its potential for synergistic effects in combination with tumor vaccines. Use bacterial vesicles IFN-γ-E7-BBV modified with IFN-γ and E7 full-length proteins as inducers to activate macrophages in vitro: IFN-γ, as a macrophage activating factor, can directly activate macrophages, enhance their phagocytic and killing abilities, and more effectively eliminate attacking tumor cells; the pathogen-associated molecular patterns (PAMPs) possessed by bacterial vesicles BBV themselves can activate the TLR signaling pathway of immune cells and promote cell activation; the tumor-specific E7 protein added to the stimulator may allow macrophages to more effectively ingest, process and present the E7 antigen, thereby initiating or enhancing the immune response against the antigen. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0025] Figure 1 It is the technical roadmap for the in vitro functionally regulated macrophages and the synergistic effect of the combined tumor vaccine described in the present invention.

[0026] Figure 2 It shows that IFN-γ-E7-BBV stimulated Raw264.7 M0 cells to M1 type in vitro in Example 1; wherein, A)-C) are respectively RT-PCR detection of the mRNA expression levels of iNOS, CD80, and IL-12 after IFN-γ-E7-BBV stimulated mouse Raw264.7 macrophages for 24 hours (n=3). D) WB representative images of iNOS in M1 Raw264.7 after the designated stimuli LPS+IFN-γ, IL-4, BBV, E7-BBV, IFN-γ-BBV, and IFN-γ-E7-BBV were treated for 24 hours. E) Representative images of cell morphology under a microscope of M0 BMDMs after treatment with designated stimuli LPS+IFN-γ, IL-4, E7-BBV, IFN-γ-BBV, and IFN-γ-E7-BBV for 24 hours and 48 hours (20×). Error bars represent standard deviation (SD). ns, not significant, P>0.05; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.

[0027] Figure 3 The figure shows the in vitro killing effect of Raw264.7 cells on tumor cells under different stimulation treatments in Example 2.

[0028] Figure 4The in vivo distribution of macrophages injected intravenously in Example 3 in TC-1 tumor-bearing mice (n=3) is shown; wherein, A)-C) are the localization of DIR-labeled M0 and MAK3 cells in various internal organs in vivo 24h, 48h and 72h after tail vein injection; D) fluorescence localization of M0 and MAK3 cells injected by tail vein at different time points in the tumor; E) fluorescence localization of M0 and MAK3 cells injected by tail vein in the left and right axillary lymph nodes and groin.

[0029] Figure 5 It is shown that the macrophages (MAK3) stimulated by IFN-γ-E7-BBV in Example 4 and the Q11-E7 nanovaccine synergistically significantly inhibited the growth of TC-1 tumors (n=6); wherein, B) tumor growth curve; C) tumor weight; D) tumor anatomical image; E) tumor mass; F) iNOS+M1 flow cytometry in tumor tissue; G) M2 flow cytometry in tumor tissue; H) M1 / M2 ratio in tumor tissue; I) MDSC flow cytometry in tumor tissue; J) CTL flow cytometry in tumor tissue; K) ELISPOT representative images and L) quantitative statistics of CTL stimulated by specific stimulating peptides in tumor tissue; M) CTL flow cytometry in lymph nodes. Error bars represent standard deviation (SD). ns, not significant; P>0.05; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. DETAILED DESCRIPTION

[0030] In the following examples, unless otherwise specified, the raw materials and experimental instruments involved are commercially available.

[0031] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0032] Embodiment 1:

[0033] This embodiment provides a macrophage MAK3 with in vitro functional regulation, wherein the macrophage is obtained by the following method:

[0034] Step 1, construct fusion plasmid:

[0035] After removing the signal peptide (1-22 amino acids) of mouse IFN-γ, the mature IFN-γ region (23-155 amino acids) was connected to the C-terminus of ClyA through Linker (GGGGS), and codon optimization was performed according to the codon preference of Escherichia coli to obtain the ClyA-IFN-γ fusion gene; the mouse HPV-specific antigen E7 was connected to the C-terminus of Trx through Linker (GSGS), and codon optimization was performed according to the codon preference of Escherichia coli to obtain the Trx-E7 fusion gene; finally, the ClyA-IFN-γ and Trx-E7 fusion genes were constructed into the pRSF-Duet-1 plasmid through homologous recombination to obtain the pRSF-Duet-1-ClyA-IFN-γ+Trx-E7 fusion plasmid.

[0036] The codon-optimized ClyA-IFN-γ fusion gene sequence is shown in SEQ ID NO.1. The ClyA-IFN-γ fusion gene was obtained by PCR, specifically:

[0037] ATGACTGAAATCGTTGCAGATAAAACGGTAGAGGTAGTTAAAAACGCAATC

[0038] GAAACCGCAGATGGAGCATTAGACCTTTATAATAAATATCTCGATCAGGTCA

[0039] TCCCCTGGCAGACCTTCGATGAAACCATAAAAGAGTTAAGTCGCTTTAAAC

[0040] AGGAGTATTCACAGGCAGCCTCCGTTTTAGTTGGCGATATTAAAACCTTACT

[0041] TATGGATAGCCAGGATAAGTATTTTGAAGCAACCAAACGGTGTATGAATG

[0042] GTGTGGTGTTGCGACGCAATTGCTCGCAGCGTATATTTTGCTATTTGATGAG

[0043] TACAATGAGAAGAAAGCATCCGCCCAGAAAGACATTCTCATTAAGGTACTG

[0044] GATGACGGCATCACGAAGCTGAATGAAGCGCAAAAATCCCTGCTGGTAAG

[0045] CTCACAAAGTTTCAACAACGCTTCCGGGAAACTGCTGGCGTTAGATAGCCA

[0046] GTTAACCAATGATTTTTCAGAAAAAAGCAGCTATTTCCAGTCACAGGTAGA

[0047] TAAAATCAGGAAGGAAGCGTATGCCGGTGCCGCAGCCGGTGTCGTCGCTG

[0048] GTCCATTTGGATTAATCATTTCCTATTCTATTGCTGCGGGCGTAGTTGAAGGG

[0049] AAACTGATTCCAGAATTGAAGAACAAGTTAAAATCTGTGCAGAGTTTCTTT

[0050] ACCACCCTGTCTAACACGGTTAAACAAGCGAATAAAGATATCGATGCCGCC

[0051] AAATTGAAATTAACCACCGAAATAGCCGCCATCGGGGAGATAAAAACGGA

[0052] AACTGAAACAACCAGATTCTATGTTGATTATGATGATTTAATGCTTTCTTTGC

[0053] TAAAAGAAGCGGCCAAAAAAATGATTAACACCTGTAATGAGTATCAGAAA

[0054] AGACACGGTAAGAAGACACTCTTTGAGGTACCTGAAGTCGGATCCCATGG

[0055] CACCGTGATTGAGAGCCTGGAAAGCCTGAACAACTATTTTAACAGCAGCG

[0056] GCATTGATGTGGAAGAAAAAAGCCTGTTTCTGGATATTTGGCGCAACTGGC

[0057] AGAAAGATGGCGATATGAAAATTCTGCAGAGTCAGATTATTAGCTTTTATCT

[0058] GCGCCTGTTTGAAGTGCTGAAAGATAACCAAGCGATTAGCAACAACATTAG

[0059] CGTGATTGAAAGCCATCTGATTACCACCTTTTTTAGCAACAGCAAAGCGAA

[0060] AAAAGATGCGTTTATGAGCATTGCGAAATTTGAAGTGAACAACCCGCAAGT

[0061] GCAGCGCCAAGCGTTTAACGAACTGATTCGCGTGGTGCATCAGCTGCTGCCGGAAAGCAGCCTGCGCAAACGCAAACGCAGCCGCTGC.

[0062] The Trx-E7 fusion gene was synthesized by Shanghai Sangon Biotechnology Co., Ltd., and its sequence is shown in SEQ ID NO.2, specifically:

[0063] .

[0064] Step 2, preparation of IFN-γ-BBV-E7:

[0065] By co-expressing IFN-γ presented on the bacterial outer membrane by ClyA and localizing E7 to the bacterial periplasmic space by Trx, a multifunctional modified nanovaccine IFN-γ-BBV-E7 was obtained. The specific steps are as follows:

[0066] The pRSF-Duet-1-ClyA-IFN-γ+Trx-E7 fusion plasmid obtained above was transformed into Escherichia coli BL21 (DE3), and IPTG at a concentration of 1 mM was added to the culture medium to induce ClyA-IFN-γ protein expression. Considering the low yield and low load of exogenous protein, after collecting the bacterial solution, HBSS was used to resuspend the bacterial suspension, and the bacterial suspension was treated by high-pressure homogenization. During this process, the bacteria were driven by ultra-high pressure and squeezed through the cracks to form a membrane component carrying the recombinant protein. The specific method of the high-pressure homogenization treatment is: the bacterial suspension is subjected to a pressure of 1200 bar (volume of 200 mL, 3 min); then the supernatant is collected by preliminary centrifugation at 6000g for 30 min, the broken bacteria are removed, and the obtained supernatant is then centrifuged at 26000rpm for 30 min to collect the precipitate, thereby obtaining IFN-γ-BBV-E7, which is the recombinant modified bacterial vesicle of IFN-γ.

[0067] Step 3, IFN-γ-BBV-E7 stimulates macrophages in vitro:

[0068] M0 Raw264.7 cells 1×10 6 Each well was plated in a 6-well cell culture plate, and IFN-γ-E7-BBV (final concentration: 1.5 μg / mL) was added and incubated for 24 hours to induce macrophages into M1 type cytotoxic macrophages MAK3. The changes of molecular markers of M1 macrophages were detected by RT-PCR and Western blot.

[0069] IFN-γ-E7-BBV stimulated Raw264.7 macrophages in the M0 state for 24 h. QP results showed that the stimulated cells upregulated the M1 phenotype-related genes IL-12, iNOS, and CD80, and the expression levels were higher than those in the LPS+IFN-γ (M1) group ( Figure 2 AC), previous work has shown (patent application: 202310046703.7) that IFN-γ-BBV can effectively polarize bone marrow-derived M0 macrophages to M1 in vitro and in vivo. After IFN-γ-E7-BBV treated Raw264.7 cells, this example again verified the upregulation of iNOS by Western blot ( Figure 2 In this example, bone marrow macrophages (M0BMDMs) were isolated from mice, IFN-γ-BBV-E7 and other control stimuli were added, and the morphology of BMDMs under IFN-γ-BBV and IFN-γ-E7-BBV stimulation was consistent with that of the classical M1 type stimulator LPS+IFN-γ group, but was obviously inconsistent with the M2 morphology under the stimulation of the classical M2 type inducer IL-4 ( Figure 2Middle E) shows that macrophages are biased towards the M1 type under IFN-γ-E7-BBV stimulation.

[0070] Embodiment 2:

[0071] Macrophages have phagocytic function. In order to explore the direct killing effect of M1-type killer macrophage MAK3 on tumor cells described in Example 1 and to investigate whether the phagocytic function of macrophages stimulated in vitro is abnormal, this example uses BBV, IFN-γ-BBV, E7-BBV, and IFN-γ-E7-BBV to stimulate macrophages for 24 hours and then co-cultures with tumor cells stained with CFSE proliferation dye for 24-48 hours, and records and observes their in vitro killing properties under a fluorescence microscope. The specific method is:

[0072] 1) After incubation of M0 Raw264.7 with different stimulants for 24 h, the medium containing stimulants was removed and the cells were washed three times with sterile PBS;

[0073] 2) Count the Raw264.7 cells with different treatments and re-plate them so that the number of cells in each experimental well is 1×10 6 ;

[0074] 3) After the cells were stably attached to the wall, CFSE-stained tumor cells were added, 3×10 5 / well, incubate for 24-48h, and take pictures under a fluorescence microscope to record the killing of tumor cells.

[0075] The E7-BBV described in this example is only used as a stimulation control group, which means that only Trx on the surface of the vesicles locates E7 to the bacterial periplasmic space, and there is no ClyA to attract IFN-γ. That is, the mouse HPV-specific antigen E7 is connected to the C-terminus of Trx through Linker (GSGS), and codon optimization is performed according to the codon preference of Escherichia coli to obtain the Trx-E7 fusion gene, and TRX-E7 is constructed into the corresponding vector by homologous recombination, and then IFN-γ-E7-BBV is prepared.

[0076] The results showed that after stimulation, the M1-type killer macrophage MAK3 described in Example 1 still had phagocytic function, and the number of stained tumor cells decreased over time, indicating that macrophages maintained a strong tumor killing ability ( Figure 3 ).

[0077] Example 3: Implementation plan for adoptive cell therapy of MKA3 M1-type cytotoxic macrophages

[0078] In order to evaluate the tumor model intervention potential of macrophages stimulated by IFN-γ-E7-BBV in vitro, this example evaluated the in vivo localization of MAK3 in tumor-bearing mice after intravenous injection to study its biodistribution behavior. The specific scheme is:

[0079] IFN-γ-E7-BBV induced M0 Raw264.7 cells for 24 hours, washed with PBS 2-3 times, and collected in vitro induced M1 cytotoxic macrophage MAK3 cells by centrifugation. 6 / mouse, and injected into the subcutaneous cervical cancer transplantation model mice through tail vein, and the intervention effect of the tumor model was analyzed by flow cytometry.

[0080] The macrophages MAK3 stimulated by DIR-labeled IFN-γ-E7-BBV in vitro and the unstimulated macrophages M0 labeled by DIR were used as controls and injected into the tail vein of mice bearing TC-1 cervical cancer and 4T1 orthotopic breast cancer tumors (tumor volume ≈ 50 mm 3 ). The biodistribution analysis of the subcutaneous TC-1 cervical cancer model showed that M0 and MAK3 injected into the tail vein had fluorescent signals in the liver, lungs, and kidneys, and the fluorescent signals accumulated in the liver were stronger ( Figure 4 24h after injection, both M0 and MAK3 group tumors showed DiR fluorescence signals, revealing the macrophage-derived tumor targeting ability ( Figure 4 Middle D), through the tumor homing effect, pro-inflammatory macrophages are sent into the tumor, directly killing the tumor, triggering an immune response, and promoting tumor immune response. In addition, we also observed the fluorescence localization of stained cells M0 and MAK3 in the mouse axilla, tumor drainage, and inguinal lymph nodes ( Figure 4 In Figure E), the in vitro stimuli contain tumor-specific antigens. It is speculated that macrophages can process and present the specific antigens in advance. After intravenous injection, they circulate in the blood to the lymph nodes and may directly induce certain tumor immune responses.

[0081] Embodiment 4:

[0082] In this example, the M1 type killer macrophage MAK3 described in Example 1 is used as a combined drug that can improve the therapeutic effect of HPV-infected tumors, and is used in combination with the tumor vaccine Q11-E7. The specific scheme is:

[0083] (1) After the TC-1 subcutaneous tumor model was established, tumor growth was monitored and tumor size was measured every two days until the tumor grew to approximately 50 mm. 3 , the mice were randomly divided into 4 groups, namely PBS, Q11-E7, MAK3, and Q11-E7+MAK3;

[0084] (2) Q11-E7 and MAK3 injection: Q11-E7 (100 μL, concentration: 10 nm / mouse) was injected subcutaneously once every 7 days for a total of three injections; the first injection of MAK3 was injected 5 to 7 days after the first injection of Q11-E7, and 100 μL of 5×106 / mouse, injected once every three days, for a total of four injections; the tumor volume and body weight changes of the mice were measured every two days.

[0085] (3) On day 30, the mice were killed by cervical dislocation after anesthesia, and the spleen and tumor tissues were collected, weighed, photographed, and the size was recorded. The tumor tissues were also immersed in 4% paraformaldehyde solution.

[0086] The tumor vaccine Q11-E7 described in this example is not a commercially available vaccine. It is a tumor vaccine previously prepared by the applicant's department. It is only used as a representative of tumor vaccines, indicating that the combination of this cell and the tumor vaccine is expected to exert a strong synergistic effect. The expected synergistic effect is as follows: Considering that the macrophage MAK3 activated in vitro can efficiently locate to the tumor area to kill tumor cells, but may be inhibited by TME, and the tumor vaccine can induce tumor antigen-specific T cell response, the combination of the two is expected to achieve the simultaneous effect of tumor microenvironment regulation and immune response effect; HPV16 E7 prepared in the previous work 44-62 The synthetic peptide fused with Q11 was successfully assembled into nanofiber Q11-E7, which induced a strong cellular immune response after immunization and activated the body's immune system (Li S, Zhu W, Ye C, et al. Local mucosal immunization of self-assembled nanofibers elicits robust antitumor effects in an orthotopic model of mouse genital tumors. Nanoscale. 2020; 12(5): 3076-3089.). On this basis, the injection of functionalized MAK3 achieved a stronger tumor inhibition effect compared with a single treatment method, that is, the combined strategy of tumor vaccine and cell therapy has certain development prospects.

[0087] In this example, after the tumor model was established, the tumor-bearing mice were subcutaneously inoculated with Q11-E7 vaccine 5 to 7 days before the tail vein injection of MAK3 ( Figure 5 The experimental results showed that the Q11-E7+MAK3 group could significantly inhibit the growth of mouse tumors ( Figure 5 Middle B), reduced tumor weight ( Figure 5 Flow cytometry experiments showed that the Q11-E7+MAK3 group significantly increased the levels of iNOS+M1 and CTL in the tumor compared with the model PBS group ( Figure 5 middle GJ), reducing the level of M2 ( Figure 5 G) and the level of MDSCs in tumors ( Figure 5 I), CTL in lymph nodes increased significantly ( Figure 5These data suggest that the immune state activated by tumor vaccines combined with adoptive cell therapy can exert a significant synergistic effect and promote tumor immunotherapy.

[0088] In addition, in this embodiment, Q11-E7 and MAK3 belong to the joint discussion of treatment strategies. Q11-E7 is a representative of tumor vaccines. Because the stimulator (IFN-γ-E7-BBV) carries the E7 tumor-specific antigen, the applicant expects that the macrophages stimulated in vitro will phagocytize and process part of the E7 antigen and present the antigen through the MCH pathway. Under the advance treatment of the Q11-E7 tumor vaccine, the tumor-specific immune response in vivo is activated. After the injection of MAK3, the two pathways work synergistically. You can replace it with other tumor-specific vaccines according to different in vitro inducers, such as replacing IFN-γ-E7-BBV (E7: cervical cancer-specific antigen) with IFN-γ-4T1-BBV (4T1: breast cancer-specific antigen), and the corresponding tumor vaccine can be replaced with a breast cancer-related tumor vaccine.

[0089] Finally, it should be noted that the above is only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred arrangement scheme, a person skilled in the art should understand that the technical solution of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A macrophage with in vitro functional regulation, characterized in that: The macrophages are obtained by the following method: Step 1, preparation of IFN-γ recombinant modified bacterial vesicles: S11, construction of fusion plasmid: First, the signal peptide of mouse IFN-γ was removed, and then the mature IFN-γ region was connected to the C-terminus of ClyA through Linker, and codon optimization was performed according to the codon preference of Escherichia coli to obtain the ClyA-IFN-γ fusion gene; the tumor-specific antigen was connected to the C-terminus of Trx through Linker, and codon optimization was performed according to the codon preference of Escherichia coli to obtain the Trx-antigen fusion gene; finally, the ClyA-IFN-γ and Trx-antigen fusion genes were constructed into a plasmid to obtain the ClyA-IFN-γ+Trx-antigen fusion plasmid; S12, Preparation of IFN-γ-BBV-antigen: The ClyA-IFN-γ+Trx-antigen fusion plasmid obtained in S11 is transformed into Escherichia coli, and the expression of the exogenous protein is induced by adding IPTG to the culture medium, the bacterial liquid is collected and resuspended to obtain a bacterial suspension, and the bacterial suspension is treated by high-pressure homogenization. The bacteria are driven by ultra-high pressure and squeezed through the cracks to form a membrane component carrying the recombinant protein. The bacterial suspension obtained after the high-pressure homogenization treatment is subjected to preliminary centrifugation to collect the supernatant and remove the broken bacteria. The supernatant is subjected to ultracentrifugation to collect the precipitate, thereby obtaining IFN-γ-BBV-antigen, that is, IFN-γ recombinant modified bacterial vesicles; Step 2, IFN-γ-BBV-antigen stimulation of macrophages in vitro: The IFN-γ-BBV-antigen prepared in step 1 is added to the macrophages, and the cells are incubated for 12 to 36 hours to induce the macrophages into M1 type cytotoxic macrophages MAK3.

2. The macrophage with in vitro functional regulation according to claim 1, characterized in that: In step 1, S11, the codon-optimized ClyA-IFN-γ fusion gene sequence is shown in SEQ ID NO.

1.

3. The macrophage with in vitro functional regulation according to claim 1, characterized in that: In step 1, S11, the tumor-specific antigens include HPV-specific antigen E7 and breast cancer-specific antigen 4T1.

4. The macrophage with in vitro functional regulation according to claim 3, characterized in that: The tumor-specific antigen is the HPV-specific antigen E7, and the Trx-antigen fusion gene in step 1 is the Trx-E7 fusion gene, and its sequence is shown in SEQ ID NO.

2.

5. The macrophage with in vitro functional regulation according to claim 1, characterized in that: In step 2, 1×10 macrophages 6 Each well was plated in a 6-well cell culture plate, and IFN-γ-BBV-antigen was added to the macrophages to control its final concentration to 1.5 μg / mL, and incubated for 24 hours.

6. A combined drug capable of improving the therapeutic effect of tumor vaccines on tumors, characterized in that: The combined drug is the in vitro functionally regulated macrophage MAK3 as described in any one of claims 1 to 5.

7. The combined drug for improving the tumor treatment effect of tumor vaccine according to claim 6, characterized in that: The in vitro functionally regulated macrophage MAK3 was administered by intravenous injection.

8. The combined drug for improving the therapeutic effect of tumor vaccines on tumors according to claim 6, characterized in that: The tumors include cervical cancer and breast cancer.

9. Use of the macrophages with in vitro function regulation according to any one of claims 1 to 5 in the preparation of drugs for treating cervical cancer and / or breast cancer.

Images