Single-cycle replication-deficient recombinant feline calicivirus as well as construction method and application thereof

Abstract

The invention discloses a single-cycle replication defective recombinant feline calicivirus (FCV) as well as a construction method and application of the FCV, and belongs to the technical field of biological medicines. The single-cycle replication-deficient recombinant feline calicivirus is obtained by deleting a nucleotide sequence between 19nt and 48nt of a VP2 gene of a feline calicivirus VS-FCV HBDL2 strain on the basis of the feline calicivirus VS-FCV HBDL2 strain, and the single-cycle replication-deficient recombinant feline calicivirus is named as rHBDL2 VP219-48. The research finds that the recombinant virus rHBDL2 VP219-48 can only grow in a gene engineering modified cell line, and has good safety. Besides, the recombinant virus rHBDL2 VP219-48 shows good immunogenicity in a cat body and can induce the body to generate a high-level neutralizing antibody aiming at a high-pathogenicity FCV strain, so that the recombinant virus rHBDL2 VP219-48 can be used as a weak candidate vaccine strain for preventing infection of the high-pathogenicity FCV strain (VS-FCV), and the problem that an existing vaccine cannot effectively prevent infection of the VS-FCV strain is solved.

Description

Technical Field

[0001] The present invention relates to a replication-deficient recombinant feline calicivirus, in particular to a single-cycle replication-deficient recombinant feline calicivirus, and also to a construction method of the single-cycle replication-deficient recombinant feline calicivirus and an application of the single-cycle replication-deficient recombinant feline calicivirus in preparing a vaccine for preventing feline calicivirus infection. The present invention belongs to the field of biomedicine technology. Background Art

[0002] Feline Calicivirus (FCV) is a non-enveloped single-stranded positive-sense RNA virus belonging to the genus Vesivirus of the family Caliciviridae. It has icosahedral symmetry, a diameter of 27 to 40 nm, a genome length of approximately 7.7 kb, and three open reading frames. ORF1 encodes non-structural proteins: p5.6, p32, p39 (NTPase), p30, p13 (VPg), and p76 (Pro-Pol); ORF2 is approximately 2 Kb in size and encodes the main structural protein. Its precursor protein is approximately 75 KD, which is then cleaved by the viral protease to form a mature capsid protein VP1 of approximately 62 KD and a leader protein LC of approximately 14 KD; ORF3 encodes the minor VP2 capsid protein.

[0003] FCV is a highly contagious virus that was first discovered in 1957. The infectious rhinoconjunctivitis caused by it is an important epidemic disease that endangers the health of pets, economic animals and wild animals. The disease is mainly manifested clinically as respiratory diseases such as rhinitis, conjunctivitis and oral ulcers. In recent years, malignant systemic diseases of cats caused by infection with highly pathogenic feline calicivirus (Virulent System Feline Calicivirus, VS-FCV) strains have appeared in many countries around the world. The disease can cause high fever, edema, ulcers on the head and limbs, jaundice and other symptoms in adult cats, and has a high mortality rate.

[0004] At present, my country has long relied on the imported Zoetis cat triple inactivated vaccine to prevent FCV infection. Due to the large antigenic variation among different FCV strains and the weak cross-reactivity of the neutralizing antibodies induced by the body, the existing vaccine cannot effectively prevent infection with domestic strains, especially the highly pathogenic VS-FCV strains. Summary of the invention

[0005] The purpose of the present invention is to solve the problem that existing vaccines cannot effectively prevent VS-FCV strain infection, and to provide a replication-deficient recombinant feline calicivirus and a construction method and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical means:

[0007] The present invention selected VS-FCV HBDL2 as the research strain, deleted its VP2 gene, and successfully rescued the VP2 gene-deficient FCV weak strain rHBDL2△ that can be stably propagated in F81-VP2 by using F81-VP2 to complement VP2 protein in vitro. VP219-48 , press 10 5 , 10 6 , 10 7 , 10 8 TCID50 / mL was divided into four immunization groups to immunize Chinese rural cats, with 5 cats in each immunization group and 5 cats in the negative control group. After two immunizations, rHBDL2△ VP219-48 All immunized groups produced high levels of neutralizing antibodies, with the highest neutralizing titer reaching 2 10 , indicating that rHBDL2△ VP219-48 Attenuated strains have application prospects as vaccines.

[0008] Based on the above research, the present invention first proposes a single-cycle replication-deficient recombinant feline calicivirus, which is obtained by deleting the VP2 gene of the feline calicivirus VS-FCV HBDL2 strain, wherein the feline calicivirus VS-FCV HBDL2 strain is deposited in the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration, and the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with a deposit number of CGMCC No.46180 and a deposit date of September 11, 2024.

[0009] Among them, preferably, the single-cycle replication-deficient recombinant feline calicivirus is a gene-deleted replication-deficient FCV attenuated strain obtained by deleting the nucleotide sequence between 19nt-48nt of the VP2 gene of the feline calicivirus VS-FCVHBDL2 strain.

[0010] Among them, preferably, the genome sequence of the single-cycle replication-deficient recombinant feline calicivirus is shown as SEQ ID NO.2.

[0011] Secondly, the present invention also proposes a method for constructing the single-cycle replication-deficient recombinant feline calicivirus, comprising the following steps:

[0012] Step 1: PCR amplification was performed using VS-FCV HBDL2 strain genomic DNA as a template and HBDL2-1 / F / R, HBDL2-2 / F / R, and HBDL2-3 / F / R as primers, and pOK-12 vector as a template and pOK12-1 / F / R as primers, and then the amplified products were connected to prepare the recombinant plasmid pOK-HBDL2; wherein the primers used for PCR amplification are as follows:

[0013] HBDL2-1 / F:ACCTAATACGACTCACTATAGTAAAAGAAATTTGAGACAA HBDL2-1 / R:TGTTGATTGGCGGGTAGTTCATCC

[0014] HBDL2-2 / F:GAACTACCCGCCAATCAACATGTGG

[0015] HBDL2-2 / R:AACTTCGAACACATCACAGTGGAGG

[0016] HBDL2-3 / F:ACTGTGATGTGTTCGAAGTTTGAGC

[0017] HBDL2-3 / R:

[0018] GCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCTGGGGTTAGGCGCAGGTGCGGC

[0019] pOK12-1 / F:

[0020] CCTCGCGGTCCGACCTGGGCATCCGAAGGAGGACGCACGTCCACTCG GATGGCTAAGGGAGGGCGctcgagGcggccgctctagaactagtggatcgatcccca

[0021] pOK12-1 / R:

[0022] CTATAGTGAGTCGTATTAGGTACCTtcgaggcctcggactagtggcgtaatc;

[0023] Step 2: Using the pOK-HBDL2 recombinant plasmid as a template, HBDL2-1 / F / R, HBDL2-2 / F / R, HBDL2-3 / F / HBDL2-4 / F, HBDL2-5 / F / pOK12-1 / R as primers for PCR amplification, and connecting the amplified products to prepare the recombinant plasmid pOK-HBDL2 △VP219-48 , the VP2 gene 19nt-48nt is deleted in the recombinant plasmid; wherein, the primers used for PCR amplification are as follows:

[0024] HBDL2-1 / F:ACCTAATACGACTCACTATAGTAAAAGAAATTTGAGACAA HBDL2-1 / R:TGTTGATTGGCGGGTAGTTCATCC

[0025] HBDL2-2 / F:GAACTACCCGCCAATCAACATGTGG

[0026] HBDL2-2 / R:AACTTCGAACACATCACAGTGGAGG

[0027] HBDL2-3 / F:ACTGTGATGTGTTCGAAGTTTGAGC

[0028] HBDL2-4 / R:ACCTAATATTGAGTTCATAATTTAGTCATA

[0029] HBDL2-5 / F:

[0030] TTATGAACTCAATATTAGGTAAAGCTCAACAAATTGAATTGGACAAAGCT

[0031] pOK12-1 / R:

[0032] CTATAGTGAGTCGTATTAGGTACCTtcgaggcctcggactagtggcgtaatc;

[0033] Step 3: Use the lentiviral packaging three-plasmid system to construct the F81-VP2 cell line for expressing the VP2 gene of the HBDL2 strain;

[0034] Step 4: pOK-HBDL2 △VP219-48 The recombinant plasmid was linearized by restriction enzyme digestion and HBDL2 was obtained by in vitro transcription. △VP219-48 RNA was transfected into F81-VP2 cell line to rescue the recombinant virus rHBDL2 △VP219-48 .

[0035] Preferably, the specific method for constructing the F81-VP2 cell line using the lentiviral packaging three-plasmid system in step 3 is:

[0036] The three plasmids, pLVX-VP2-IRES-ZsGreen1, pMD2G and pSPAX2, are diluted with DMEM culture medium to obtain a plasmid dilution solution; a transfection reagent is mixed with the plasmid dilution solution to obtain a plasmid / transfection reagent complex, the plasmid / transfection reagent complex is evenly dropped into 293T cells, cultured, the culture medium supernatant is collected, the culture medium supernatant is used to infect F81 cells, and the F81 cells are flow sorted to obtain an F81-VP2 cell line; the cell density of the F81 cells is 48% to 52%; the goal of the flow sorting is to continuously sort cells whose green fluorescence positive rate reaches more than 95% twice.

[0037] Preferably, the pLVX-VP2-IRES-ZsGreen1 plasmid is constructed by inserting the VP2 gene into pLVX-IRES-ZsGreen1, wherein the sequence of the VP2 gene is shown in SEQ ID NO: 1 in the sequence listing.

[0038] Preferably, the transfection procedure in step 4 is as follows: HBDL2 △VP219-48 The RNA diluent and the Lipo2000 diluent were mixed evenly to obtain a Lipo2000 / RNA complex. The mixture was allowed to stand and the Lipo2000 / RNA complex was evenly dropped into F81-VP2 cells for cultivation. When CPE appeared in the cells, the replication-deficient recombinant virus was harvested.

[0039] Again, the present invention also proposes the use of the single-cycle replication-deficient recombinant feline calicivirus in the preparation of a drug for preventing feline calicivirus infection.

[0040] Among them, preferably, the feline calicivirus is a highly pathogenic feline calicivirus.

[0041] Among them, preferably, the drug is a vaccine.

[0042] Then, the present invention also proposes a single-cycle replication-deficient recombinant feline calicivirus expressing the VP1 gene of the FCV QD2 strain, wherein the recombinant feline calicivirus is obtained by replacing the VP1 gene of the single-cycle replication-deficient recombinant feline calicivirus described in claim 1 with the VP1 gene of the FCV QD2 strain, and preferably, the genome sequence of the recombinant feline calicivirus is shown in SEQ ID NO.15.

[0043] Subsequently, the present invention also proposes a method for obtaining the single-cycle replication-deficient recombinant feline calicivirus expressing the FCV QD2 strain VP1 gene, comprising the following steps:

[0044] (1) Preparation of pOK-rHBDL2 QD2 VP1 △VP219-48 Recombinant plasmid

[0045] Using FCV QD2 strain genomic DNA as a template and QD2-1 / F / R as primers, and using pOK-rHBDL2 prepared in claim 4 △VP219-48 As template, PCR amplification was performed with HBDL2-1 / F / R, HBDL2-2 / F / R, and HBDL2-5 / F / pOK12-1 / R as primers. Four DNA fragments were obtained by agarose gel electrophoresis, gel excision, recovery, and purification. There were 20 bp homology arms before and after the fragments. The DNA fragments were connected and transformed into competent JM109 to obtain positive clones. The recombinant plasmid was extracted using a plasmid extraction kit for sequencing. The recombinant plasmid with correct sequencing was named pOK-rHBDL2 QD2 VP1 △VP219-48 ;

[0046] HBDL2-1 / F:ACCTAATACGACTCACTATAGTAAAAGAAATTTGAG

[0047] ACAA

[0048] HBDL2-1 / R:TGTTGATTGGCGGGTAGTTCATCC

[0049] HBDL2-2 / F:GAACTACCCGCCAATCAACATGTGG

[0050] HBDL2-2 / R:AACTTCGAACACATCACAGTGGAGG

[0051] QD2-1 / F:ACTGTGATGTGTTCGAAGTTTGAGCATGTGCTCAAC

[0052] CTGCGCTAACGTGC

[0053] QD2-1 / R:ACCTAATATTGAGTTCATAATTTAGTCATTCCACTCCT

[0054] AATGTTAGAGGC

[0055] HBDL2-5 / F:TTATGAACTCAATATTAGGTAAAGCTCAACAAATTG

[0056] AATTGGACAAAGCT

[0057] pOK12-1 / R:CTATAGTGAGTCGTATTAGGTACCTtcgaggcctcggactagtg

[0058] gcgtaatc

[0059] (2) Rescue of recombinant virus rHBDL2 QD2 VP1 △VP219-48

[0060] pOK-rHBDL2 QD2 VP1 △VP219-48 The recombinant plasmid was linearized by XhoI digestion, and the product was purified by product purification kit. In vitro transcription reaction was performed according to the instructions of the in vitro transcription kit, and Ribo m7G CapAnalog was added to obtain rHBDL2 QD2 VP1. △VP219-48 RNA was then transfected into the F81-VP2 cell line. The cells were transferred to a 37°C 5% CO2 incubator for culture. After 48 hours, the cells were observed for cytopathic effects (CPE). The cells and their culture supernatants were placed in a -80°C refrigerator and frozen and thawed once before being inoculated into new cells. The CPE was further observed. The recombinant virus that was successfully rescued was named rHBDL2 QD2 VP1 △VP219-48 .

[0061] Next, the present invention also proposes the use of a single-cycle replication-deficient recombinant feline calicivirus expressing the VP1 gene of the FCV QD2 strain in the preparation of a drug for preventing feline calicivirus infection. Preferably, the drug is a vaccine.

[0062] Finally, the present invention also proposes a vaccine composition for preventing feline calicivirus infection, wherein the vaccine composition contains the single-cycle replication-deficient recombinant feline calicivirus expressing the FCV QD2 strain VP1 gene and the single-cycle replication-deficient recombinant feline calicivirus.

[0063] Compared with the prior art, the present invention has the following beneficial effects:

[0064] The present invention uses reverse genetics technology to successfully rescue the VP2 gene-deleted recombinant single-cycle replication-deficient feline calicivirus in the cat kidney cell F81 chimeric VP2 gene cell line, and performs targeted deletion of the VP2 gene of the highly pathogenic FCV strain HBDL2 to obtain a replication-deficient virus that replicates only in a single cycle. The virus can only grow in a genetically engineered cell line and has good safety.

[0065] The VP2 gene-deficient replication-deficient recombinant feline calicivirus assembled in a genetically engineered cell line exhibits good immunogenicity in cats and can induce the body to produce high levels of neutralizing antibodies against highly pathogenic FCV strains. It can be used to prevent and control highly pathogenic FCV strains (VS-FCV) infection and can be used as a candidate feline calicivirus single-cycle replication attenuated vaccine strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 Schematic diagram of the construction of pOK-HBDL2 recombinant plasmid;

[0067] Figure 2 pOK-HBDL2 △VP219-48 Schematic diagram of the construction of recombinant plasmid;

[0068] Figure 3 For pOK-HBDL2 and pOK-HBDL2 △VP219-48 Single enzyme digestion identification of recombinant plasmid;

[0069] Among them, M represents DL15000 DNAMarker; 1 represents pOK-HBDL2; 2 represents pOK-HBDL2 linearization; 3 represents pOK-HBDL2 △VP219-48 ; 4 represents pOK-HBDL2 △VP219-48 Linearization;

[0070] Figure 4 IFA identification of the F81-VP2 gene stably expressing cell line;

[0071] Figure 5 Recombinant virus rHBDL2 △VP219-48 CPE status of infected F81-VP2 cells;

[0072] Figure 6 Recombinant virus rHBDL2 △VP219-48 and electron microscopic observation of wild strain HBDL2;

[0073] Figure 7 Recombinant virus rHBDL2 △VP219-48 IFA identification of single-cycle replication defects, Figure 7 The picture in the middle and upper row is rHBDL2 △VP219-48 F81 cells were infected with 10-fold serial dilutions for 48 hours, IFA: VP1 protein expression; the next row of pictures is rHBDL2 △VP219-48 F81 cells were infected with 10-fold gradient dilution for 48 hours, and the supernatant of freeze-thaw was inoculated into F81 cells for 48 hours. IFA: VP1 protein was not expressed; the rightmost pictures in the upper and lower rows are HBDL2 control pictures;

[0074] Figure 8Recombinant virus rHBDL2 △VP219-48 And the growth kinetic curves of wild strain HBDL2.

[0075] Fig. 9 The body temperature measurement results of each immunization group;

[0076] Fig.10 The weight growth rate of each immunization group;

[0077] Fig.11 The amount of virus in the blood of each immunization group;

[0078] Fig.12 The clinical symptoms of FCV were scored for each immunization group;

[0079] Fig.13 pOK-rHBDL2 QD2 VP1 △VP219-48 Schematic diagram of the construction of infectious clone plasmid;

[0080] Fig.14 The morphology of rHBDL2QD2 VP1 FCV-△VP2 virus particles was observed using negative staining transmission electron microscopy, as indicated by the black arrow. DETAILED DESCRIPTION

[0081] The embodiments of the present invention are described in detail below. The following embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation schemes and specific operation processes are given, but the protection scope of the present invention is not limited to the following embodiments.

[0082] Example 1 Recombinant virus rHBDL2 △VP219-48 Preparation

[0083] 1. Virus strains and their origins

[0084] In this embodiment, the HBDL2 genome is derived from the VS-FCV HBDL2 strain, which is a progeny virus after three viral plaque purifications of the original strain, and the original strain has been disclosed in the Chinese Academy of Agricultural Sciences dissertation "Preparation of Monoclonal Antibodies to Feline Calicivirus, Identification of Strain Isolation and Pathogenicity Analysis". The VS-FCV HBDL2 strain is a feline calicivirus, which is deposited in the General Microbiological Center (CGMCC) of the China Microbiological Culture Collection Administration, and the deposit address is No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number is CGMCC No. 46180, and the deposit date is September 11, 2024.

[0085] 2. Methods

[0086] 2.1 Preparation of pOK-HBDL2 recombinant plasmid

[0087] VS-FCVHBDL2 strain genomic DNA was used as a template and HBDL2-1 / F / R, HBDL2-2 / F / R, HBDL2-3 / F / R were used as primers. At the same time, pOK-12 vector was used as a template and pOK12-1 / F / R was used as a primer for PCR amplification. The PCR system was: 10×PCRBuffer (5μL), 25mM MgSO4 (4μL), 2mM dNTPs (5μL), 1.5μL of upstream and downstream primers, cDNA template (2μL), KOD high-fidelity enzyme (1μL), sterile water (5μL); PCR reaction program: 98℃ denaturation for 10s, 55℃ annealing for 30s, 68℃ extension for 2min, 30 cycles; 68℃ extension for 10min; 4℃ storage, agarose gel electrophoresis, gel excision, recovery and purification to obtain 4 DNA fragments, with 20bp homology arms before and after the fragments, the DNA fragments were connected, the connection system: 2×CE mix (5μL), 50ng of each DNA fragment, add sterile water to 10μL; 50℃ for 15min to obtain the connection product, transformed into competent JM109 to obtain positive clones, and the recombinant plasmid was extracted using a plasmid extraction kit for sequencing and identified by single enzyme digestion. The correct recombinant plasmid was named pOK-HBDL2.

[0088] Table 1 Primers used to prepare pOK-HBDL2 recombinant plasmid

[0089]

[0090]

[0091] 2.2 Preparation of pOKHBDL2 △VP219-48 Recombinant plasmid

[0092] Using the pOK-HBDL2 recombinant plasmid as a template, PCR amplification was performed using the primers in Table 2. The PCR system was: 10×PCRBuffer (5μL), 25mM MgSO4 (4μL), 2mM dNTPs (5μL), 1.5μL of upstream and downstream primers, cDNA template (2μL), KOD high-fidelity enzyme (1μL), and sterile water (5μL); PCR reaction program: 98°C denaturation for 10s, 55°C annealing for 30s, 68°C extension for 2min, 30 cycles; 68°C extension for 10min; 4°C storage, agarose gel electrophoresis, gel excision, recovery, and purification to obtain 4 DNA fragments, with 20bp homology arms before and after the fragments. The DNA fragments were connected, and the connection system was: 2×CE Mix (5 μL), 50 ng of each DNA fragment, add sterile water to 10 μL; after 15 min at 50°C, the ligation product was obtained, and transformed into competent JM109 to obtain positive clones. The recombinant plasmid was extracted using a plasmid extraction kit for sequencing and identified by single enzyme digestion. The correct recombinant plasmid was named pOK-HBDL2 △VP219-48 The VP2 gene in the recombinant plasmid has 19nt-48nt deleted.

[0093] Table 2 Preparation of pOKHBDL2 △VP219-48 Primers used for recombinant plasmids

[0094]

[0095]

[0096] The invention introduces T7 promoter at the 5' end of the feline calicivirus genome sequence and HDV ribozyme sequence at the 3' end to construct pOK-HBDL2 and pOK-HBDL2 △VP219-48 Infectious cloning plasmids. pOK-HBDL2 and pOK-HBDL2 △VP219-48 The schematic diagrams of plasmid construction are shown in Figure 1 and Figure 2 pOK-HBDL2 and pOK-HBDL2 △VP219-48 Plasmid single enzyme digestion identification see Figure 3 The results showed that pOK-HBDL2 and pOK-HBDL2 △VP219-48 The infectious clone plasmid was constructed successfully.

[0097] 2. Preparation of 3F81-VP2 Cell Line

[0098] The VP2 gene stably expressed F81 cell line was constructed using a lentiviral packaging three-plasmid system. The pLVX-VP2-IRES-ZsGreen1 recombinant plasmid was constructed by inserting the VP2 gene (the sequence of the VP2 gene is shown in SEQ ID NO: 1 in the sequence table) into pLVX-IRES-ZsGreen1, which was synthesized and provided by Nanjing GenScript Company. The pMD2G and pSPAX2 backbone plasmids were commercial plasmids. When the 293T cells were cultured in a T75 culture flask at a density of about 80%, the transfection procedure was as follows: 10 μg of each plasmid of pLVX-VP2-IRES-ZsGreen1, pMD2G and pSPAX2 was added to 100 μL DMEM and mixed, and 60 μL of PEI (2 μg / μl) transfection reagent was added to 100 μL DMEM and mixed. The PEI and plasmid dilutions were fully mixed and allowed to stand for 15 minutes to obtain a plasmid / PEI complex. The plasmid / PEI complex was evenly dropped into the 293T cells. The cells were transferred to a 37°C 5% CO2 incubator for culture. 48 hours after transfection, the culture supernatant was collected and replaced with fresh complete culture medium for the cells. 72 hours later, the culture supernatant was collected again, the two supernatants were mixed and mixed with fresh complete culture medium at a volume ratio of 1:1 to infect F81 cells (cat kidney cells, density of about 50%). After 24 hours, the cells were flow sorted according to green fluorescence. When the green fluorescence positive rate of two consecutive sortings reached more than 95%, it could be used for the subsequent rescue of recombinant feline calicivirus, and the obtained cell line was named F81-VP2.

[0099] When the density of F81-VP2 cells reached 90%, IFA identification was performed. F81-VP2 cells showed red fluorescence, while normal F81 cells did not. Figure 4 , Figure 4 The left picture in the middle shows F81-VP2 cells with red fluorescence, while the right picture shows normal F81 cells without fluorescence. The results show that the F81-VP2 cell line can express VP2 protein.

[0100] 2.4 Rescue of recombinant virus rHBDL2 △VP219-48

[0101] pOK-HBDL2 △VP219-48The recombinant plasmid was linearized by XhoI digestion, and the product was purified by the product purification kit. The in vitro transcription reaction was performed according to the instructions of the in vitro transcription kit, and Ribo m7G Cap Analog was added. The in vitro transcription 20μL system is as shown in Table 3. The reaction procedure is: 37℃2h, after the in vitro transcription is completed, 10×ReactionBuffer (10μL), DNase I (1μL) and RNase-free Water (69μL) are added in sequence and mixed, and incubated in a 37℃ water bath for 10min to degrade the residual linearized pOK-HBDL2 in the in vitro transcription product. △VP219-48 , purified using an RNA purification kit to obtain HBDL2 △VP219-48 RNA was then transfected into the F81-VP2 cell line. The transfection procedure was as follows: F81-VP2 cells were plated in a 12-well plate, and when the cell density reached about 90%, 1 μg HBDL2 was taken. △VP219-48 Add RNA to 100μL DMEM and mix well. Take 2μL Lipo 2000 transfection reagent to 100μL DMEM and mix well. After standing for 5 minutes, mix the RNA and Lipo2000 diluent thoroughly. Let stand for 10 minutes. Finally, drop the Lipo2000 / RNA complex evenly into the cells. The cells were transferred to a 37℃ 5% CO2 incubator for culture. After 48 hours, observe whether the cells have cytopathic effects (CPE). Place the cells and their culture supernatant in a -80℃ refrigerator, freeze and thaw once, and then inoculate into new cells to continue observing CPE. If the recombinant virus (named rHBDL2 △VP219-48 ), the virus solution was negatively stained and observed under electron microscopy, and HBDL2 virus solution was used as a positive control.

[0102] Table 3 In vitro transcription system

[0103] Reaction system Usage 10×ReactionBuffer 2μL ATP(100mM) 2μL CTP (100 mM) 2μL UTP(100mM) 2μL GTP(20mM) 2μL Ribom7GCapAnalog(40mM) 4μL <![CDATA[Linearized pOK-HBDL2 △VP219-48 > 1 μg T7RNApolmix 2μL RNase-free Water Make up to 20 μL

[0104] Results: HBDL2 △VP219-48 After RNA was transfected into F81-VP2 cells for 48 h, the cells were frozen and thawed once at -80 °C and centrifuged at 1500 rpm for 1 min to harvest the supernatant rHBDL2 △VP219-48 At the P0 generation, F81-VP2 cells were inoculated for 24 h and obvious CPE appeared. The cells were frozen and thawed three times at -80 °C and centrifuged at 1500 rpm for 1 min to harvest the supernatant rHBDL2 △VP219-48 In the P1 generation, obvious CPE appeared 24 hours after inoculation of F81-VP2 cells. Figure 5 . This indicates that the recombinant virus rHBDL2 △VP219-48 Rescue success, rHBDL2 △VP219-48 The genome sequence is shown as SEQ ID NO: 2 in the sequence listing.

[0105] Recombinant virus rHBDL2 △VP219-48 Electron microscopy was performed after negative staining, and the wild strain VS-FCVHBDL2 virus liquid was used as a positive control. The results showed that the recombinant virus rHBDL2 △VP219-48 There is no difference in virus particle morphology between VS-FCV HBDL2 and wild-type strain, see Figure 6 , further indicating that the recombinant virus rHBDL2 △VP219-48 Rescue successful.

[0106] Example 2 Recombinant virus rHBDL2 △VP219-48 Single cycle replication defect verification

[0107] Ordinary F81 cells were plated in 12-well plates, and when the cell density reached 90%, rHBDL2 △VP219-48 Dilute 10 times 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 After 48 h of infection of F81 cells with six dilutions, the cells were observed for CPE and washed with PBS three times for indirect immunofluorescence IFA identification. The wild-type strain HBDL210 was set 2 The dilution wells were used as controls. The cells were fixed with 4% paraformaldehyde for 30 min and washed three times with PBST; blocked with 5% skim milk for 1 h and washed three times with PBST shaker at 50 rpm; incubated with anti-FCVVP1 monoclonal antibody (1:500) for 1 h and washed three times with PBST shaker at 50 rpm; incubated with DyLight488-labeled goat anti-mouse IgG secondary antibody (1:500) for 1 h and washed three times with PBST shaker at 50 rpm, and observed for green fluorescence under an inverted fluorescence microscope.

[0108] Ordinary F81 cells were plated in 12-well plates, and when the cell density reached 90%, rHBDL2 △VP219-48 Dilute 10 times 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 Six dilutions were used to infect F81 cells. After 48 h, the CPE of the cells was observed. The cells and their culture supernatant were placed in a -80 °C refrigerator, frozen and thawed three times, centrifuged at 1500 rpm for 5 min, and the supernatant was inoculated with 90% density F81 cells. The CPE of the cells was observed and IFA was performed. The wild strain HBDL210 was set 2 Dilution wells served as controls.

[0109] Results: rHBDL2 △VP219-48 Dilute 10 times 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 After 48h of infection of normal F81 cells with six dilutions, indirect immunofluorescence IFA was performed to identify VP1 gene expression. The results showed that green fluorescence appeared in all the wells with six dilutions, indicating that rHBDL2 △VP219-48 Can infect normal F81 cells; rHBDL2 △VP219-48 Dilute 10 times 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 After 48h of infection with normal F81 cells at six dilutions, the cells were frozen and thawed three times at -80℃, and the supernatant was harvested by centrifugation at 1500rpm for 1min. The supernatant was inoculated into normal F81 cells again for 48h, and then indirect immunofluorescence IFA was performed to identify the expression of VP1 gene. The results showed that no green fluorescence appeared in the wells of the six dilutions, further indicating that rHBDL2 △VP219-48 Can only infect normal F81 cells once, rHBDL2 △VP219-48 For single-cycle replication-defective recombinant viruses, see Figure 7 .

[0110] Example 3 Recombinant virus rHBDL2 △VP219-48 Comparison of growth kinetics of wild-type strain VS-FCV HBDL2

[0111] F81-VP2 cells were plated in 24-well plates and when the cell density reached 90% (about 2×10 5 cells / well) infected with recombinant virus rHBDL2 △VP219-48 (100TCID 50 / mL) and wild strain VS-FCV HBDL2 (0.001MOI), with three replicates in each group. The virus was adsorbed for 1 hour, the supernatant culture medium was discarded, and fresh DMEM medium containing (1% FBS) was added. The supernatant virus liquid was harvested at 12h, 24h, 36h, 48h, 60h and 72h after infection, and the titer (TCID 50 ), and the determination was repeated three times at each time point. The TCID 50 The logarithmic value is used as the vertical axis and the infection time is used as the horizontal axis to make a virus growth curve.

[0112] TCID50 Assay steps: The harvested virus solution was diluted 10-fold with serum-free DMEM medium to 11 dilutions (10 1 ~10 11 ) Inoculate F81-VP2 cells at a density of about 80% in a 96-well plate. Set up 5 replicate wells for each dilution, 100 μL in each well, and set up 8 wells inoculated with serum-free DMEM medium as a control, 100 μL in each well. The virus was adsorbed at 37°C for 1 hour, the virus dilution was discarded, and 200 μL of fresh DMEM medium (1% FBS) was added to each well. The cells were cultured at 37°C for 48 hours, and the CPE was observed. The recombinant virus rHBDL2 was calculated according to the Reed-Muench method. △VP219-48 TCID of wild strain VS-FCVHBDL2 50 .

[0113] Results: rHBDL2 △VP219-48 F81-VP2 cells were infected with VS-FCVHBDL2 at a dose of 0.001 MOI, and the virus fluids were collected at 12h, 24h, 36h, 48h, 60h and 72h, and the virus TCID 50 And draw the growth curve, see Figure 8 The results showed that rHBDL2 △VP219-48 There was no significant difference in the growth dynamics curve between VS-FCVHBDL2 and VS-FCVHBDL2.

[0114] Example 4 Recombinant virus rHBDL2 △VP219-48 Evaluation of neutralizing antibody levels after immunization

[0115] According to rHBDL2 △VP219-48 Different immunization doses (10 8 TCID 50 / mL, 10 7 TCID 50 / mL, 10 6 TCID 50 / mL, 10 5 TCID 50 / mL) were set up to set up 4 immunization groups and 1 negative control group, with 5 Chinese rural cats in each group. The immunization method was intramuscular injection, and the immunization volume was 1mL / cat. The second immunization was carried out 21 days after the first immunization. Blood was collected from cats 21 days after each immunization, and the serum was separated for neutralization test to detect the neutralizing antibody level. Neutralization test steps: The separated serum samples were placed at 56℃ for 30 minutes and the treated cat serum was diluted 2-fold (2 1 ~2 12 ), take 2 3 ~2 12A total of 10 serum dilutions were mixed with wild-type strain HBDL2 (200 TCID 50 / 100μL) were mixed in equal volumes, and after neutralizing the virus at 37°C for 1h, the cat serum dilution / virus was inoculated into a 96-well plate at a culture density of 80% normal F81 cells at 100μL per well. Four replicate wells were set for each dilution, and the virus was adsorbed at 37°C for 1h. The culture supernatant was discarded, and the cells were washed twice with PBS. Fresh DMEM medium (1% FBS) was added to each well, and CPE was observed after 37°C for 48h. If CPE appeared in one or more wells of the four replicate wells, it was determined that the virus could not be completely neutralized at this serum dilution. If CPE did not appear in all four replicate wells, it was determined that the serum dilution had the ability to completely neutralize the virus.

[0116] Results: rHBDL2 △VP219-48 According to different immunization doses (10 8 TCID 50 / mL, 10 7 TCID 50 / mL, 10 6 TCID 50 / mL, 10 5 TCID 50 / mL) to immunize Chinese rural cats, and the results are shown in Table 4. The results show that after two immunizations, the cats produced a good level of neutralizing antibodies, and the neutralization titer was as high as 1:2. 10 , the lowest can reach 1:2 6 . It shows that rHBDL2 △VP219-48 Immunizing a cat can enable its body to produce a higher level of neutralizing antibodies, laying the foundation for subsequent anti-virus immune protection tests.

[0117] Table 4 Recombinant virus rHBDL2 △VP219-48 Neutralizing antibody levels produced by Chinese rural cats after immunization with different virus titers

[0118]

[0119]

[0120] Example 5 Recombinant virus rHBDL2 △VP219-48 Evaluation of protection level against virus challenge after immunization

[0121] The recombinant virus rHBDL2 was used according to the method of Example 4. △VP219-48 After 21 days of booster immunization, the recombinant virus rHBDL2 was evaluated by challenging with a highly pathogenic FCV strain. △VP219-48 The protection level of challenge after immunization was as follows: each cat in the immunization group and the control group was challenged by nasal drops and eye drops, and the challenge dose for each cat was 1 ml (10 8 TCID50 / mL, 0.8ml for nasal drops, 0.2ml for eye drops) highly pathogenic FCV strain HBDL2 and observed for 15 days, recording symptoms every day, and measuring body temperature, body weight and collecting anticoagulant blood (for virus content determination) on 0d, 3d, 6d, 9d, 12d, and 15d after infection.

[0122] Results: 21 days after booster immunization, the mice were challenged with highly pathogenic FCV strains by nasal drops and eye drops. 5 TCID 50 / mL immunization group had transient temperature rise (temperature exceeded 36.5℃) 3 days after challenge, while the temperature of other immunization groups was stable ( Fig. 9 ), the weight growth rate of the control group showed a trend of first decreasing and then increasing after the virus challenge, while the weight of the immune group continued to increase ( Fig.10 ). The duration of virus in the blood after challenge showed that compared with the control group 10 8 TCID 50 / mL, 10 7 TCID 50 / mL, 10 6 TCID 50 / mL immunization group did not detect the virus in the blood throughout the whole process, 10 5 TCID 50 / mL of the immune group's blood was detected with the virus, and the number of virus-positive cats and the virus content were lower than those in the control group ( Fig.11 ). Clinical scores showed that the FCV clinical symptom scores in each immunization group were significantly lower than those in the control group ( Fig.12 ), indicating that different immunization doses (10 8 TCID 50 / mL, 10 7 TCID 50 / mL, 10 6 TCID 50 / mL, 10 5 TCID 50 / mL) recombinant virus rHBDL2 △VP219-48 It can induce a protective immune response in cats against challenge with highly pathogenic FCV strains.

[0123] Example 6 Recombinant virus rHBDL2 QD2 VP1 △VP219-48 Preparation

[0124] 1. Virus strains and their origins

[0125] In this embodiment, the VP1 gene is derived from the FCV QD2 strain, which is a progeny virus of the original strain after three viral plaque purifications. The original strain has been disclosed in the Chinese Academy of Agricultural Sciences thesis "Preparation of Monoclonal Antibodies to Feline Calicivirus, Isolation and Identification of Strain and Pathogenicity Analysis" and is preserved and provided by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.

[0126] 2. Methods

[0127] 2.1 Preparation of pOK-rHBDL2 QD2 VP1 △VP219-48 Recombinant plasmid

[0128] The FCV QD2 strain genomic DNA was used as a template and the QD2-1 / F / R in Table 5 were used as primers. The pOK-rHBDL2 prepared in Example 12.2 was used as a primer. △VP219-48 As template, HBDL2-1 / F / R, HBDL2-2 / F / R, HBDL2-5 / F / pOK12-1 / R in Table 5 were used as primers for PCR amplification. The PCR system was: 10×PCRBuffer (5μL), 25mM MgSO4 (4μL), 2mM dNTPs (5μL), 1.5μL of upstream and downstream primers, cDNA template (2μL), KOD high-fidelity enzyme (1μL), sterile water (5μL); PCR reaction program: 98℃ denaturation for 10s, 55℃ annealing for 30s, 68℃ extension for 2min, 30 cycles; 68℃ extension for 10min; 4℃ storage, agarose gel electrophoresis, gel excision, recovery and purification to obtain 4 DNA fragments, with 20bp homology arms before and after the fragments, and the DNA fragments were connected. The connection system: 2×CE mix (5 μL), 50 ng of each DNA fragment, add sterile water to 10 μL; after 50°C for 15 min, the ligation product was obtained, transformed into competent JM109 to obtain positive clones, and the recombinant plasmid was extracted using a plasmid extraction kit for sequencing. The recombinant plasmid with correct sequencing was named pOK-rHBDL2 QD2 VP1 △VP219-48 .

[0129] Table 5 Preparation of pOK-rHBDL2 QD2 VP1 △VP219-48 Primers used for recombinant plasmids

[0130]

[0131]

[0132] The invention introduces a T7 promoter at the 5' end of the feline calicivirus genome sequence and an HDV ribozyme sequence at the 3' end to construct pOK-rHBDL2 QD2 VP1 △VP219-48 Infectious clone plasmid, plasmid construction diagram is shown in Fig.13 .

[0133] 2.2 Rescue of recombinant virus rHBDL2 QD2 VP1 △VP219-48

[0134] pOK-rHBDL2 QD2 VP1 △VP219-48 The recombinant plasmid was linearized by XhoI digestion, and the product was purified by the product purification kit. The in vitro transcription reaction was performed according to the instructions of the in vitro transcription kit, and Ribo m7G Cap Analog was added. Reaction procedure: 37℃2h, after the in vitro transcription was completed, 10×Reaction Buffer (10μL), DNase I (1μL) and RNase-free Water (69μL) were added in sequence and mixed, and incubated in a 37℃ water bath for 10min to degrade the residual linearized pOK-rHBDL2 QD2VP1 in the in vitro transcription product. △VP219-48 , purified using an RNA purification kit to obtain rHBDL2 QD2VP1 △VP219-48 RNA was then transfected into the F81-VP2 cell line. The transfection procedure was as follows: F81-VP2 cells were plated in a 12-well plate. When the cell density reached about 90%, 1 μg rHBDL2 QD2 VP1 △VP219-48 RNA was added to 100 μL DMEM and mixed, 2 μL Lipo 2000 transfection reagent was added to 100 μL DMEM and mixed, and RNA and Lipo 2000 diluent were fully mixed after standing for 5 minutes, and the mixture was allowed to stand for 10 minutes. Finally, the Lipo2000 / RNA complex was evenly dripped into the cells. The cells were transferred to a 37°C 5% CO2 incubator for culture. After 48 hours, the cells were observed for cytopathic effects (CPE). The cells and their culture supernatant were placed in a -80°C refrigerator, frozen and thawed once, and then inoculated into new cells to continue observing the CPE. If the recombinant virus (named rHBDL2 QD2 VP1) was successfully rescued △VP219-48 ), the virus solution was negatively stained and observed under electron microscopy, and HBDL2 virus solution was used as a positive control.

[0135] Results: rHBDL2 QD2 VP1 △VP219-48 RNA was transfected into F81-VP2 cells for 48 hours, and then the cells were frozen and thawed once at -80°C, and centrifuged at 1500 rpm for 1 min to harvest the supernatant rHBDL2 QD2 VP1 △VP219-48 In the P0 generation, F81-VP2 cells were inoculated for 24 hours and obvious CPE appeared. The cells were frozen and thawed three times at -80°C and centrifuged at 1500 rpm for 1 min to harvest the supernatant rHBDL2 QD2 VP1 △VP219-48In the P1 generation, obvious CPE appeared in F81-VP2 cells 24 hours after inoculation. △VP219-48 After negative staining, electron microscopy was performed. The results showed that the recombinant virus rHBDL2 QD2 VP1 △VP219-48 There is no difference in virus particle morphology between VS-FCVHBDL2 and wild strain VS-FCVHBDL2, see Fig.14 , indicating that the recombinant virus rHBDL2 QD2 VP1 △VP219-48 Rescue success. rHBDL2 QD2 VP1 △VP219-48 The genome sequence is shown in SEQ ID NO: 15 in the sequence listing.

[0136] Example 7 Recombinant virus rHBDL2 QD2 VP1 △VP219-48 Growth kinetics assay

[0137] F81-VP2 cells were plated in 24-well plates and when the cell density reached 90% (about 2×10 5 cells / well) infected with recombinant virus rHBDL2 QD2 VP1 △VP219-48 (0.001MOI), three replicates were set for each group, the virus was adsorbed for 1 hour, the supernatant culture medium was discarded, and fresh DMEM medium containing (1% FBS) was added. The supernatant virus liquid was harvested at 12h, 24h, 36h, 48h, 60h and 72h after infection, and the titer of the virus liquid harvested at different time points was determined (TCID 50 ), and the determination was repeated three times at each time point. The TCID 50 The logarithmic value is used as the vertical axis and the infection time is used as the horizontal axis to make a virus growth curve.

[0138] TCID 50 Assay steps: The harvested virus solution was diluted 10-fold with serum-free DMEM medium to 11 dilutions (10 1 ~10 11 ) Inoculate F81-VP2 cells at a density of about 80% in a 96-well plate. Set up 5 replicate wells for each dilution, 100 μL in each well, and set up 8 wells inoculated with serum-free DMEM medium as a control, 100 μL in each well. The virus was adsorbed at 37°C for 1 hour, the virus dilution was discarded, and 200 μL of fresh DMEM medium containing (1% FBS) was added to each well. The cells were cultured at 37°C for 48 hours, and the CPE was observed. The recombinant virus rHBDL2 QD2 VP1 was calculated according to the Reed-Muench method. △VP219-48 TCID 50 .

[0139] Results: rHBDL2 QD2 VP1 △VP219-48F81-VP2 cells were infected with an MOI of 0.001, and the virus fluid was collected at 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h, and the virus TCID 50 The growth curve was drawn. The results showed that compared with VS-FCVHBDL2, rHBDL2 QD2 VP1 △VP219-48 The replication capacity is slightly reduced, and the virus titer can reach 10 8.83 TCID 50 / mL.

[0140] Example 8 Recombinant virus rHBDL2 QD2 VP1 △VP219-48 and rHBDL2 △VP219-48 Evaluation of neutralizing antibody levels after immunization

[0141] Two immunization groups were set up, with 3 Chinese rural cats in each group. The immunization groups were rHBDL2 QD2 VP1 △VP219-48 (10 6 TCID 50 / mL) and rHBDL2 △VP219-48 (10 6 TCID 50 / mL) co-immunized group and rHBDL2 QD2VP1 △VP219-48 (10 6 TCID 50 / mL) immunization group, the immunization method was intramuscular injection, the immunization volume was 1mL / cat, 21 days after the first immunization, the second immunization was carried out, and blood was collected from cats 21 days after each immunization to separate the serum and the previous rHBDL2 △VP219-48 Neutralization test was performed on the high-immune serum to detect the neutralizing antibody level. Neutralization test steps: The separated serum samples were placed at 56°C for 30 minutes for heat inactivation, and the treated cat serum was diluted 2-fold (2 1 ~2 12 ), take 2 3 ~2 12 A total of 10 serum dilutions were mixed with wild-type strains (200 TCID 50 / 100μL) were mixed in equal volumes, and after neutralizing the virus at 37°C for 1h, the cat serum dilution / virus was inoculated into a 96-well plate at a culture density of 80% normal F81 cells at 100μL per well. Four replicate wells were set for each dilution, and the virus was adsorbed at 37°C for 1h. The culture supernatant was discarded, and the cells were washed twice with PBS. Fresh DMEM medium (1% FBS) was added to each well, and CPE was observed after 37°C for 48h. If CPE appeared in one or more wells of the four replicate wells, it was determined that the virus could not be completely neutralized at this serum dilution. If CPE did not appear in all four replicate wells, it was determined that the serum dilution had the ability to completely neutralize the virus.

[0142] Results: Compared with single strain immunization, rHBDL2 QD2 VP1 △VP219-48 and rHBDL2 △VP219-48 The serum cross-neutralization reaction between the co-immunized sera and other strains was significantly increased. For some strains, such as HBJB, LF-1, VS FCV GZ-1, co-immunization significantly increased the efficacy of neutralizing antibodies in the sera of immunized animals against these strains (Table 6). In summary, co-immunization with these two replication-deficient viruses can induce a broad serum cross-neutralization spectrum and is expected to be used as a multivalent vaccine strategy to prevent FCV infection.

[0143] Table 6 Serum neutralizing antibody titers of different FCV isolates.

[0144]

[0145] 1: VS-FCV strain; 2: Respiratory symptom strain; 3: Attenuated vaccine strain; 4: Inactivated vaccine strong strain

Claims

1. A single-cycle replication-deficient recombinant feline calicivirus (FCV), characterized in that: The single-cycle replication-deficient recombinant feline calicivirus is obtained by deleting the VP2 gene of the feline calicivirus VS-FCV HBDL2 strain, wherein the feline calicivirus VS-FCV HBDL2 strain is deposited in the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration, the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, the deposit number is CGMCC No.46180, and the deposit date is September 11, 2024.

2. The single-cycle replication-deficient recombinant feline calicivirus according to claim 1, characterized in that The replication-deficient recombinant feline calicivirus is a single-cycle gene-deleted replication-deficient FCV attenuated strain obtained by deleting the nucleotide sequence between 19nt and 48nt of the VP2 gene of the feline calicivirus VS-FCV HBDL2 strain.

3. The single-cycle replication-deficient recombinant feline calicivirus according to claim 1, characterized in that The genome sequence of the single-cycle replication-deficient recombinant feline calicivirus is shown in SEQ ID NO.

2.

4. A method for constructing the single-cycle replication-deficient recombinant feline calicivirus according to any one of claims 1 to 3, characterized in that The following steps are involved: Step 1: PCR amplification was performed using VS-FCV HBDL2 strain genomic DNA as a template and HBDL2-1 / F / R, HBDL2-2 / F / R, and HBDL2-3 / F / R as primers, and pOK-12 vector as a template and pOK12-1 / F / R as primers, and then the amplified products were connected to prepare the recombinant plasmid pOK-HBDL2; wherein the primers used for PCR amplification are as follows: HBDL2-1 / F:ACCTAATACGACTCACTATAGTAAAAGAAATTTGAGACAA HBDL2-1 / R:TGTTGATTGGCGGGTAGTTCATCC HBDL2-2 / F:GAACTACCCGCCAATCAACATGTGG HBDL2-2 / R:AACTTCGAACACATCACAGTGGAGG HBDL2-3 / F:ACTGTGATGTGTTCGAAGTTTGAGC HBDL2-3 / R: GCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCTGGGGTTAGGCGCAGGTGCGGC pOK12-1 / F: CCTCGCGGTCCGACCTGGGCATCCGAAGGAGGACGCACGTCCACTCGGATGGCTAAGGGAGGGCGctcgagGcggccgctctagaactagtggatcgatcccca pOK12-1 / R: CTATAGTGAGTCGTATTAGGTACCTtcgaggcctcggactagtggcgtaatc; Step 2: Using the pOK-HBDL2 recombinant plasmid as a template, HBDL2-1 / F / R, HBDL2-2 / F / R, HBDL2-3 / F / HBDL2-4 / F, HBDL2-5 / F / pOK12-1 / R as primers for PCR amplification, and connecting the amplified products to prepare the recombinant plasmid pOK-HBDL2 △VP219-48 , the VP2 gene 19nt-48nt is deleted in the recombinant plasmid; wherein, the primers used for PCR amplification are as follows: HBDL2-1 / F:ACCTAATACGACTCACTATAGTAAAAGAAATTTGAGACAA HBDL2-1 / R:TGTTGATTGGCGGGTAGTTCATCC HBDL2-2 / F:GAACTACCCGCCAATCAACATGTGG HBDL2-2 / R:AACTTCGAACACATCACAGTGGAGG HBDL2-3 / F:ACTGTGATGTGTTCGAAGTTTGAGC HBDL2-4 / R:ACCTAATATTGAGTTCATAATTTAGTCATA HBDL2-5 / F: TTATGAACTCAATATTAGGTAAAGCTCAACAAATTGAATTGGACAAAGCT pOK12-1 / R: CTATAGTGAGTCGTATTAGGTACCTtcgaggcctcggactagtggcgtaatc; Step 3: Use the lentiviral packaging three-plasmid system to construct the F81-VP2 cell line for expressing the VP2 gene of the HBDL2 strain; Step 4: pOK-HBDL2 △VP219-48 The recombinant plasmid was linearized by restriction enzyme digestion and HBDL2 was obtained by in vitro transcription. △VP219-48 RNA was transfected into F81-VP2 cell line to rescue the recombinant virus rHBDL2 △VP219-48 ; Preferably, the specific method for constructing the F81-VP2 cell line using the lentiviral packaging three-plasmid system in step 3 is: The three plasmids pLVX-VP2-IRES-ZsGreen1, pMD2G and pSPAX2 are diluted with DMEM culture medium to obtain a plasmid dilution solution; a transfection reagent is mixed with the plasmid dilution solution to obtain a plasmid / transfection reagent complex, the plasmid / transfection reagent complex is evenly dropped into 293T cells, cultured, the culture medium supernatant is collected, the culture medium supernatant is used to infect F81 cells, and the F81 cells are flow sorted to obtain an F81-VP2 cell line; the cell density of the F81 cells is 48% to 52%; the goal of the flow sorting is to sort cells whose green fluorescence positive rate reaches more than 95% twice in a row; Preferably, the transfection procedure in step 4 is as follows: HBDL2 △VP219-48 The RNA diluent and the Lipo 2000 diluent were mixed evenly to obtain the Lipo2000 / RNA complex. The complex was allowed to stand and the Lipo2000 / RNA complex was evenly dropped into F81-VP2 cells for cultivation. When CPE appeared in the cells, the replication-deficient recombinant virus was harvested.

5. The method according to claim 4, characterized in that The pLVX-VP2-IRES-ZsGreen1 plasmid is constructed by inserting the VP2 gene into pLVX-IRES-ZsGreen1, wherein the sequence of the VP2 gene is shown as SEQ ID NO: 1 in the sequence table.

6. The use of the single-cycle replication-deficient recombinant feline calicivirus according to any one of claims 1 to 3 in the preparation of a drug for preventing feline calicivirus infection, wherein the feline calicivirus is a highly pathogenic feline calicivirus, and wherein the drug is a vaccine.

7. A single-cycle replication-deficient recombinant feline calicivirus expressing the VP1 gene of FCV QD2 strain, characterized in that: The recombinant feline calicivirus is obtained by replacing the VP1 gene of the single-cycle replication-deficient recombinant feline calicivirus according to claim 1 with the VP1 gene of the FCV QD2 strain. Preferably, the genome sequence of the recombinant feline calicivirus is shown in SEQ ID NO.

15.

8. A method for obtaining the single-cycle replication-deficient recombinant feline calicivirus expressing the FCV QD2 strain VP1 gene according to claim 7, characterized in that: The following steps are involved: (1) Preparation of pOK-rHBDL2 QD2 VP1 △VP219-48 Recombinant plasmid Using FCV QD2 strain genomic DNA as a template and QD2-1 / F / R as primers, and using pOK-rHBDL2 prepared in claim 4 △VP219-48 As template, PCR amplification was performed with HBDL2-1 / F / R, HBDL2-2 / F / R, and HBDL2-5 / F / pOK12-1 / R as primers. Four DNA fragments were obtained by agarose gel electrophoresis, gel excision, recovery, and purification. There were 20 bp homology arms before and after the fragments. The DNA fragments were connected and transformed into competent JM109 to obtain positive clones. The recombinant plasmid was extracted using a plasmid extraction kit for sequencing. The recombinant plasmid with correct sequencing was named pOK-rHBDL2 QD2 VP1 △VP219-48 ; HBDL2-1 / F:ACCTAATACGACTCACTATAGTAAAAGAAATTTGAGACAA HBDL2-1 / R:TGTTGATTGGCGGGTAGTTCATCC HBDL2-2 / F:GAACTACCCGCCAATCAACATGTGG HBDL2-2 / R:AACTTCGAACACATCACAGTGGAGG QD2-1 / F:ACTGTGATGTGTTCGAAGTTTGAGCATGTGCTCAACCTGCGCTAACGTGC QD2-1 / R:ACCTAATATTGAGTTCATAATTTAGTCATTCCACTCCTAATGTTAGAGGC HBDL2-5 / F:TTATGAACTCAATATTAGGTAAAGCTCAACAAATTGAATTGGACAAAGCT pOK12-1 / R:CTATAGTGAGTCGTATTAGGTACCTtcgaggcctcggactagtggcgtaatc (2) Rescue of recombinant virus rHBDL2 QD2 VP1 △VP219-48 pOK-rHBDL2 QD2 VP1 △VP219-48 The recombinant plasmid was linearized by XhoI digestion, and the product was purified by product purification kit. In vitro transcription reaction was performed according to the instructions of the in vitro transcription kit, and Ribo m7G Cap Analog was added to obtain rHBDL2 QD2 VP1. △VP219-48 RNA was then transfected into the F81-VP2 cell line described in claim 4. The cells were transferred to a 37°C 5% CO2 incubator for culture, and the cells were observed for cytopathic effects (CPE) after 48 hours. The cells and their culture supernatant were placed in a -80°C refrigerator and frozen and thawed once, and then inoculated into new cells. The CPE was further observed, and the recombinant virus that was successfully rescued was named rHBDL2 QD2 VP1 △VP219-48 .

9. Use of a single-cycle replication-deficient recombinant feline calicivirus expressing the VP1 gene of the FCV QD2 strain in the preparation of a drug for preventing feline calicivirus infection, preferably, the drug is a vaccine.

10. A vaccine composition for preventing feline calicivirus infection, characterized in that: The vaccine composition contains the single-cycle replication-deficient recombinant feline calicivirus expressing the FCV QD2 strain VP1 gene according to claim 7 and the single-cycle replication-deficient recombinant feline calicivirus according to any one of claims 1-3.

Images