Alkene reductase mutant and application thereof in preparation of brivaracetam intermediate

Abstract

The invention discloses an alkene reductase mutant and application thereof in preparation of a brivaracetam intermediate, and belongs to the field of bioengineering. According to the present invention, wild type alkene reductase NnER represented by SEQ ID NO.1 is adopted as a template, and mutation is respectively performed on the 57th alanine, the 67th tryptophan and the 271th phenylalanine so as to obtain a variety of alkene reductase mutants such as A57G, W67K, W67H and F271Y; according to the alkene reductase mutant provided by the invention, the stereoselectivity and catalytic activity of catalyzing 4-propylfuran-2 (5H)-ketone to generate a brivaracetam intermediate (R)-4-propyldihydrofuran-2 (3H)-ketone are enhanced, and the brivaracetam intermediate can be synthesized at higher efficiency under a mild condition; the invention provides an effective and sustainable method for biocatalytically synthesizing the brivaracetam intermediate, and the method has important industrial application potential.

Description

Technical Field

[0001] The invention belongs to the technical field of biocatalysis, and more specifically relates to an alkene reductase mutant and its encoding gene, genetic engineering bacteria and application in the preparation of (R)-4-propyldihydrofuran-2(3H)-one (R-PDFO). Background Art

[0002] Ene reductase (ER, EC1.6.99.1) is mainly composed of the old yellow enzyme (OYEs) family containing flavin mononucleotide (FMN). It belongs to the oxidoreductase class and can catalyze the asymmetric reduction of α, β-unsaturated ketones, aldehydes, nitroolefins, carboxylic acids and their derivatives. The products can be used as chiral components of many drugs, such as pregabalin, baclofen and L-menthol. Due to its broad-spectrum substrate, photoexcitation reactivity and excellent characteristics of generating two chiral centers at one time, it has been widely used in the asymmetric synthesis of chiral intermediates and has high application value in the synthesis of chiral compounds.

[0003] Brivaracetam is a new type of anti-epileptic drug, and its structure is similar to the second-generation anti-epileptic drug levetiracetam. The anti-epileptic effect of Brivaracetam is mainly achieved by binding to synaptic vesicle protein 2A (SV2A), and is also related to the inhibitory effect on specific sodium ion channels in neurons. In terms of drug treatment, it has the advantages of fast absorption, high bioavailability and less drug interactions. The synthesis of Brivaracetam involves the introduction of chiral centers, which is the key point and difficulty of the entire process. Many of the developed Brivaracetam synthesis routes have problems such as high cost, complex process, low yield, and difficulty in product separation, which greatly hinder large-scale production. Therefore, it is of great significance to design a simple and efficient synthesis route for Brivaracetam.

[0004] (R)-4-propyl-dihydrofuran-2-one (R-PDFO) is a key chiral intermediate in the synthesis of the anti-epileptic drug brivaracetam, with a relative molecular mass of 128.17. Several synthetic routes to obtain this chiral intermediate have been developed, including using propylmalonate as the starting material, and obtaining the compound (R)-4-propyldihydrofuran-2(3H)-one through substitution, decarboxylation, reduction, cyclization and other reactions; starting from succinic anhydride, first reacting with a chiral chelating agent, then reacting with propionaldehyde to introduce an R-configuration propyl group through an Evans Aldol reaction, and then removing the hydroxyl group through a Barton-McCombie deoxygenation reaction, and finally obtaining the target intermediate through carboxyl reduction and lactonization; using glyoxylic acid and n-valeraldehyde as raw materials, a series of reactions were performed to obtain the intermediate 4-propylfuran-2(5H)-one. Then, hydrogen is used as a reducing agent and palladium / carbon is used as a catalyst to catalytically reduce the C=C double bond to obtain a racemate, and the racemate is then chirally resolved by (1R,2S)-2-amino-1,2-diphenylethanol to obtain (R)-4-propyldihydrofuran-2(3H)-one. The chemical substance polymethyl-hydrogen siloxane (PMHS) is used as a reducing agent to achieve enantioselective reduction of 4-propylfuran-2(5H)-one under the chiral catalysis of Cu(I).

[0005] Compared with other methods, enzymatic catalysis is the greenest and most efficient route for the synthesis of (R)-4-propyl-dihydrofuran-2-one (R-PDFO). Recombinant ene reductase, coenzyme and coenzyme regeneration system are used to catalyze the chiral reduction of the substrate 4-propylfuran-2(5H)-one to the key intermediate of buvacetam. This method has the advantages of mild reaction conditions, high efficiency, simple operation, no need for chiral separation, high yield and low cost. However, the ene reductases discovered so far have problems such as low catalytic activity and low enantiomeric selectivity in the asymmetric catalytic synthesis of R-PDFO. Summary of the invention

[0006] The purpose of the present invention is to provide an alkene reductase mutant, an encoding gene, a recombinant plasmid, a recombinant genetically engineered bacterium and the use thereof in the preparation of a brivaracetam intermediate, thereby solving the problem that the existing alkene reductase has low catalytic activity and corresponding selectivity during the application process, resulting in low yield of the brivaracetam intermediate and difficulty in industrial production.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] According to a first aspect of the present invention, there is provided an ene reductase mutant for catalyzing 4-propylfuran-2(5H)-one to generate a brivaracetam intermediate (R)-4-propyldihydrofuran-2(3H)-one, comprising an ene reductase mutant formed by using the wild-type ene reductase shown in SEQ ID NO.1 as a template, and the following mutations occur at alanine at position 57, tryptophan at position 67, and phenylalanine at position 271: a mutant A57G formed by a mutation of alanine A at position 57 to glycine G, with an amino acid sequence as shown in SEQ ID NO.3; a mutant W67K formed by a mutation of tryptophan W at position 67 to lysine K, with an amino acid sequence as shown in SEQ ID NO.4; a mutant W67H formed by a mutation of tryptophan W at position 67 to histidine H, with an amino acid sequence as shown in SEQ ID NO.5; a mutant F271Y formed by a mutation of phenylalanine F at position 271 to tyrosine Y, with an amino acid sequence as shown in SEQ ID NO.6.

[0009] According to the present invention, the wild-type olefin reductase is derived from Novosphingobium nitrogenifigens.

[0010] According to the second aspect of the present invention, a gene encoding the olefin reductase mutant is provided.

[0011] According to a third aspect of the present invention, a recombinant vector and a genetically engineered bacterium containing the coding gene of the olefin reductase mutant are provided. According to a preferred embodiment of the present invention, the host bacterium can be E. coli BL21 (DE3).

[0012] According to the fourth aspect of the present invention, a method for preparing an ene reductase mutant is provided, comprising the following steps: 1) culturing the recombinant genetically engineered bacteria and inducing the expression of the ene reductase mutant; 2) isolating the ene reductase mutant from the culture obtained in step 1).

[0013] According to the fifth aspect of the present invention, there is provided a use of the olefin reductase mutant in catalyzing the substrate 4-propylfuran-2(5H)-one to generate (R)-4-propyldihydrofuran-2(3H)-one.

[0014] The present invention uses a laboratory bacterial resource library to mine and obtain multiple ERs, and through in vitro detection of enzyme activity, screens out an ene reductase NnER from the genus Novosphingobium nitrogenifigens, which has the highest enzyme activity, catalytic efficiency and enantiomeric selectivity for the substrate 4-propylfuran-2(5H)-one. So far, there has been no report on the mutation of the ene reductase from the genus Novosphingobium nitrogenifigens.

[0015] Preferably, the present invention uses a coenzyme recycling system to couple with the olefin reductase mutants A57G, W67K, W67H, and F271Y to catalyze the reaction of PFO to generate R-PDFO. Among them, glucose dehydrogenase (BsGDH) derived from Bacillus subtilis is used to realize the circulation of the coenzyme NADPH to save costs.

[0016] In the application: the olefin reductase mutant and glucose dehydrogenase are cultured in LB medium until OD 600 =0.6-0.8, add IPTG to induce expression, obtain wet bacteria, freeze-dry and then obtain dry bacteria powder, use PFO as substrate, and use flavin mononucleotide FMN and NADP + The reaction system is composed of a cofactor, glucose as a co-substrate, and a 100 mM PBS buffer solution with a pH of 6-8 as a reaction medium. The reaction is shaken in a shaker at 25-35°C and a rotation speed of 180-220 rpm for 18-24 hours. After the reaction is complete, the reaction solution is extracted with ethyl acetate containing an internal standard (o-xylene), and then dried with anhydrous sodium sulfate and detected by gas chromatography.

[0017] The key invention of the present invention is to obtain an olefin reductase NnER from the genus Novosphingobium nitrogenifigens from the laboratory bacterial resource library, and to achieve heterologous expression of the olefin reductase NnER through a series of molecular cloning methods. By semi-rational design of the wild-type NnER, the olefin reductase NnER was synthesized at a distance from the substrate. Five residues were selected from the range, including: A57, F271, G28, H130, W67, and these residues were regarded as "hot spots" for mutation, and then saturation mutation was performed on these five residues. The present invention also constructed a dual enzyme cascade reaction system, cascading the olefin reductase mutant and glucose dehydrogenase, realizing the cyclic regeneration of NADPH, and greatly reducing the cost. Subsequently, PFO was used as a substrate to determine the catalytic generation of R-PDFO by all mutants, wherein the R-PDFO yield and ee value of the forward mutants W67K, W67H, A57G, and F271Y at 8 mM substrate concentration for 24 h were increased from the wild type (15.5%, 82.7%) to W67K (17.8%, 95.7%), W67H (31.44%, 96.9%), A57G (15.5%, 93.1%), and F271Y (30.28%, 95.7%), respectively. The ee values ​​of the above four forward mutation points were all improved, and the next transformation plan can be carried out. Among them, the mutant W67H has the highest R-PDFO yield and ee value, and is the optimal mutant obtained by the present invention.

[0018] In summary, the present invention transforms the olefin reductase NnER through semi-rational design, obtains a variety of olefin reductase mutants, encoding genes, recombinant plasmids, and recombinant genetically engineered bacteria with improved catalytic efficiency and ee value, and also constructs a dual-enzyme cascade reaction system, which can more efficiently synthesize the brivaracetam intermediate R-PDFO under mild conditions, overcomes the low yield and low enantiomeric selectivity of the wild-type olefin reductase NnER for PFO, and has a wider application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 A schematic diagram showing the reaction principle of olefin reductase mutants catalyzing 4-propylfuran-2(5H)-one to generate the brivaracetam intermediate (R)-4-propyldihydrofuran-2(3H)-one;

[0020] Figure 2 Molecular docking results are shown;

[0021] Figure 3 The detection diagram of substrate PFO and product R-PDFO is shown;

[0022] Figure 4 The stereoselective detection of the product R-PDFO is shown;

[0023] Figure 5 A standard curve of the concentration of the product R-PDFO is shown. DETAILED DESCRIPTION

[0024] The present invention will be further described below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional operations in the art, or according to the experimental methods recommended by the kit and instrument manufacturers.

[0025] The formula of LB liquid culture medium is as follows: take 1L of deionized water, weigh 5g of yeast extract, 10g of peptone, and 10g of sodium chloride, stir evenly on a magnetic stirrer, and adjust the pH value to natural. Use a measuring cylinder to measure 50mL and dispense it into a 250mL conical flask. Use a high-pressure steam sterilizer to sterilize the prepared culture medium at 121℃ for 20min.

[0026] LB solid medium: Use a measuring cylinder to measure 150 mL of LB liquid medium and dispense it into 250 mL Erlenmeyer flasks. Add 2.25 g of agarose to each flask and sterilize at 121°C for 20 min.

[0027] Example 1: Construction of genetically engineered bacteria

[0028] The NnER sequence from Novosphingobium nitrogenifigens DSM 19370 was cloned and inserted into the expression plasmid pET28a(+) to obtain pET28a(+)-NnER. The amino acid sequence of wild-type NnER is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2. After sequencing, the plasmid was transferred into the expression host Escherichia coli BL21(DE3) for subsequent expression of the recombinase.

[0029] Example 2: Bacteria culture

[0030] The correctly sequenced bacterial solution was inoculated into 5 mL LB liquid medium containing 50 μg / mL kanamycin resistance, and cultured in a shaker at 37°C and 200 rpm for 12 h. Then 500 μL of the bacterial solution was added to 50 mL LB liquid medium (containing kanamycin resistance) and cultured in a 37°C constant temperature shaker for 2.5 h until the OD 600 When the concentration reaches 0.6-0.8, add the inducer IPTG with a final concentration of 0.1mM, transfer to a shaker at 20℃ and 200rpm and continue to culture for 16-20h. After the culture is completed, transfer the culture solution to a 50mL centrifuge tube, balance it, centrifuge it at 4℃ and 8000rpm for 10min, discard the supernatant, add 15mL of physiological saline to wash the bacteria, centrifuge again to collect the bacteria, and then put it in a -40℃ refrigerator to freeze for more than 3h for freeze drying. After the bacteria are freeze-dried in a vacuum freeze dryer for 10h, take them out and grind them evenly to obtain freeze-dried bacterial powder.

[0031] Example 3: Selection of mutation sites

[0032] AlphaFold3 was used to predict the structure of the wild-type ene reductase, and Auto-Dock was used to perform molecular docking between the substrate PFO and the cofactor FMN and the binding site of the ene reductase. The molecular graphics were visualized and analyzed using PyMOL software. The results are shown in Figure 2. Figure 2 As shown in the figure. Based on the docking results, the key residues in the catalytic activity pocket of olefin reductase NnER were screened out: A57, F271, G28, H130, and W67. Subsequently, these five potential sites were subjected to saturation mutation to construct a mutant library.

[0033] Example 4: Construction of single-point mutants of olefin reductase

[0034] Escherichia coli containing the pET28a(+)-NnER recombinant plasmid was cultured overnight in LB liquid medium (containing kanamycin resistance), and the plasmid was extracted and used as a template for subsequent mutant construction. The primers used for mutation are shown in Table 1.

[0035] Table 1 Mutant primer information (SEQ ID NO.7-16) Primer name Primer sequence (5'→3') A57NNK-F CGGGATCCTTAAGCAGCATCCGTCCATCCTCTC A57NNK-R GGAATTCCATATGAGCATCGCCTTCACCCC F271NNK-F CGGGATCCATGCCGACTTTGTTCGATCCCAT F271NNK-R GGAATTCCTACGCCGCGCTGGGATA G28NNK-F CCCAAGCTTATGGGGGCCGTTTCCTGGT G28NNK-R CCGCTCGAGTCATGGGATTTGCGGACGAA H130NNK-F CCCAAGCTTGTGACGGGTCGACATTCGCT H130NNK-R GGAATTCCATATGTCATGGCCGTCTCCTTCTCTCCC W67NNK-F CCCAAGCTTTCAGTGCAGCCGTTCGCGA W67NNK-R GGAATTCCATATGTCGACCTGCCCTGACG

[0036] Table 2 PCR reaction system (20 μL)

[0037] Table 3 PCR reaction conditions

[0038] Steps (2) to (4) were set to 35 cycles.

[0039] After the PCR amplification was completed, the product was verified as positive by agarose gel electrophoresis, and then 0.5 μL of restriction endonuclease Dpn I was added and reacted in a 37°C metal bath for 2.5 h to achieve the purpose of specific excision of the methylated template DNA chain.

[0040] The digested PCR product was transferred to competent cells of Escherichia coli BL21 (DE3), ice-bathed for 30 minutes, heat-shocked at 42°C for 90 seconds, ice-bathed again for 2 minutes, added with 700 μL LB medium (without resistance), revived on a shaker at 37°C for 45 minutes, and the bacterial solution was spread on an LB plate containing kanamycin resistance (Kan, 50 μg / mL), and cultured overnight at 37°C. A single colony was picked and inoculated into LB liquid culture medium, and sequenced after 5 hours. A portion of the bacterial solution with correct sequencing was inoculated into a seed tube and stored in a -40°C refrigerator, and the other portion was cultured to prepare freeze-dried bacterial powder of various mutants. The specific operation can be seen in Example 2.

[0041] Example 5: Mutant enzyme activity assay

[0042] The lyophilized bacterial powder of olefin reductase prepared in Example 4 was used as a catalyst to carry out a conversion reaction of the substrate PFO to screen out mutants with improved yield.

[0043] 1mL reaction system composition: 100μL substrate PFO (final concentration 8mM), 100μL glucose (final concentration 20mM), 100μL NADP + (final concentration 0.5 mM), 100 μL FMN (final concentration 0.1 mM), 20 mg freeze-dried bacterial powder, 20 mg GDH bacterial powder, 600 μL PB buffer (100 mM pH 7.0). After adding all components, mix thoroughly and make three parallel samples for each reaction.

[0044] The reaction was carried out in a shaker at 30°C and 250 rpm for 24 h. After the reaction was completed, 750 μL of ethyl acetate was added to terminate the reaction and extract, and the mixture was vortexed at high speed for 10 min, and then centrifuged in a high-speed centrifuge (14000 rpm, 10 min), and the upper organic phase was collected. The above steps were repeated once, and the organic phases were combined, placed in a fume hood and evaporated to dryness, and 1 mL of ethyl acetate (containing o-xylene) was added to redissolve, and the mixture was shaken vigorously for 5 min. Anhydrous sodium sulfate was added to remove water, and the mixture was centrifuged in a high-speed centrifuge (14000 rpm, 10 min). 200 μL of the supernatant was filtered through a 0.22 μm organic filter membrane and detected by gas chromatography.

[0045] The yield detection method is as follows: the yield of the product R-PDFO is detected by gas chromatography, using the internal standard method, selecting o-xylene as the internal standard, and the gas chromatography column used is an Agilent DB-1701 capillary column (30m×0.25mm×0.25μm); the analysis method is as follows: the injection port and detector temperature are both set to 250°C, the column box temperature is 80°C, and the carrier gas is N 2 , flow rate 1mL / min, split ratio 20:1, injection volume 1μL; temperature program 80℃ for 3min, then heated to 230℃ at a rate of 15℃ / min and kept for 2min. Under this analytical condition, the retention time of substrate PFO is 9.473min, the retention time of product R-PDFO is 8.350min, and the retention time of internal standard o-xylene is 2.943min. Figure 3 shown.

[0046] The stereoselectivity detection method of the product is as follows: the stereoselectivity of the product is detected by gas chromatography, and the internal standard method is adopted. O-xylene is selected as the internal standard. The gas chromatography column used is an Agilent Beta DEXTM 225 capillary column (30m×0.25mm×0.25μm); the analysis method is as follows: the injection port temperature is set to 220℃, the detector temperature is set to 250℃, the column box initial temperature is 40℃, and the carrier gas is N 2 , flow rate 0.5mL / min, split ratio 50:1, injection volume 1μL; temperature program is 40℃ for 1min, then increase to 170℃ at a rate of 15℃ / min and maintain for 1min, then increase to 180℃ at a rate of 1℃ / min and maintain for 1min. Figure 4 As shown, under the analytical conditions, the retention time of the product R-PDFO is 16.703 min, and the retention time of S-PDFO is 16.917 min. The ee value is calculated according to the following formula: ee value (%) = [(RS) / (R+S)] × 100%, where R and S represent the peak areas of the R-type and S-type of the product in the gas chromatogram, respectively.

[0047] The catalytic activity of the mutant expression system constructed above was evaluated by the conversion of the product R-PDFO. The content of R-PDFO was measured using a standard curve (e.g. Figure 5 Calculated as shown).

[0048] Using PFO as the substrate for the catalytic reaction, the constructed mutant library was screened and analyzed using the above method, and the mutants with higher R-PDFO production ability than the wild type were shown in Table 4. As can be seen from the table, the mutants with more improved yields or ee values ​​are W67K, W67H, A57G, and F271Y. Among them, the mutant W67H has the highest R-PDFO yield and ee value, and is the optimal mutant obtained by the present invention.

[0049] Table 4 Reaction yield and ee value of ene reductase NnER and mutants (three parallels were set for each experiment)

[0050] The above is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention. The above embodiments of the present invention can also be modified in various ways. All simple, equivalent changes and modifications made according to the claims and the description of the present invention fall within the scope of protection of the claims of the present invention. The contents not described in detail in the present invention are all conventional technical contents.

Claims

1. An ene reductase mutant for catalyzing 4-propylfuran-2(5H)-one (PFO) to generate brivaracetam intermediate (R)-4-propyldihydrofuran-2(3H)-one (R-PDFO), characterized in that: The olefin reductase mutant includes an olefin reductase mutant formed by using the wild-type olefin reductase shown in SEQ ID NO.1 as a template and causing the following mutations at the 57th alanine, the 67th tryptophan, and the 271st phenylalanine: The mutant A57G formed by the mutation of alanine A at position 57 to glycine G has an amino acid sequence as shown in SEQ ID NO.3; The mutant W67K formed by the mutation of tryptophan W at position 67 to lysine K has an amino acid sequence as shown in SEQ ID NO.4; The mutant W67H formed by the mutation of tryptophan W at position 67 to histidine H has an amino acid sequence as shown in SEQ ID NO.5; The mutant F271Y is formed by the mutation of phenylalanine F at position 271 to tyrosine Y, and the amino acid sequence is shown in SEQ ID NO.

6.

2. The olefin reductase mutant according to claim 1, characterized in that The wild-type olefin reductase is derived from Novosphingobium nitrogenifigens.

3. A gene encoding the olefin reductase mutant according to any one of claims 1 to 2.

4. A recombinant plasmid comprising a gene encoding the olefin reductase mutant according to claim 3.

5. A recombinant genetically engineered bacterium containing the recombinant plasmid according to claim 4.

6. The recombinant genetically engineered bacterium according to claim 5, characterized in that: The host cell is Escherichia coli BL21 (DE3).

7. A method for preparing an olefin reductase mutant, characterized in that: The following steps are involved: 1) culturing the recombinant genetically engineered bacteria according to claim 5, and inducing the expression of the olefin reductase mutant; 2) Isolating an olefin reductase mutant from the culture obtained in step 1).

8. Use of the olefin reductase mutant according to claim 1 in catalyzing the generation of (R)-4-propyldihydrofuran-2(3H)-one from 4-propylfuran-2(5H)-one.

Images