Rhamnosyl transferase for catalyzing biological synthesis of polyphyllin as well as coding gene and application of rhamnosyl transferase

Abstract

According to the application disclosed by the invention, the full length of the rhamnosyltransferase TtUGT39 gene in trillium tschonoskii is obtained by cloning through a polymerase chain reaction, a recombinant protein is successfully expressed in escherichia coli, and the condition that the rhamnosyltransferase TtUGT39 can catalyze extension of C-4 carbohydrate chains of polyphyllin III and pennogenin-3-O-beta-chectrioside is identified and confirmed for the first time; the polyphyllin II and the polyphyllin VII are generated, the invention also relates to a variant of the TtUGT39 enzyme, and the variant has good catalytic activity and extremely high economic value and application prospect.

Description

Technical Field

[0001] The present invention relates to the field of proteins and genetic engineering, and more specifically, to a glycosyltransferase and a gene encoding the enzyme, wherein the glycosyltransferase can catalyze the biosynthesis of Paris polyphylla saponins in vitro. Background Art

[0002] Paris polyphylla saponin is a steroidal saponin with a cyclopentane polyhydrophenanthrene structure as the structural mother nucleus, mainly including isospirostane-type diosgenin and pentosan-type saponin. Studies have shown that Paris polyphylla saponin not only has resistance to tumors and myocardial ischemia, but also has good effects in anti-oxidation, antibacterial and anti-inflammatory, sedative and analgesic, hemostatic, immune regulation and organ protection, so it has extremely high medicinal value.

[0003] Based on the theory of medicinal plant phylogeny, the closely related Paris and Trillium plants both contain Paris saponins. Paris plants are mainly distributed in Yunnan, Guizhou and other southwestern provinces. According to research, it can produce a variety of effects, such as clearing away heat and detoxification, dispersing stagnation and swelling, cooling the liver and calming the nerves, etc., and is often used to relieve diseases such as sore throat and snake bites. Among them, Paris saponins I, II, III and other monomer components have good in vitro anti-tumor activity, and the hemostatic activity of diosgenin saponins such as Paris saponins H, VI, VII and other monomers is stronger than the corresponding Dioscorea saponins. Modern pharmacological studies have shown that they play an important role in inhibiting cancer cell growth and metastasis, regulating cell apoptosis, etc. Paris plants are mainly distributed in Sichuan, Yunnan, Guizhou and other places, and have a long history of medicinal use. They are often used by the people to treat uterine bleeding, promoting blood circulation and removing blood stasis. There are three main types of steroidal sapogenins in Trillium plants: diosgenin, pyranosapogenin and furostanol sapogenins, which are the same as the main sapogenins in Paris plants. The content of saponin compounds in plants is not high, and the separation of monomer compounds is difficult, and it is difficult to achieve large-scale production, which cannot meet the market demand. In addition, the structure of Paris saponins is complex and chemical synthesis is difficult to achieve, which seriously restricts the development and application of this type of natural product.

[0004] Glycosylation modification plays a key role in the structural diversity of Paris saponins, and this process relies on the catalysis of glycosyltransferases. Glycosyltransferases are widely present in animals, plants and microorganisms, and can catalyze the transfer of sugar groups from donor molecules to acceptor molecules to form various glycoside compounds, which play an important role in their biological activity, solubility, stability and secondary metabolite diversity. The formation of Paris saponins requires a variety of glycosyltransferases that can specifically recognize different aglycones, glycosyl groups and glycosylation positions. At present, only 3-O-β-glucosyltransferase and 2'-O rhamnosyltransferase of diosgenin and diosgenin have been found, while the key rhamnosyltransferases that catalyze other key active ingredients Paris saponin III, diosgenin-3-O-β-chacotrisaccharide, Paris saponin V, and Paris saponin VI have not been discovered. Therefore, the identification of glycosyltransferases related to the downstream pathway of the biosynthesis of Paris saponins is of great significance for the exploration of the biosynthetic pathway of Paris saponins and the realization of heterologous synthesis of Paris saponins. Summary of the invention

[0005] The object of the present invention is to provide a rhamnosyltransferase (hereinafter referred to as TtUGT39), which includes the amino acid sequence shown in SEQ ID NO: 1, or a mutant in which at least one amino acid of the amino acid sequence shown in SEQ ID NO: 1 is substituted, deleted or inserted but the activity of the protein is maintained, and has the biological function of catalyzing the extension of the sugar chain of Paris saponins, and can catalyze Paris saponin III to produce Paris saponin II, and catalyze the production of Paris saponin VII from parosaponin-3-O-β-chacotrisaccharide.

[0006] In a specific embodiment of the present invention, the mutant is selected from at least one of the following sites in the amino acid sequence shown in SEQ ID NO: 1: A158T, S377V, T370A, S376A, G23A, P355A, H22A, F100A, Y152A, F154A, H104A, Y421, I91A, R203A, N296A or a combination thereof, and these mutants have at least a certain biological function of catalyzing the extension of the sugar chain of Paris saponins, and can catalyze Paris saponin III to produce Paris saponin II, and catalyze the production of Paris saponin VII from parosaponin-3-O-β-chacotrisaccharide.

[0007] In a preferred embodiment of the present invention, the mutant is an A158T mutant or a S377V mutant.

[0008] The present invention also provides a polynucleotide encoding the enzyme TtUGT39 of the present invention (or coding gene, hereinafter referred to as TtUGT39). A representative example is that the polynucleotide sequence is shown in SEQ ID NO: 2.

[0009] The present invention also provides an expression vector comprising the polynucleotide of the present invention. The expression vector may be selected from, for example, pET series expression vectors and pEASY series expression vectors.

[0010] In the present invention, various vectors known in the art, such as commercially available vectors, including plasmids, cosmids, etc., can be selected. When producing the rhamnosyltransferase TtUGT39 of the present invention, the nucleotide sequence of the rhamnosyltransferase TtUGT39 encoding gene can be operably linked to the expression control sequence to form an expression vector for synthesizing Paris saponin II and / or Paris saponin VII. The "operably linked" when referring to DNA segments means that these segments are arranged in a certain way so that they can coordinately play their intended purpose, such as starting transcription in the promoter and moving forward through the coding segment to the terminator. It also refers to a situation where certain parts of a linear DNA sequence can affect the activity of other parts of the same linear DNA sequence. For example, if the signal peptide DNA is expressed as a prerequisite and participates in the secretion of the polypeptide, then the signal peptide (secretion leader sequence) DNA is operably linked to the polypeptide DNA; if the promoter controls the transcription of the sequence, then it is operably linked to the coding sequence; if the ribosome binding site is placed in a position that enables its translation, then it is operably linked to the coding sequence. Generally, "operably linked" means contiguous, and, with respect to a secretory leader, means contiguous and in reading frame.

[0011] In a fourth aspect, the present invention provides a recombinant host bacteria comprising the polynucleotide described in the second aspect of the present invention or the expression vector described in the third aspect of the present invention, wherein the host bacteria is Escherichia coli, such as DE3 Escherichia coli.

[0012] The host bacteria of the present invention comprises a polynucleotide molecule encoding the rhamnosyltransferase TtUGT39 of the present invention, or a nucleotide molecule that can hybridize with the polynucleotide molecule under stringent conditions, or comprises the expression vector described above of the present invention. The host cell is selected from bacteria, prokaryotic cells (such as Escherichia coli), fungal cells, yeast cells, insect cells, mammalian cells or plant cells, preferably Escherichia coli.

[0013] According to ordinary methods, in a culture medium containing nutrients and other necessary components for the growth of selected host cells, the transformed or transfected host cell is cultivated. A variety of suitable culture mediums, including known component culture mediums and complex culture mediums, are known in the art and generally include carbon sources, nitrogen sources, essential amino acids, vitamins and minerals. If necessary, the culture medium can also contain components such as growth factors or serum. Growth medium generally selects cells containing exogenous interpolation DNA by, for example, drug screening or lacking the necessary nutrients that can be carried by expression vectors or cotransfected into the selection markers in the host cell. By conventional means, sufficient air is provided to liquid cultures as a shaking triangular flask or a fermentation tank jet.

[0014] In the present invention, the full-length polynucleotide sequence encoding the rhamnosyltransferase TtUGT39 or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified each time in the correct order. Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombination. This is usually done by cloning it into a vector, then transferring it into a cell, and then isolating the relevant sequence from the host cell after proliferation by conventional methods. In addition, mutants can also be introduced into the protein sequence of the present invention by chemical synthesis. In addition to recombinant production, fragments of the protein of the invention can also be produced by direct peptide synthesis using solid phase technology (Stewart et al., Solid-Phase Pedtide Synthesis, J. Am. Chem. Soc. 85:2149-2154, 1963). In vitro protein synthesis can be performed manually or automatically. For example, the peptide can be automatically synthesized using the Applied Biosystems 431A Peptide Synthesizer (Foster City, CA). The fragments of the protein of the invention can be chemically synthesized separately and then chemically linked to produce the full-length molecule.

[0015] The present invention constructs an expression vector with the cloned TtUGT39 gene, integrates it into Escherichia coli using synthetic biology technology, and catalytic experiments confirm that it has the biological function of catalyzing paridis saponin III to produce paridis saponin II, and catalyzing sapogenin-3-O-β-chacotrisaccharide to produce paridis saponin VII.

[0016] Therefore, in another aspect, the present invention provides rhamnosyltransferase TtUGT39, or rhamnosyltransferase TtUGT39 encoding gene TtUGT39, or an expression vector comprising the encoding gene TtUGT39, and a host bacteria comprising the expression vector, for use in regulating and / or synthesizing Paris saponin II and / or Paris saponin VII.

[0017] The Paris polyphylla saponin II and / or VII of the present invention can be prepared in the following manner, i.e., by adopting a biosynthetic method, the method comprising: introducing the coding gene TtUGT39 of rhamnosyltransferase TtUGT39 into Escherichia coli to obtain recombinant Escherichia coli, fermenting the recombinant bacteria, adding the reaction substrate to the fermentation broth, and reacting to obtain Paris polyphylla saponin II and / or VII.

[0018] The invention has important theoretical and practical significance for cultivating high-quality medicinal plant varieties, especially cultivating Paris polyphylla varieties with high yield of Paris polyphylla saponin II and / or VII. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention.

[0020] Figure 1 is the agarose gel electrophoresis diagram of the ORF amplification product of TtUGT39, where the marker is PlusⅡDNA Marker, lane 2 is the target band (1488bp).

[0021] Figure 2 This is the gel image of pET28a-TtUGT39 recombinant protein, where the marker is Blue ⅡProtein Marker (14-120kDa), lane 2 is TtUGT39 protein, and lane 3 is pET28a empty protein.

[0022] Figure 3The LC-MS results of the enzymatic reaction products of Parisopsenoside III and Pseudocosapentaenoside-3-O-β-chacotrisaccharide catalyzed by rhamnosyltransferase TtUGT39, A. Enzymatic reaction LC / MS TIC spectrum (a. TtUGT39 catalyzes the enzymatic reaction of Paris saponin III, where TtUGT39 is the enzymatic reaction and pET28a is the empty load control. The retention time of the enzymatic product of TtUGT39 is 8.50min, which is consistent with the retention time of the standard Paris saponin II. b. TtUGT39 catalyzes the enzymatic reaction of parsenoside-3-O-β-chacotrisaccharide, where TtUGT39 is the enzymatic reaction and pET28a is the empty load control. The retention time of the enzymatic product of TtUGT39 is 5.71min, which is consistent with the retention time of the standard Paris saponin VII), B. Mass spectrum of the enzymatic product Paris saponin II, C. Mass spectrum of the enzymatic product Paris saponin VII.

[0023] Figure 4 This is the reaction formula in which rhamnosyltransferase TtUGT39 catalyzes the production of parisosaponin III and parisosaponin-3-O-β-chakao trisaccharide into parisosaponin II and parisosaponin VII, respectively.

[0024] Figure 5 This is the gene expression analysis of TtUGT39 in different tissues of Trillium plants.

[0025] Figure 6 Molecular docking results of TtUGT39 protein, sugar receptor Paris polyphylla saponin III and UDP-Rha

[0026] Figure 7 The conversion rate of the mutant catalyzed the production of parisosaponin II and parisosaponin VII from parisosaponin III and parisosaponin-3-O-β-chacotrisaccharide.

[0027] Materials and sources of this experiment

[0028] 1.1 Plant samples

[0029] The plant samples of Trillium were collected from Baoxing County, Ya'an City, Sichuan Province. They were divided into five parts: rhizome, fibrous root, stem, leaf, and flower. They were cleaned with clean water and distilled water, dried with filter paper, and quickly frozen with liquid nitrogen and stored in a -80℃ refrigerator.

[0030] 1.2 Materials and reagents

[0031] Super total RNA extraction kit was purchased from Promega Biotechnology Co., Ltd. (Beijing); 2×PhantaTMMaster Mix high-fidelity enzyme, 6×Protein Loading Buffer, Blue ⅡProtein Marker was purchased from Novazon Biotech Co., Ltd.; -Blunt Zero was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; Trans1-T1 competent cells and Transetta (DE3) expression competent cells were purchased from ABclonal Technology Co., Ltd.; pET28a vector (retained in the laboratory); Thermo Scientific GeneJET gel recovery kit was purchased from Thermo Fisher; isopropylthiogalactoside (IPTG) was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; primers were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd. DETAILED DESCRIPTION

[0032] The preferred embodiments of the present invention are described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0033] Example 1 Cloning of the full-length cDNA sequence of the Trillium gene TtUGT39

[0034] 1.1 Extraction of total RNA from various tissues of Trillium and acquisition of the first-chain cDNA

[0035] Fresh plants of Trillium were collected from Baoxing County, Ya'an City, Sichuan Province. They were divided into five parts: rhizome, fibrous root, stem, leaf, and flower. They were cleaned with clean water and distilled water, dried with filter paper, and quickly frozen with liquid nitrogen and stored in a -80℃ refrigerator. The Super Total RNA Extraction Kit was used to extract RNA from Trillium plant tissues frozen at -80°C. The Fast Quant cDNA First-Strand Synthesis Kit (Tiangen Biochemical Technology Beijing Co., Ltd.) was used to convert the extracted total RNA of good quality into cDNA according to the instructions. The cDNA was stored in a -20°C refrigerator for future use.

[0036] 1.2 Cloning of the full-length gene sequence

[0037] (1) Design primers and PCR amplify target genes

[0038] The open reading frame (ORF) sequence fragment of TtUGT39 was screened based on the annotation information of the Trillium genome data. 5' and 3' specific primers were designed at both ends of the ORF using Primer premier 5.0 software. The first strand of cDNA obtained by reverse transcription was used as a template and the primers were cloned using 2×Phanta TM Master Mix high-fidelity enzyme was used for PCR amplification to obtain the full-length gene. The primer sequences are as follows:

[0039] TtUGT39-F:ATGGGGAGCGCTCCTCCT

[0040] TtUGT39-R:TTAGTCACCACCACCATTCTCGGT

[0041] Reaction system (50 μL):

[0042]

[0043] PCR program (35 cycles):

[0044]

[0045]

[0046] The PCR product was electrophoresed on a 1.0% agarose gel at 180 V for 10 min and observed on a gel imager. If a band with the same size as the target gene appeared, continue with the following steps.

[0047] (2) Recovery of amplified fragments

[0048] The Thermo Scientific GeneJET gel recovery kit was used to recover DNA, and the operation method is as follows.

[0049] ① Carefully cut the gel containing DNA fragments with a scalpel, put it into a 1.5mL EP tube and weigh it, and record the weight of the gel block;

[0050] ② Add Binding Buffer to a 1.5mL EP tube in a volume-to-weight ratio of 1:1 (the amount is by weight, i.e., add 100μL of Binding Buffer for every 100mg of agarose gel);

[0051] ③ Incubate the gel mixture at 55-60°C for 10 min. After the gel is completely dissolved, transfer it to an adsorption tube, centrifuge at 12000×g for 1 min, and discard the waste liquid;

[0052] ⑤ Add 700 μL Wash Buffer to the adsorption tube, centrifuge at 12 000×g for 1 min, and discard the waste liquid; repeat twice;

[0053] ⑥ Centrifuge the empty column at 12000×g for 2 min, transfer the purification column to a new 1.5mL centrifuge tube, and add 30-50μL ddH 2 O on the purification column membrane, after 5 minutes, centrifuge at 12000×g for 1 minute, and the purified DNA can be directly used for subsequent experiments or stored at -20℃.

[0054] (3) Construction of cloning vector and transformation of cloning competent cells

[0055] use -Blunt Zero Cloning Kit, take 4.5μL gel-cutting DNA recovery solution, 0.5μL -Blunt Zero vector, ligated for 15 min at 25°C; added the ligated product to 50 μL Trans1-T1 competent cells, placed in ice for 30 min, heat-shocked at 42°C for 45 s, immediately placed in ice for 2 min, added 500 μL LB medium, revived at 37°C, 180 rpm for 1 h, and 100 μL was spread on a plate containing 50 mg·L -1 Kana's LB solid medium was incubated at 37°C overnight. Single colonies were selected and sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing.

[0056] The sequencing results showed that the gene of the PCR amplification product was named TtUGT39, which encoded a protein consisting of 495 amino acid residues, and the amino acid sequence was shown in SEQ ID NO. 2. The cloning vector was named pEASY-Blunt-TtUGT39 plasmid and stored in a -80°C refrigerator.

[0057] Example 2: Study on the biological function of Trillium TtUGT39

[0058] 1. Construction of prokaryotic expression vector

[0059] The strain with the correct sequencing results and the pET28a vector strain were inoculated into 50 mg·L -1 Kana was cultured in LB liquid culture medium at 37°C and 250 rpm with shaking for 12-16 h, and the plasmid was extracted using a plasmid extraction kit (Tiangen Biochemical Technology Beijing Co., Ltd.).

[0060] (1) Design primers with homology arms specific to the target gene.

[0061] pET28a-TtUGT39-F:tgttccaggggcccgaattcATGGGGAGCGCTCCTCCTGT

[0062] pET28a-TtUGT39-R:tggtgctcgagtgcggccgcTTAGTCACCACCACCATTCT

[0063] (2) Preparation of linearized empty vector: The extracted pET28a (His-MBP) empty vector was double-digested with restriction endonucleases Not I and EcoR I from NEB and incubated at 37°C for 2 h. The product was stained with 6× DNA Loading Buffer and detected by 1.0% agarose gel electrophoresis at 180 V for 10 min. The product was recovered using the Thermo Scientific GeneJET gel recovery kit.

[0064] Enzyme digestion reaction system (50uL):

[0065]

[0066] Enzyme digestion reaction conditions: 37°C, incubation for 2h.

[0067] (3) Preparation of PCR products with homology arms (target gene): The pEASY-Blunt-TtUGT39 plasmid containing the full-length cDNA of the Trillium UGT39 gene was used as a template, pET28a-TtUGT39-F / R was used as primers, and 2×Phanta TM Master Mix high-fidelity enzyme was used to amplify the gene coding region by PCR. PCR reaction program: 98℃ pre-denaturation for 30s; 98℃ for 10s, 59℃ for 5s, 72℃ for 20s, 35 cycles; 72℃ extension for 5min; 4℃ maintenance. After PCR products were stained with 6×DNA Loading Buffer, they were detected by 1.0% agarose gel electrophoresis at 180V for 10min and recovered using Thermo Scientific GeneJET gel recovery kit.

[0068] (4) Establish a connection system based on the seamless splicing kit

[0069] Reaction system (10 μL):

[0070]

[0071] The amount of vector and each inserted fragment added in a 10 μL reaction system was 0.01-0.25 pmols, the optimal molar ratio of vector to each fragment was 1:2, and the connection was carried out at 50°C for 15 min.

[0072] (5) Add the ligation product to 50 μL Trans1-T1 competent cells, place in ice for 30 min, heat shock at 42°C for 45 s, and immediately place in ice for 2 min. Add 500 μL LB medium, resuscitate at 37°C, 180 rpm for 1 h, take 100 μL and spread on LB+Kana solid medium, invert and culture at 37°C overnight. Select a single colony and send it to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The strain with the correct sequencing result was inoculated into 5 mL containing 50 mg·L -1 Kana was shaken in LB liquid culture medium overnight, and the plasmid was extracted using a plasmid extraction kit (Tiangen Biochemical Technology Beijing Co., Ltd.), and the plasmid was stored in a -20°C refrigerator.

[0073] (6) Transformation to competent cells: The extracted pET28a-TtUGT39 (Trans-T1) plasmid was transformed into Transetta (DE3) competent cells in the presence of 50 mg L -1 Kana was cultured on LB solid medium at 37°C overnight, and a single colony was selected and sent to Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The strain with the correct sequencing result was shaken and added with 20% volume of glycerol and stored in a -80°C refrigerator.

[0074] 2. Induce recombinant protein expression

[0075] (1) The positive monoclonal colony of pET28a-TtUGT39 transformed with the expression vector was cultured overnight in a shaker at 37°C and 250 rpm, and then expanded by 1% to 500 mL containing 50 mg·L -1 Kana liquid medium was cultured at 37°C with shaking until OD 600 After the pH value was 0.6-0.8, isopropylthiogalactoside (IPTG) was added to a final concentration of 0.5 mM, and the expression was induced at 16°C for 16-20 h;

[0076] (2) The low-temperature induced bacterial solution was centrifuged at 4°C, 10,000 × g for 1 min to collect the bacterial cells, and the cells were resuspended in buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 5% glycerol) to a concentration of 0.2 g mL -1 , crushed by ultrasonic crusher, centrifuged at 12000×g for 45min at 4℃.

[0077] (3) Take 20 μL of the supernatant and add 4 μL of 6× Protein Loading Buffer. Boil at 99°C for 8 min and detect by SDS-PAGE gel electrophoresis. Ⅱ Protein Marker (14-120kDa)] control, the molecular weight of pET28a-TtUGT39 recombinant protein is about 100kDa, which is a soluble protein.

[0078] 3. Enzymatic reaction

[0079] In a 200 μL reaction system, 4 μL UDP-rhamnose (1 mM), 8 μL Paris saponin III, 100 μM parsenoside-3-O-β-chacotriosaccharide, and 188 μL crude enzyme were added. The recombinant protein expression protein of the recombinant plasmid pET28a-TtUGT39 was used as the experimental group, and the protein expression protein of the empty plasmid pET28a was used as the control group. After reacting in a 30°C incubator for 12 h, 200 μL ice methanol was added to terminate the reaction, and the reaction was filtered through a 0.22 μm filter membrane. The reaction results were analyzed by LC-MS (SYNAPT G2 ultra high performance liquid chromatography / ion mobility / quadrupole-time of flight mass spectrometry).

[0080] Liquid phase detection method and conditions: The chromatographic column was a BEH-C18 reverse phase chromatographic analysis column (1.7 μm, 2.1 mm × 100 mm, Waters Company), the injection volume was 3 μL, the mobile phase was: phase A was water, phase B was acetonitrile, the elution gradient was: 0-9 min, 30%-60% B; 9-11 min, 60% B; 11-13 min, 60%-70% B; 13-16 min, 70%-100% B. The flow rate was 0.3 mL / min, the injection volume was 5 μL, and the column temperature was 30 °C. Full-MS selected the positive ion mode, the scanning range was 100-1000 Da, and the scanning time was 0.2 s.

[0081] The reaction results are as follows Figure 3 As shown, TtUGT39 can catalyze the extension of the C-4 sugar chain of parisaponin III and parisaponin-3-O-β-chacotrisaccharide to generate the polysaccharides parisaponin II and parisaponin VII, respectively.

[0082] 4. Molecular docking and in vitro enzymatic reaction of mutants

[0083] According to the molecular docking results, Figure 6 As shown, the key amino acids within the 5A range of the binding site and the substrate channel were selected for alanine scanning, the TtUGT39 gene sequence was compared with the transcriptome database and the homologous sequences of known functional Rha, the differential amino acids were mutated, and the preparation of mutants and in vitro enzymatic experiments were carried out in the manner of Example 2.

[0084] The reaction results are as follows Figure 7As shown in the figure, the conversion rate of A158T mutant to Rhizoma Polygoni saponin III increased by 1 times compared with the wild type, the conversion rate of sapogenin-3-O-β-chacotriosaccharide increased by 0.8 times compared with the wild type, and the conversion rate of S377V to Rhizoma Polygoni saponin III was slightly improved compared with the wild type. And the key conservative amino acids for catalytic reaction lost their activity after mutation to alanine, such as 370A, S376A, G23A, P355A, H22A, F100A, Y152A, F154A, H104A, Y421, I91A, R203A, N296A.

[0085] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. An isolated protein comprising the amino acid sequence shown in SEQ ID NO: 1, or a mutant in which at least one amino acid of the amino acid sequence shown in SEQ ID NO: 1 is substituted, deleted or inserted but the activity of the protein is retained.

2. The protein according to claim 1, wherein the mutant is selected from at least one of the following sites in the amino acid sequence shown in SEQ ID NO: 1: A158T, S377V, T370A, S376A, G23A, P355A, H22A, F100A, Y152A, F154A, H104A, Y421, I91A, R203A, N296A or a combination thereof.

3. A nucleotide encoding the protein according to claim 1 or 2. The nucleotide according to claim 3 , wherein the nucleotide sequence is shown as SEQ ID NO:

2.

5. An expression vector comprising the nucleotide sequence of claim 3 or 4.

6. An engineered bacterium comprising the polynucleotide according to claim 3 or 4, or the expression vector according to claim 5, wherein the engineered bacterium may be, for example, Escherichia coli.

7. Use of the protein according to claim 1 or 2, or the nucleotide according to claim 3 or 4, or the expression vector according to claim 5, or the engineered bacteria according to claim 6 in catalyzing Parisopsenoside III and parsenoside-3-O-β-chacotriosaccharide.

8. The use according to claim 7, wherein the use is to catalyze the C-4 sugar chain extension of Paris saponin III and Pianosaponin-3-O-β-chacotriosaccharide.

9. The use according to claim 7 or 8, wherein the use is to catalyze the production of parisosaponin II and parisosaponin VII from parisosaponin III and parisosaponin-3-O-β-chacotrisaccharide.

10. Use of the protein according to claim 1 or 2, or the nucleotide according to claim 3 or 4, or the expression vector according to claim 5, or the engineered bacteria according to claim 6 in Paris polyphylla breeding.

Images