Azido-modified Suc2 recombinant protein as well as coding gene and application thereof

Abstract

The invention discloses an azido-modified Suc2 recombinant protein as well as a coding gene and application of the azido-modified Suc2 recombinant protein. The amino acid sequence of the azido modified Suc2 recombinant protein is as shown in SEQ ID NO. 1. The efficiently-combined nucleic acid-protein compound can provide a new scheme for high-sensitivity and quick-response detection, and is combined with a CRISPR-Cas system, so that the cost of the detection method in pathogen detection is reduced, the flexibility and applicability of the detection method are improved, and the application of the detection method in pathogen nucleic acid detection is promoted.

Description

Technical Field

[0001] The invention relates to an azido-modified Suc2 recombinant protein and a coding gene and application thereof, and belongs to the field of biological detection. Background Art

[0002] In recent years, sucrase, as an efficient hydrolase, has shown important application potential in rapidly converting sucrose into glucose. The high efficiency of sucrase makes it an ideal choice for portable blood glucose monitoring and can provide a solid foundation for the development of blood glucose monitoring and biosensors. By combining with other biomaterials, sucrase is widely used in the development of portable blood glucose meters.

[0003] The CRISPR-Cas system originates from bacteria and archaea. As a natural immune mechanism, it can recognize and cut foreign DNA. In recent years, this system has been transformed into a powerful detection tool. The CRISPR-Cas system uses a specific RNA (gRNA) that is complementary to the specific nucleic acid sequence of the pathogen to be detected, thereby achieving the recognition of the target pathogen. When the gRNA binds to the target DNA, the Cas protein is activated and forms a dimer, which then cuts the DNA. This process is not only efficient but also highly specific. By combining various signal amplification technologies (such as fluorescent signals or electrochemical signals), trace pathogen signals can be amplified for detection.

[0004] Nucleic acid protein conjugates are a common method in POCT applications. However, traditional nucleic acid protein conjugation methods often have problems such as complicated operation steps and low conjugation efficiency. Summary of the invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide an azido-modified Suc2 recombinant protein and its encoding gene and application.

[0006] Technical solution: To solve the above technical problems, the present invention provides an azido-modified Suc2 recombinant protein, whose amino acid sequence is shown in SEQ ID NO.1.

[0007] Suc2 is a wild-type sucrase from yeast SC288, which is a natural tetramer. Therefore, the azido-modified Suc2 recombinant protein will also form a tetramer. After testing, the azido-modified Suc2 recombinant protein monomer is composed of 549 amino acids, with a molecular weight of 62.373 KDa and an isoelectric point of 4.47.

[0008] The present invention also provides a gene encoding the azide-modified Suc2 recombinant protein, and the nucleotide sequence thereof is shown in SEQ ID NO.2.

[0009] The invention also provides an expression box, a recombinant vector or a recombinant engineering bacterium containing the gene.

[0010] The present invention also provides a method for promoting the expression of a Suc2 recombinant protein modified with an azide group, wherein the DNA of the 111TAG-Suc2 protein with a nucleotide sequence such as that shown in SEQ ID NO.4 is cloned into a prokaryotic expression vector PBad, and the pEvoL-pAzF (addgene Plasmid #31186) expression vector is co-transformed into Escherichia coli, and the expression is induced with L-ara and PAZF. The method adopts genetic codon expansion technology, and with the help of orthogonal aminoacyl-tRNA synthetase (aaRS) / tRNA pairs, non-natural azidophenylalanine is specifically incorporated into the amber stop codon site. The click chemistry reaction based on the azide group can significantly improve the preparation efficiency of the recombinant protein conjugate.

[0011] Specifically, the following steps are included:

[0012] (1) connecting the coding gene of 111TAG-Suc2 protein to the PBad linear vector to obtain a recombinant expression vector; the nucleotide sequence of the PBad linear vector is shown in SEQ ID NO.3;

[0013] (2) using the recombinant expression vector obtained in step (1) and the pEvoL-pAzF (addgene Plasmid #31186) expression vector to co-transform Escherichia coli host cells to obtain recombinant genetically engineered bacteria;

[0014] (3) Using the recombinant genetically engineered bacteria in step (2) as the production strain, adding L-ara and PAZF to induce expression.

[0015] The present invention also provides the use of the azide-modified Suc2 recombinant protein or the gene in preparing a nucleic acid-protein complex.

[0016] The application is based on click chemistry and DNA coupling. The azide group introduced by the recombinant protein Suc2 is coupled with DBCO-DNA-Biotin based on a click chemistry reaction to generate a nucleic acid-protein conjugate.

[0017] The present invention also provides a nucleic acid-protein complex containing the azide-modified Suc2 recombinant protein or the gene.

[0018] The present invention also provides the use of the azido-modified Suc2 recombinant protein, the gene encoding the Suc2 recombinant protein, the expression cassette containing the gene, the recombinant vector or the recombinant engineered bacteria or the nucleic acid-protein complex in the preparation of a pathogen nucleic acid detection reagent or kit.

[0019] Among them, the pathogens include the new coronavirus or classical circovirus.

[0020] The present invention also provides a pathogen nucleic acid detection reagent or kit, which contains the azido-modified Suc2 recombinant protein, the gene encoding the azido-modified Suc2 recombinant protein, the expression cassette, the recombinant vector or the recombinant engineered bacteria or the nucleic acid-protein complex.

[0021] The present invention also establishes a new method for portable pathogen nucleic acid detection based on nucleic acid protein complex. The specific principle is: BIotin of the nucleic acid protein complex is affinity-linked with SA-MB, and finally a Suc2-MB structure with DNA as the intermediate connector is generated. The pathogen template is pre-amplified by PCR or RT-PCR and converted into a DNA / RNA template; the template activates the trans-cutting activity of the Cas12a protein through sgRNA-mediated target recognition, and the activated Cas12a protein can cut the Suc2-MB intermediate connector DNA, releasing the Suc2 hydrolase as a signal to be captured and collected for converting sucrose into glucose. However, in the absence of target nucleic acid, the nuclease activity of the Cas protein is dormant, and the Suc2-MB structure will not be destroyed to release the Suc2 hydrolase to produce glucose, maintaining the integrity of Suc2-MB. The Suc2-MB structure is added to the CRISPR detection system, and the sucrose is hydrolyzed to produce glucose after non-specific cleavage by the Cas protein, and the sugar concentration in the system is detected by a portable personal blood glucose meter.

[0022] The method includes the following steps: affinity binding of nucleic acid-protein complex with SA-magnetic beads to generate Suc2-MB, adding the pre-amplified product of pathogen nucleic acid, targeted CRISPR / Cas reaction solution, Suc2-MB and sucrose to react, and after the reaction, using a blood glucose meter for detection.

[0023] The present invention uses a highly efficient nucleic acid-protein complex combined with a CRISPR / Cas system to successfully construct a pathogen nucleic acid detection method using a portable personal blood glucose meter as a signal output, and develops a POCT platform for rapid detection of pathogen nucleic acids.

[0024] Based on the azido-modified Suc2 recombinant protein, the present invention combines the CRISPR-Cas system to develop a portable blood glucose meter pathogen nucleic acid detection method. The expression method of the azido-modified Suc2 recombinant protein is intended to overcome the problems of complicated protein coupling operation steps and low coupling efficiency in traditional methods.

[0025] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0026] 1. It overcomes the problems of complicated protein coupling operation steps and low coupling efficiency in traditional methods, and can achieve efficient binding of nucleic acids and proteins, providing a new solution for high-sensitivity and rapid response detection;

[0027] 2. By combining with the CRISPR-Cas system, not only the cost of this detection method in pathogen detection is reduced, but also the flexibility and applicability of the detection method are improved, which promotes its application in pathogen nucleic acid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the agarose electrophoresis diagram of the PBad-111TAG-Suc2 recombinant plasmid;

[0029] Figure 2 This is the antibiotic screening diagram of PBad-111TAG-Suc2 transformants;

[0030] Figure 3 is the enzyme activity diagram of Suc2-PAZF recombinant protein induced expression;

[0031] Figure 4 is the enzyme activity diagram of purified Suc2-PAZF recombinant protein;

[0032] Figure 5 is the SDS-PAGE electrophoresis diagram of the induced expression of Suc2-PAZF recombinant protein;

[0033] Figure 6 is the SDS-PAGE electrophoresis of purified Suc2-PAZF recombinant protein;

[0034] Figure 7 It is the PAGE electrophoresis diagram after the reaction of Suc2-PAZF recombinant protein and DBCO-DNA-BIotin;

[0035] Figure 8 This is a graph showing the results of validating the classical circovirus target;

[0036] Fig. 9 This is a graph showing the results of the validation of the new coronavirus target;

[0037] Fig.10 This is the result diagram of the application of PBad-5'UTR-111TAG-Suc2 recombinant plasmid;

[0038] Fig.11 This is a diagram showing the application results of the PBad-Sumo-111TAG-Suc2 recombinant plasmid. DETAILED DESCRIPTION

[0039] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0040] Reagent preparation:

[0041] Buffer 1: 20 mM Tris, 150 mM NaCl, pH 7.6;

[0042] Buffer 2: 50 mM NiSO4;

[0043] Buffer 3: composed of 50 mM phosphate buffer containing 5 mM imidazole, 300 mM NaCl, pH 6.8;

[0044] Buffer 4: composed of 50 mM phosphate buffer containing 30 mM imidazole, 300 mM NaCl, pH 6.8;

[0045] Buffer 5: composed of 50 mM phosphate buffer containing 45 mM imidazole, 300 mM NaCl, pH 6.8;

[0046] Buffer 6: composed of 50 mM phosphate buffer containing 60 mM imidazole, 300 mM NaCl, pH 6.8;

[0047] Buffer 7: composed of 50 mM phosphate buffer containing 150 mM imidazole, 300 mM NaCl, pH 6.8;

[0048] Buffer 8: composed of 50 mM phosphate buffer containing 200 mM imidazole, 300 mM NaCl, pH 6.8;

[0049] Buffer 9: composed of 50 mM phosphate buffer containing 250 mM imidazole, 300 mM NaCl, pH 6.8;

[0050] Buffer 10: composed of 50 mM phosphate buffer containing 300 mM imidazole, 300 mM NaCl, pH 6.8;

[0051] Buffer 11: 0.5 M NaCl, 20 mM Tris, 100 mM EDTA, NaOH adjusted to pH 7.9;

[0052] Buffer 12: 0.2 mol / L disodium hydrogen phosphate-citrate buffer, pH 5.0;

[0053] Buffer 13: 0.01 M sodium phosphate buffer, 0.01% Tween 20, pH 7.4;

[0054] Definition of enzyme activity: 1U of enzyme is required to hydrolyze 5% sucrose to release 1μmol of glucose per minute.

[0055] Enzyme activity calculation formula:

[0056] Sucrase activity = glucose concentration × Vtotal × 1000 × n / (180 × t × Venzyme),

[0057] Wherein, Vtotal: total volume of enzyme reaction system (mL); n: enzyme solution dilution factor; t: enzyme reaction time (min); Venzyme: required enzyme solution volume (mL).

[0058] Example 1 Preparation of azide-modified Suc2 recombinant protein (Suc2-PAZF) by prokaryotic expression system

[0059]

[0060] 1. Construction of PBad linear vector:

[0061]

[0062] Table 1 Inverse linear PCR system

[0063]

[0064] Among them, the plasmid-specific primer F / R is PBad-F (SEQ ID NO. 7): 5'-AAGCTTGGCTGTTT TGGCG-3' (Tm: 61.3°C);

[0065] PBad-R (SEQ ID NO. 8): 5'-GGTTAATTCCTCCTGTTAGCCCA-3' (Tm: 61.7°C).

[0066] Table 2 Inverse linear PCR program

[0067]

[0068] According to Table 1, the reverse PCR amplification system was prepared, and according to the reaction conditions in Table 2, the PBad linear vector was amplified by reverse PCR, and the nucleotide sequence was as SEQ ID NO.3.

[0069] 2. Construct the target gene 111TAG-Suc2 gene with homology arms, the nucleotide sequence of which is as shown in SEQ ID NO.4.

[0070] Table 3 PCR system

[0071]

[0072]

[0073] Among them, the plasmid-specific primer F / R (10 μM) is Suc2-F (SEQ ID NO.9):

[0074] 5'-gctaacaggaggaattaaccCATATGCTGTTACAAGCTTTCTTGTTT-3' (the calculated value of gene-specific primer Tm is: 69.8°C, homology arm length: 20 bp, homology arm GC content: 45.0%);

[0075] Suc2-R (SEQ ID NO.10):

[0076] 5'-ccgccaaaacagccaagcttTCAGTGGTGGTGGTGGTGGTGGT-3' (the calculated value of gene-specific primer Tm is: 61.0°C; the length of homology arm: 20 bp; the GC content of homology arm: 55.0%).

[0077] Table 4 PCR program

[0078]

[0079]

[0080] 3. Construction of PBad-111TAG-Suc2 recombinant plasmid by homologous recombination

[0081] Table 5 Homologous recombination system

[0082]

[0083]

[0084] Homologous recombination was performed using Vazyme's ClonExpress Ultra one Step Colning Kit V2 C116 (system as shown in Table 5). The homologous recombination reaction conditions were: 50°C, 5 min; immediately cooled on ice. The PBad-111TAG-Suc2 recombinant plasmid was obtained.

[0085] 4. Inducible expression of Suc2-PAZF recombinant protein

[0086] The PBad-111TAG-Suc2 recombinant plasmid and pEvoL-pAzF (addgene Plasmid # 31186) were co-introduced into Escherichia coli DH10B, and the positive clones were picked and inoculated into LB medium containing ampicillin (33 mg / mL) and chloramphenicol (33 mg / mL). After shaking culture at 37°C for 12 hours, the bacterial solution was transferred to fresh LB medium containing 33 mg / mL ampicillin and 33 mg / mL chloramphenicol at a ratio of 1:100, and shake-cultured at 37°C until the OD reached 0.6-0.8, then L-Ara (Shanghai Aladdin) and PAZF (mreda) were added to make the final concentration of L-Ara 0.2%, and the final concentration of PAZF 1 mM, and the expression was induced at 20°C for 20 hours to obtain Suc2-PAZF recombinant protein, whose amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2.

[0087] 5. Purification of Suc2-PAZF recombinant protein

[0088] (1) Centrifuge at 4°C, 6000 rpm for 20 min and discard the supernatant; add buffer 1 according to the weight of the bacterial pellet to resuspend the cells (add 9 mL of buffer 1 for every 1 g of bacterial pellet), use Hammer lysis buffer (ACE Biotechnology) to lyse Escherichia coli (add 1 mL of Hammer lysis buffer for every 1 g of bacterial pellet), invert and mix, and let stand at 4°C for 15-20 min; after lysis, centrifuge at 4°C, 12000 rpm for 40 min and collect the supernatant.

[0089] (2) Adjust the nucleic acid protein instrument to 280 nm, 0.1A, remove the nickel column (Cityva), rinse the resin with sterile water, adjust the flow rate to one drop / 3 s; wash with 6 volumes of buffer 2; balance with 5 volumes of buffer 3, and adjust the instrument to zero; load the collected sample supernatant onto the column; after the sample is loaded, wash the column with 10 volumes of buffer 3; elute with 6 volumes of buffer 4; elute with 6 volumes of buffer 5; elute with 6 volumes of buffer 6; elute with 6 volumes of buffer 7; elute with 6 volumes of buffer 8; elute with 6 volumes of buffer 9; elute with 6 volumes of buffer 10, and collect all the parts flowing out from the place where the signal increases; wash the column with 5 volumes of buffer 11.

[0090] (3) The eluted protein was ultrafiltered using a 50 KDa ultrafiltration tube, replaced with PBS 7 times, and centrifuged at 10,000 × g for 6 min at 4°C to obtain the PBad-111TAG-Suc2 recombinant plasmid.

[0091] 6. Construction of the identification diagram of the PBad-111TAG-Suc2 recombinant plasmid

[0092] (1) Agarose electrophoresis of PBad-111TAG-Suc2 recombinant plasmid. The concentration of agarose was 1%. 5 μL of the PBad linear vector and the target gene sequence with homology arms obtained in the above reactions were added to 1 μL of 6×DNA loading buffer at 100 V for 45 min.

[0093] (2) The PBad-111TAG-Suc2 expression vector constructed by homologous recombination was transformed into Escherichia coli DH5α, spread on LB solid medium with ampicillin (33 mg / mL) resistance, and cultured inverted at 37°C overnight. The single clone was picked out and sequenced by Sangon Biotech (Shanghai) Co., Ltd. The universal sequencing primers were numbered U084 and U085 (U085: ATCTGTATCAGGCTGAAAATC, U084: ATGCCATAGCATTTTTATCC, provided by Sangon Biotech (Shanghai) Co., Ltd.). The plasmid encoding the correct 111TAG-Suc2 target gene sequence was returned.

[0094] like Figure 1 As shown, both the PBad linear vector and the target gene sequence with homology arms can be amplified with good specificity.

[0095] like Figure 2 Shown is the antibiotic screening diagram of DH5α-PBad-111TAG-Suc2 transformants.

[0096] Example 2 SDS-PAGE electrophoresis of Suc2-PAZF expression product and identification of DNS enzyme activity

[0097] 1. DNS reagent to determine the activity of Suc2-PAZF recombinant protease

[0098] The total volume of the enzyme reaction was 0.6 mL (containing 0.05 mL of buffer 12, 5 μL of 5% sucrose, 0.3-5 μL of the sample to be tested, ddH2O), 42°C for 30 min. 0.1 mL of DNS reagent (Solarbio) was added and boiled for 5 min. The reaction was taken out to room temperature and 0.45 mL of ddH2O was added; a 48-well plate was used, 200 μL per well, and three wells were repeated, and the OD540 nm was measured by an ELISA reader.

[0099] like Figure 3 As shown, the recombinant protein of Suc2-PAZF was expressed after induction of L-Ara and PAZF compared with that without induction.

[0100] like Figure 4 As shown, the protein was purified by nickel column affinity, and buffer 8, 9, and 10 eluents all had target protein activity. Finally, buffer 4, 5, 6, and 7 eluents were used to elute the impurities with imidazole, and buffer 10 was used to elute and collect the target protein.

[0101] 2. SDS-PAGE determination of the molecular weight of Suc2-PAZF recombinant protein

[0102] SDS-PAGE uses 4%-20% protein precast gel (ACE Biotechnology); the sample is boiled for 15 minutes and then centrifuged, 16 μL is taken for electrophoresis, and a standard molecular weight is added as a control; the voltage is 150V, 50 minutes, and the gel is stripped and stained with Coomassie Brilliant Blue; after electrophoresis, the molecular weight of the protein to be tested is obtained based on the molecular weight of the standard protein.

[0103] like Figure 5 As shown, compared with empty vector and uninduced bacteria, the recombinant protein of Suc2-PAZF was expressed after induction with L-Ara and PAZF.

[0104] like Figure 6 As shown, the target band was eluted using the nickel column affinity purification buffer 10.

[0105] Example 3 PAGE Identification of Protein-DNA Coupling Based on Azide Group Click Chemistry Reaction

[0106] (1) The dry powder of DBCO-DNA-Biotin synthesized by Shanghai Biotech Co., Ltd. was centrifuged at 6000×g for 3 min. 330 μL ddH2O was added to dilute it to 10 μM. The sequence of DBCO-DNA-Biotin was (SEQ ID NO. 11): 5′-Biotin-TTATTATTATTATTATTATTATTATTATTA-DBCO-3′.

[0107] (2) Take 50 μL of the induced expression Suc2-PAZF recombinant protein solution with an enzyme activity of 32427U and mix it with a slightly excess of 60 μL of the DBCO-DNA-Biotin solution diluted in step (1), add 110 μL of 2×PBS buffer, react at 25°C, 880 rpm for 8-10 hours, and after the reaction, use a 50KDa ultrafiltration tube for ultrafiltration, centrifuge at 4°C, 8000×g, 7 minutes. Replace the PBS buffer 3 times.

[0108] like Figure 7 As shown, compared with the reaction before and after DBCO-DNA-Biotin and Suc2-PAZF recombinant protein reaction, the nucleic acid protein was successfully coupled.

[0109] Example 4 Nucleic acid protein complex combined with CRISPR for pathogen detection and blood glucose meter identification

[0110] 1. Synthesis of Suc2-MB structure: Take 20 μL of 10 mg / mL chain and affinity mycin modified magnetic beads (SA-MB, Thermo Fisher Scientific), wash three times with buffer 13 and PBS respectively, and resuspend with 20 μL PBS; take 35 μL of the above ultrafiltered nucleic acid protein complex Biotin-DNA-DBCO-PAZF-111TAG-Suc2, add 20 μL of 10 mg / mL SA-MB solution after washing and 45 μL PBS buffer in a vortex mixer at 25°C for 2h. After the reaction, separate the magnetic beads, remove the supernatant, wash the magnetic beads 3 times with buffer 13 and PBS respectively, and finally resuspend in 20 μL PBS buffer to generate Suc2 recombinant protein bound to magnetic beads, i.e., Suc2-MB structure, and store at 4°C.

[0111] 2. Activation of LbCas12a1 system and detection of porcine circovirus targets

[0112] Table 6 PCR system

[0113]

[0114] Among them, the target specific primer F / R (10uM) is PCV3-F (SEQ ID NO.12):

[0115] GCGTCACTGGCTCTGACACGCCAACAAAGAGGCCAGCGAGTATTG(Tm:79℃)

[0116] PCV3-R (SEQ ID NO. 13):

[0117] GTCATCTGACGGAGGGATCGCGCAACTTCAGTCAGATTTCC(Tm:76.2℃)

[0118] Table 7Cas-Suc2-MB system

[0119]

[0120] Cas trans-cleavage conditions: 30°C, 1h; magnetic separation, separate the reaction supernatant.

[0121] Among them, PCV3-CrRNA (SEQ ID NO.14): UAAUUUCUAAGUGUAGAUGGUACCAAGAUCGGAUCUUCA

[0122] Table 8 Sucrose hydrolysis reaction system

[0123]

[0124] Sucrose hydrolysis conditions: 42°C, 30 min; tested using a home blood glucose meter.

[0125] Table 9 PCR temperature program

[0126]

[0127] Reaction process: ① The above-mentioned classical swine fever circovirus pathogen DNA sequence was screened in the genome database, artificially synthesized by Nanjing GenScript Biotechnology Co., Ltd. and recombined into the PUC19 plasmid vector provided by GenScript as a DNA template (template in Table 6), and the classical swine fever circovirus pathogen DNA sequence is shown in SEQ ID NO.5: ② The target primers of the new classical swine fever circovirus were determined, and the PCR system was prepared as shown in Table 6, and the specific PCR reaction conditions were shown in Table 9.

[0128] After PCR amplification is completed, a double-stranded DNA product is generated, which is further verified by the nucleic acid-protein complex CRISPR-Cas pathogen nucleic acid detection method. The Cas system and Suc2-MB complex are premixed and then added to the double-stranded DNA product, as shown in Table 7. The reaction supernatant is further hydrolyzed with sucrose to produce glucose, which is detected using a blood glucose meter, as shown in Table 8. That is, the double-stranded DNA product is combined with the corresponding target PCV3-Cr-RNA and coupled with LbCas12a1 to form a ternary complex to cut the nucleic acid-protein complex. The nucleic acid-protein separation reaction is completed under the reaction conditions of 30°C and 1 hour. There are a positive group and a blank control group. The positive group added a double-stranded DNA product, and the blank control used water instead of the double-stranded DNA product as a result comparison. The results are as follows Figure 8 As shown, PCV3 has an obvious blood glucose meter signal, which is clearly distinguishable from the blank control, verifying the feasibility of the method of the present invention for this target.

[0129] 3. Activate the SuCas12a2 system and detect the new coronavirus target

[0130] Table 10 PCR system

[0131]

[0132]

[0133] Among them, the target specific primer F / R is: XG-ORF-F (SEQ ID NO.15):

[0134] CAGGAAACAGCTATGACC (Tm: 49.9°C);

[0135] XG-ORF-R (SEQ ID NO. 16): GGTAACGCCAGGGTTTTCC (Tm: 56.9°C)

[0136] Table 11 Design of in vitro transcription system

[0137]

[0138] In vitro transcription conditions: mix thoroughly and centrifuge briefly to collect, 37°C, 14h; add 1μL DNase I enzyme, 37°C, 15min.

[0139] Table 12Cas-Suc2-MB system

[0140]

[0141]

[0142] Cas trans-cleavage conditions: 30°C, 1h; magnetic separation, separation of reaction supernatant

[0143] Wherein XG-ORF-CrRNA (SEQ ID NO.17):

[0144] AUUUCUACUGUUGUAGAUCACAUACCGCAGACGGUACAGACU

[0145] Table 13 Sucrose hydrolysis reaction system

[0146]

[0147] Sucrose hydrolysis conditions: 42°C, 30 min; tested using a home blood glucose meter.

[0148] Table 14 PCR reaction program

[0149]

[0150] Reaction process: ① Screen the DNA sequence of the pathogen novel coronavirus (XG-ORF) in the genome database, as shown in SEQ ID NO.6: actcgttaatacgactcactatagggagggaagccaatatggatcaagaatcctttggtggtgcatcgtgttgtctgtactgccgttgccacatagatcatccaaatcctaaaggattttgtgacttaaaaggtaagtatgtacaaatacctacaacttgtgctaatgaccctgtgggttttacacttaaaaacacagtctgtaccgtctgcggtatgtggaaaggttatggctgtagttgtgatcaactccgcgaacccatgcttcagtcagc tgatgcacaatcgtttttaaacgggtttgcggtgtaagtgcagcccgtcttacaccgtgcggcacaggcactagtactgatgtcgtatacagggcttttgacatctacaatgataaagtagctggttttgctaaattcctaaaaactaattgttgtcgcttccaagaaaaggac, artificially synthesized by Nanjing GenScript Biotechnology Co., Ltd. and recombined into the pMD-18-T vector provided by GenScript as a DNA template, wherein the DNA template contains a T7 promoter; ② Determine the target primers for the new coronavirus and prepare the PCR system as shown in Table 10, and the specific PCR reaction conditions are shown in Table 14. ③ The new coronavirus DNA was transcribed in vitro and the RNA was purified, which was synthesized by Vazyme's T7 HighYieldRNA transcription kit, and the system is shown in Table 11. And used according to the manufacturer's recommendations. RNA cleaning kit purification, purification steps according to the instructions. ④ Purified new coronavirus target (10 10 The RNA amplification product of 100 copies was used as a positive control, and the blank control was replaced by water instead of the double-stranded RNA product, as shown in Table 12, that is, the Cas system and the Suc2-MB complex were pre-mixed and then the double-stranded RNA product was added, and the nucleic acid protein separation reaction was completed under the reaction conditions of 30°C and 1 hour. As shown in Table 13, the reaction supernatant was further hydrolyzed with sucrose to produce glucose, which was detected using a blood glucose meter. The results are shown in Fig. 9 In the experiment, XG-ORF had obvious blood glucose meter signal, which was clearly distinguished from the blank control, and the feasibility of the method of the present invention was verified for this target.

[0151] Example 5

[0152] Changing the nucleotide sequence of the 5' untranslated region of the PBad-111TAG-Suc2 recombinant plasmid and adding a Sumo tag to the front end of protein translation can successfully introduce azidophenylalanine, which is connected to nucleic acid through click chemistry to form a nucleic acid-protein complex, and finally connected to magnetic beads with affinity streptavidin to form a Suc2 protein structure bound to magnetic beads. It can also be applied to the above-mentioned activation of the LbCas12a1 system, detection of porcine circovirus targets, activation of the SuCas12a2 system, and detection of new coronavirus targets; the application results of the PBad-5'UTR-111TAG-Suc2 recombinant plasmid are as follows Fig.10 The results of the PBad-Sumo-111TAG-Suc2 recombinant plasmid application are as follows: Fig.11

[0153] gccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgggga

[0154] gtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttact

[0155] catatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacg

[0156] tgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaa

[0157] acaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagc

[0158] gcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgcta

[0159] atcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcg

[0160] gtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctat

[0161] gagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagg

[0162] gagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagg

[0163] ggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgt

[0164] tatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtca

[0165] gtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagt

[0166] acaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgcca

[0167] acacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtc

[0168] agaggttttcaccgtcatcaccgaaacgcgcgaggcagcagatcaattcgcgcgcgaaggcgaagcggcatgcataatgtgcctgtc

[0169] aaatggacgaagcagggattctgcaaaccctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatgacaacttgacggc

[0170] tacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgat

[0171] cgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctc

[0172] gcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgc

[0173] tggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgact

[0174] cgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgt

[0175] taatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccag

[0176] ttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgat

[0177] gaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatg

[0178] gtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgcc

[0179] accagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagag。

Claims

1. An azido-modified Suc2 recombinant protein, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

1.

2. A gene encoding the azido-modified Suc2 recombinant protein according to claim 1, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

2.

3. An expression cassette, recombinant vector or recombinant engineered bacteria containing the gene according to claim 2.

4. A method for promoting the expression of azide-modified Suc2 recombinant protein, characterized in that: The nucleotide sequence 111TAG-Suc2 shown in SEQ ID NO.4 is cloned into the prokaryotic expression vector PBad, and transformed into Escherichia coli together with the pEvoL-pAzF expression vector, and the expression is induced by L-ara and PAZF.

5. Use of the azido-modified Suc2 recombinant protein according to claim 1 or the gene according to claim 2 in the preparation of a nucleic acid-protein complex.

6. The use according to claim 5, characterized in that: The application is based on click chemistry and DNA coupling.

7. A nucleic acid-protein complex, characterized in that: Containing the azido-modified Suc2 recombinant protein according to claim 1 or the gene according to claim 2.

8. Use of the azido-modified Suc2 recombinant protein according to claim 1, the gene according to claim 2, the expression cassette, recombinant vector or recombinant engineered bacteria according to claim 3 or the nucleic acid-protein complex according to claim 7 in the preparation of a pathogen nucleic acid detection reagent or kit.

9. The use according to claim 8, characterized in that: The pathogens include classical circovirus or new coronavirus.

10. A pathogen nucleic acid detection reagent or kit, characterized in that: Containing the azido-modified Suc2 recombinant protein according to claim 1, the gene according to claim 2, the expression cassette, recombinant vector or recombinant engineered bacteria according to claim 3 or the nucleic acid-protein complex according to claim 7.

Images