A glutamate decarboxylase mutant, its gene, amino acid sequence and its application in achieving efficient production of gamma-aminobutyric acid

Abstract

The invention discloses a glutamate decarboxylase mutant, its gene, amino acid sequence and its application in realizing efficient production of gamma-aminobutyric acid, and belongs to the field of protein engineering. The present invention obtains glutamate decarboxylase mutant M17 by genetic engineering method; The mutant not only has excellent catalytic activity and high thermal stability, but also shows good acid resistance, and its optimum pH is reduced from the original 5.0 to 3.5. Under the condition of pH 3.5, the production intensity is 1.4 times that of the original bacteria, and salt ions are not introduced in the reaction system, and there is no need to carry out desalination and refining, so as to reduce product loss, and lay the foundation for reducing production and equipment loss costs in the industrial application of producing GABA.

Description

Technical Field

[0001] The present invention belongs to the technical field of protein engineering, and in particular relates to a mutant of glutamate decarboxylase, a recombinant bacterial cell thereof, and applications of the mutant in realizing efficient production of gamma-aminobutyric acid. Background Art

[0002] γ-Aminobutyric acid (GABA), a non-protein amino acid, is an important inhibitory neurotransmitter in the mammalian central nervous system. It has been shown to have calming, anti-anxiety, anti-epileptic, sleep-promoting effects, improve menopausal and senile mental disorders, enhance liver and kidney function, lower blood pressure, effectively reduce weight, and promote alcohol metabolism. Approved as a new resource food by the Ministry of Health in 2009, GABA has wide applications in the pharmaceutical, healthcare, agricultural, feed, chemical, and food industries. GABA in vivo is primarily produced by the decarboxylation of glutamate catalyzed by glutamate decarboxylase (GAD), with pyridoxal-5-phosphate as its coenzyme. Three main methods for preparing GABA as a pharmaceutical or health supplement are chemical synthesis, isolation and extraction, and biosynthesis. Biosynthesis offers advantages such as mild reaction conditions, simple processing procedures, high product yield and selectivity, and energy conservation and environmental protection, making it a promising method for the bioproduction of GABA in industrial production.

[0003] GAD is a key enzyme in GABA biosynthesis. Using pyridoxal 5'-phosphate (PLP) as a coenzyme, it can specifically and irreversibly catalyze the decarboxylation of glutamate to synthesize GABA and CO2. Its activity directly affects the ability of microorganisms to synthesize GABA. GAD from microbial sources mainly includes Lactobacillus brevis, Lactobacillus plantarum, Escherichia coli, Streptomyces, and Bacillus megaterium. However, GAD from these sources has shortcomings such as poor thermal stability, a narrow pH stability range, and low affinity for substrates, making it difficult to meet the needs of industrial applications. In 2019, Fang Hui's team introduced proline into the GAD of L. brevis CGMCC No. 1306, enhancing the hydrophobic interactions around site 364 and significantly improving the thermal stability of G364P. In 2020, Zhang Qingfei's research group significantly improved the thermal stability of GAD1407 by introducing a disulfide bond. The efficient expression and high enzyme activity of glutamate decarboxylase are the key to the whole-cell catalytic production of GABA. In 2019, Yang Yuan'e et al. constructed a recombinant Escherichia coli glutamate decarboxylase expression strain. By optimizing the induction conditions, the expression of soluble protein was improved, and the GAD enzyme activity reached 41.2U / mL, an increase of 11.1%. In 2020, Qiu Ling et al. introduced GAD from Escherichia coli for expression in Bacillus subtilis. After optimizing the optimal temperature and pH, they introduced pyridoxal oxidase (PdxH), and the recombinant bacterial enzyme activity reached a maximum of 31.86U / mL. In 2023, Rao Zhiming's team selected 9 sites for site-directed mutagenesis and combined mutagenesis based on the surface charge modification of enzyme protein, which broadened the enzyme activity at a neutral pH of 6.0, at 40°C, PLP concentration of 0.1mM, and bacterial cell volume OD 600 Under the condition of 20, the engineered strain C. glutamicum E01 / pXMJ19-LpgadS24R / D88R / Y309K was used in a 5L tank-scaled conversion system. With an initial addition of 100g / L of conversion solution and a total of 1000g of glutamate fed in batches over 14 hours, it efficiently synthesized γ-aminobutyric acid, achieving a yield of 402.8g / L. However, the molar conversion rate was only 52.3%. Li Haixing's team at Nanchang University optimized the culture medium to establish a sodium-free GABA fermentation process for Lactobacillus brevis CD817. However, this process still requires complex separation methods to obtain the final product.

[0004] Although existing research on glutamate decarboxylase (GAD) has made some progress, including improving the enzyme's thermal stability and activity through genetic engineering, some shortcomings still exist. For example, although most GAD mutants reported to date have improved the properties of the enzyme to a certain extent, they still face problems such as insufficient thermal stability, limited pH adaptability, and the need for specific buffer salt solutions in industrial applications. These problems limit the application efficiency and cost-effectiveness of GAD in the large-scale production of γ-aminobutyric acid (GABA). In addition, while existing GAD mutants improve enzyme activity, they are often accompanied by lower molar conversion rates, which not only increases raw material consumption but also affects the yield and purity of the final product. Therefore, developing a glutamate decarboxylase mutant that simultaneously has high thermal stability, a wide pH adaptability range, can maintain high activity without the need for specific buffer salt solutions, and has a high molar conversion rate is of great significance for achieving efficient and low-cost industrial production of GABA. Summary of the Invention

[0005] In view of the shortcomings of the prior art, the present invention obtains a glutamate decarboxylase mutant through a genetic engineering method, which not only improves the activity and stability of the glutamate decarboxylase mutant, but also reduces the optimum pH of the enzyme from 5.0 to 3.5. However, the catalytic activity at pH 5.0 is still retained, which is similar to the pH value of the existing reaction system. The catalytic reaction can be carried out under reaction conditions where the pH is not naturally controlled, thereby providing an effective approach for the industrial production of gamma-aminobutyric acid by enzymatic methods.

[0006] In a first aspect, the present invention provides a glutamate decarboxylase mutant, wherein the amino acid sequence of the mutant has at least 99% homology to SEQ ID NO. 4; more preferably, at least 99.5% homology.

[0007] For the technical solution described above, in a further preferred case, the mutant has the catalytic activity of glutamate decarboxylase, and the amino acid positions 38, 337, and 355 of the reference sequence SEQ ID NO.2 are replaced by asparagine (N), glutamic acid (E), and aspartic acid (D), respectively, i.e., Q38N, R337E, and L355D; in the core functional region, the amino acid sequence outside the mutation site has at least 99% homology to the corresponding core functional region in the reference sequence SEQ ID NO.4, more preferably at least 99.5% homology; and the amino acid sequence in the non-core functional region may be different, allowing certain sequence variations without strict homology requirements. Under the premise of not affecting the core enzyme activity, this part of the sequence may have a certain degree of change or variation. The glutamate decarboxylase mutant described above is modified based on the glutamate decarboxylase of Lactobacillus brevis. By replacing specific amino acids, it is possible not only to enhance the performance of the enzyme, but also to make the host strain taxonomically close to the closely related species of Lactobacillus brevis. Regardless of the specific taxonomy of the host strain, the present invention encompasses all mutant enzymes that may be assigned to species related to Lactobacillus brevis due to specific amino acid substitutions.

[0008] The above-mentioned "homology" refers to the degree of similarity between two or more protein sequences.

[0009] The core functional region of an enzyme is the region with a specific three-dimensional structure that specifically binds to the substrate and catalyzes its conversion to product. This region is known as the enzyme's active center or active site. Within the active center, there are typically several essential groups that are crucial for the enzyme's catalytic activity.

[0010] Essential groups within the active center: These groups are responsible for binding to the substrate, helping to form the enzyme-substrate complex, and catalytic groups that directly participate in the chemical conversion of the substrate and promote the reaction.

[0011] Essential groups outside the active center:

[0012] Although these groups are not directly involved in the catalytic reaction, they are necessary to maintain the spatial conformation of the enzyme active center and serve as binding sites for regulators.

[0013] The active center of an enzyme is highly specific, capable of recognizing and binding to a specific substrate molecule and catalyzing a chemical reaction in the substrate, transforming it into a product. This specificity and high efficiency of enzymes is achieved through the precise structure of the active center and the synergistic action of essential groups.

[0014] For the technical solution described above, in a further preferred case, the amino acid sequence of the mutant is as shown in SEQ ID NO. 4; that is, the glutamate decarboxylase mutant M17 obtained in the embodiment of the present invention.

[0015] For the technical solution described above, in a further preferred case, the mutant is derived from glutamate decarboxylase (gadB) of Lactobacillus brevis.

[0016] For the technical solution described above, in a further preferred embodiment, the mutant has catalytic activity of glutamate decarboxylase; based on the reference sequence SEQ ID NO.1, the mutant undergoes AAC, GAA, and GAT substitutions at nucleotide positions 114, 1011, and 1065, respectively, resulting in changes of Q38N, R337E, and L355D in the amino acid sequence. In its core functional region, except for the above-mentioned mutation sites, the remaining nucleotide sequence has at least 99.5% homology with the corresponding core functional region of the reference sequence SEQ ID NO.3; more preferably, it has at least 99% homology; while the nucleotide sequence in the non-core functional region may differ, and sequence variation within a certain range is allowed, and no strict requirement is made for the homology of this part.

[0017] The above-mentioned "homology" refers to the identity and similarity between two or more nucleotide sequences.

[0018] For the technical solution described above, in a further preferred case, the coding gene sequence of the mutant is shown as SEQ ID NO.3.

[0019] A recombinant bacterial cell, characterized in that: the recombinant bacterial cell comprises a gene expression vector encoding the above-mentioned glutamate decarboxylase mutant, the gene expression vector is selected from one of pET28(a), pUC19, pACYC, pHT254, pHT254-WapA, pXMJ19 or pEC-XK99E; and the expression host cell of the recombinant bacterial cell is selected from one of Escherichia coli (E. coli), Bacillus subtilis (B. subtilis) or Corynebacterium glutamicum (C. glutamicum).

[0020] For the technical solution described above, in a further preferred case, the use of the recombinant bacteria in the preparation of gamma-aminobutyric acid (GABA) is characterized in that the recombinant bacteria performs a bioconversion process under the conditions of pH 3.0-4.0 (preferably pH 3.0-3.5; more preferably pH 3.5) and 35-45° C. (more preferably 40-45° C.; more preferably 40° C.), showing a catalytic efficiency of at least 1-1.5 times that of wild-type glutamate decarboxylase and a half-life of at least 1.5-2.5 times that of wild-type glutamate decarboxylase.

[0021] For the technical solution described above, in a further preferred case, when the mutant is used to prepare γ-aminobutyric acid, the pH range during the bioconversion process is 3.0 to 4.0 (more preferably 3.0 to 3.5; most preferably 3.5). Therefore, after the reaction is completed, there is no need to adjust the pH value or introduce additional salts, and only the bacterial cells need to be removed by centrifugation. At this point, the reaction solution mainly contains γ-aminobutyric acid and water, and the resulting supernatant can be directly concentrated and dried to obtain a γ-aminobutyric acid product with higher purity without the need for additional desalting steps. This greatly simplifies the subsequent purification process.

[0022] For the technical solution described above, in a further preferred case, the catalytic system of the recombinant bacteria in use comprises 4-6M glutamate substrate, 0.03-0.07mM pyridoxal 5-phosphate and 10-25g / L (wet weight) of recombinant bacteria cells for reaction.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The γ-glutamylmethylamine synthetase mutant obtained by the genetic engineering method of the present invention has significantly improved properties compared with the wild strain, as shown in the following aspects:

[0025] (1) The optimal pH of the mutant was reduced from 5.0 to 3.5, and it also had high catalytic activity at pH 5.0; this means that M17 can maintain high catalytic activity in a wider pH range, avoiding the introduction of salt ions and reducing separation difficulty and cost.

[0026] (2) The production intensity of M17 under optimal conditions is 1.4 times that of the original bacteria; this significant improvement means that within the same production time, the production efficiency and economic benefits are greatly improved.

[0027] (3) The thermal stability of the enzyme was significantly improved. At pH 5.0, the half-life of the M17 mutant was 1.78 times that of the original bacteria; at pH 3.5, the half-life increased to 2.22 times the original; this is of great significance for low pH tolerance and reducing the introduction of salt.

[0028] (4) The optimal pH of the enzyme is close to the pH of the initial reaction system. No salt ions are introduced into the reaction system, and desalting and purification are not required, which simplifies the subsequent purification process, thereby reducing product loss, shortening the production cycle, and reducing industrial costs.

[0029] (5) Comparative analysis revealed that when the M17-specific mutation sites (Q38N, R337E, and L355D) were added to other mutants, these mutants showed significant improvements in γ-aminobutyric acid production efficiency. Similar trends were observed in all tested mutants, demonstrating the nonobviousness of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The optimal pH of the original bacteria and mutants;

[0031] Figure 2 Optimum temperature of the original bacteria and mutants. DETAILED DESCRIPTION

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments.

[0033] In the present invention, unless otherwise specified, percentages and contents are all by mass. Unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used can be purchased from commercial sources.

[0034] Example 1 Construction of mutants

[0035] The glutamate decarboxylase gene gadB from Lactobacillus brevis was fully synthesized by a gene synthesis company after codon optimization. The base sequence is shown in SEQ ID NO.1. It was ligated into the plasmid pET28(a) and transformed into E. coli BL21(DE3). The original strain E. coli BL21(DE3)-pET28(a)-gadB was named WT.

[0036] The method for obtaining a glutamate decarboxylase mutant comprises the following steps:

[0037] 1. Follow QuickMutation TM Gene random mutagenesis kit designed primers and random mutations, the primer sequences are:

[0038] random-F:gatatacatatgataaataacgtagatctag; SEQ ID NO.5;

[0039] random-R: ggtggtggtgctcgagactgcgcactgtgg; SEQ ID NO.6;

[0040] 2. Random Mutagenesis PCR Reaction

[0041] Random mutation PCR reaction: Refer to the following table to set up the random mutation PCR reaction system:

[0042] Table 1 Random mutagenesis PCR reaction system

[0043]

[0044] Set up the PCR instrument according to the following parameters:

[0045] Table 2 PCR instrument parameter settings

[0046]

[0047] 3. Transformation of Competent Cells

[0048] Take 10 μL of PCR product and detect it on 1% agarose. After the target band is observed, add 1 μL of DpnI enzyme to the remaining PCR product and incubate at 37°C for 1 hour. Add 2-5 μL of digestion product to 50 μL of competent cells, mix well and place on ice for 30 minutes, then heat-shock in a 42°C water bath for 45 seconds, and immediately place on ice for 2-5 minutes. Then add 250 μL of LB medium, culture at 200 rpm and 37°C for 1 hour, take 100-200 μL of bacterial solution and culture overnight on a kanamycin-resistant plate. Multiple mutants were obtained, among which the mutant with improved thermal stability and optimal temperature was named M17. The amino acid sequence is shown in SEQ ID NO.2. The M17 mutants are Q38N, R337E, and L355D.

[0049] 4. Expression of glutamate decarboxylase:

[0050] The original bacteria and mutants were cultured in LB medium (kanamycin 50 mg / L) at 37°C and 200 rpm overnight, and 5% inoculation was inoculated into the fermentation medium for expansion culture. 600 =0.4~1.0, add 0.3mM IPTG, induce at low temperature overnight, and collect wet cells of glutamate decarboxylase by centrifugation as catalyst.

[0051] The seed culture medium and fermentation culture medium are composed of 5 g / L yeast extract, 10 g / L peptone, and 10 g / L NaCl. The mixture is sterilized at 121° C. for 20 min, and kanamycin is added to a final concentration of 10 to 100 mg / mL after cooling.

[0052] Example 2 Effect of pH on Enzyme Properties

[0053] Enzyme reactions have their optimal pH range. Too high or too low a pH value will affect the activity of the enzyme catalytic reaction. This experiment will simultaneously determine the optimal reaction pH of the unmutated WT and mutant M17. Prepare several groups of 100mL reaction solutions. The reaction system contains 50mM glutamate, 0.05mM pyridoxal 5-phosphate, and 5g / L glutamate decarboxylase wet bacteria. Adjust the pH value to 3.0-6.0 respectively, place it at 40℃ for 30min, and measure the changes in γ-aminobutyric acid in the reaction solution by HPLC at regular intervals. The catalytic yield of the unmutated product measured at pH = 5.0 is used as the control and recorded as 100%. The relative enzyme activity at other pH values ​​is calculated based on this.

[0054] Enzyme activity of glutamate decarboxylase (U): Unit enzyme activity is defined as the amount of enzyme required to catalyze glutamate to produce 1 μmol of γ-aminobutyric acid per minute at 40°C and pH 5.0.

[0055] Relative enzyme activity of glutamate decarboxylase (U / mg): the enzyme activity per mg of glutamate decarboxylase.

[0056] The results are as follows Figure 1 As shown, the optimal pH of mutant M17 is reduced, with the optimal pH of WT at 5.0-5.5, while that of mutant M17 is at 3.0-3.5. This indicates that mutant M17 has a wider pH range of adaptability and exhibits higher enzyme activity even under uncontrolled reaction conditions. This property makes mutant M17 more advantageous in practical production, especially in environments where reactions require lower pH values.

[0057] Example 3 Effect of temperature on enzyme properties

[0058] Temperature can alter the rate of enzyme-catalyzed reactions and also lead to reduced or inactivated enzyme protein activity. The optimal reaction temperatures for the unmutated WT and mutant M17 were determined simultaneously. Reactions were performed at 35, 40, 45, 50, and 55°C for 30 min. The reaction system contained 50 mM glutamate, 0.05 mM pyridoxal-5-phosphate, and 5 g / L of wet glutamate decarboxylase cells at their respective optimal pH solutions. HPLC was used to regularly measure changes in γ-aminobutyric acid in the reaction solution. The enzyme activity of the WT at 40°C was taken as 100%, and the relative enzyme activity at other temperatures was calculated.

[0059] The results are as follows Figure 2 As shown, the optimum temperature of WT is 40℃, and the optimum temperature of mutant M17 is consistent with that of the original bacteria WT, but the relative activity is significantly improved.

[0060] Unmutated WT and mutant M17 were incubated at 40°C at pH 5.0 and 3.5, respectively. Residual enzyme activity at different incubation times was determined, with the unmutated enzyme activity defined as 100%. The results, shown in Table 3, show that at pH 5.0, the half-life of mutant M17 was 1.78 times that of WT; at pH 3.5, the half-life of mutant M17 was 2.22 times that of WT. This demonstrates that M17 tolerates low pH.

[0061] Table 3 Half-life at each optimal pH

[0062] Half-life / h pH 5.0 pH 3.5 WT 5.98 3.03 M17 10.67 6.73

[0063] Enzyme reactions have their optimal pH range. Too high or too low a pH value will affect the activity of the enzyme catalytic reaction. This experiment will simultaneously determine the optimal reaction pH of the unmutated WT and mutant M17. Prepare several groups of 100mL reaction solutions. The reaction system contains 50mM glutamate, 0.05mM pyridoxal 5-phosphate, and 5g / L glutamate decarboxylase wet bacteria. Adjust the pH value to 3.0-6.0 respectively, place it at 40℃ for 30min, and measure the changes in γ-aminobutyric acid in the reaction solution by HPLC at regular intervals. The catalytic yield of the unmutated product measured at pH = 5.0 is used as the control and recorded as 100%. The relative enzyme activity at other pH values ​​is calculated based on this.

[0064] Example 4 Effects of different carriers

[0065] The in-fusion cloning technique was used to construct WT and M17 recombinant plasmids on different vectors (pUC19 and pACYC vectors). The recombinant plasmids were transformed into competent Escherichia coli cells. The bacterial liquid was spread on corresponding resistance plates and cultured overnight to obtain engineered bacteria. The effects of different vectors on glutamate decarboxylase activity were evaluated.

[0066] E.coliBL21(DE3) / pUC19-gadB-WT、

[0067] E.coliBL21(DE3) / pUC19-gadB-M17、

[0068] E.coliBL21(DE3) / pACYC-gadB-WT、

[0069] E.coliBL21(DE3) / pACYC-gadB-M17,

[0070] They were named WT-1, M17-1 and WT-2, M17-2 respectively.

[0071] Use LB medium to culture the engineered bacteria (pUC19 ampicillin 100 mg / L or pACYC chloramphenicol 50 mg / L), and wait until the cell OD 600 =0.4-1.0, add 0.3 mM IPTG, induce at low temperature overnight, and collect wet cells of glutamate decarboxylase by centrifugation as a catalyst.

[0072] The seed culture medium and fermentation culture medium are composed of 5 g / L yeast extract, 10 g / L peptone, and 10 g / L NaCl. The mixture is sterilized at 121° C. for 20 min, and kanamycin is added to a final concentration of 10 to 100 mg / mL after cooling.

[0073] The engineered bacteria WT-1 and WT-2 from Example 4 were used in conjunction with the original bacteria WT to convert the glutamate substrate. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM pyridoxal 5-phosphate, and 5 g / L of glutamate decarboxylase wet cells), the reaction was carried out at 40°C and pH 5.0-5.5 for 30 min. The changes in γ-aminobutyric acid in the reaction solution were measured periodically by HPLC. The production level of WT measured under these conditions was taken as 100%. The relative production levels of WT-1 and WT-2 were 98.6% and 99.3%, respectively.

[0074] The engineered bacteria M17-1 and M17-2 in Example 4 were used to convert the glutamate substrate to the original mutant strain M17. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM pyridoxal 5-phosphate, and 5 g / L of glutamate decarboxylase wet cells), the reaction was carried out at 40°C and pH 3.0-3.5 for 30 min. The changes in γ-aminobutyric acid in the reaction solution were measured by HPLC at regular intervals. The production level of M17 measured under these conditions was taken as 100%. The relative production levels of M17-1 and M17-2 were 99.4% and 99.2%, respectively.

[0075] This indicates that the M17 mutant has little effect on the expression and activity of glutamate decarboxylase in different vectors (pUC19 and pACYC), and WT and M17 perform similarly in both vectors. Both have good versatility and application potential.

[0076] Example 5 Effects of Different Hosts

[0077] According to conventional molecular manipulation methods, WT and M17 were expressed in Bacillus subtilis using pHT254 and pHT254-WapA. The engineered bacteria were obtained:

[0078] B.subtilis168-pHT254-P grac100 -gadB-WT,

[0079] B.subtilis168-pHT254-P grac100 -gadB-M17,

[0080] B.subtilis168-pHT254-P grac100 -WapA-gadB-WT,

[0081] B. subtilis 168-pHT254-P grac100 -WapA-gadB-M17,

[0082] They were named WT-3, M17-3 and WT-4, M17-4 respectively.

[0083] The glutamate decarboxylase gene (gadB) of WT and M17 was expressed in Corynebacterium glutamicum using pXMJ19 and pEC-XK99E according to conventional molecular manipulation methods. The following engineered bacteria were obtained to evaluate the effect of different hosts on glutamate decarboxylase activity.

[0084] Corynebacterium glutamicumATCC 13002 / pXMJ19-gadB-WT,

[0085] Corynebacterium glutamicumATCC 13002 / pXMJ19-gadB-M17,

[0086] Corynebacterium glutamicumATCC 13002 / pEC-XK99E-gadB-WT,

[0087] Corynebacterium glutamicumATCC 13002 / pEC-XK99E-gadB-M17,

[0088] They were named WT-5, M17-5 and WT-6, M17-6 respectively.

[0089] Bacillus subtilis was cultured in 2×YT medium (chloramphenicol 10 mg / L) at 37°C and 200 rpm overnight, and inoculated into the fermentation medium at a 5% inoculum volume for expansion. 600 =0.5-0.8, 1 mM IPTG was added, and the mixture was induced at low temperature overnight. The wet cells of glutamate decarboxylase of WT-3 and M17-4 were collected by centrifugation as catalysts. The supernatant of glutamate decarboxylase of WT-4 and M17-4 were collected by centrifugation as catalysts.

[0090] 2×YT seed medium and fermentation medium: yeast extract powder 10 g / L, peptone 16 g / L, NaCl 5 g / L, sterilize at 121°C for 20 min, and add chloramphenicol to a final concentration of 10-50 mg / mL after cooling.

[0091] Corynebacterium glutamicum was cultured in LBB medium (pEC-XK99E kanamycin 50 mg / L or pXMJ19 chloramphenicol 20 mg / L) and inoculated into the fermentation medium at 5% inoculum for expansion. 600 =0.4-0.6, 0.1 mM IPTG was added, induced at low temperature overnight, and the whole cells were harvested by centrifugation as catalysts.

[0092] LBB seed culture medium and fermentation medium: yeast extract 5 g / L, peptone 10 g / L, NaCl 10 g / L, brain heart extract 10 g / L, sterilize at 121 ° C for 20 min, and add chloramphenicol to a final concentration of 10-50 mg / mL after cooling.

[0093] The engineered bacteria WT-3, WT-4, WT-5, and WT-6 from Example 5 were used in conjunction with the original bacteria WT to convert the glutamate substrate. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM pyridoxal 5-phosphate, and 5 g / L glutamate decarboxylase cells), the reaction was carried out at 40°C and pH 5.0-5.5 for 30 min. The changes in gamma-aminobutyric acid in the reaction solution were measured by HPLC at regular intervals. The production level of WT measured under these conditions was taken as 100%. The relative production levels of WT-3, WT-4, WT-5, and WT-6 were 99.2%, 99.1%, 99.4%, and 99.1%, respectively.

[0094] The engineered bacteria M17-3, M17-4, M17-5, and M17-6 in Example 5 were subjected to glutamate substrate conversion with the original mutant strain M17. In a 100 mL reaction system (containing 50 mM glutamate, 0.05 mM pyridoxal 5-phosphate, and 5 g / L of glutamate decarboxylase cells), the reaction was carried out at 40° C. and pH 3.5 for 30 min. The changes in gamma-aminobutyric acid in the reaction solution were measured by HPLC at regular intervals. The production level of M17 measured under these conditions was taken as 100%. The relative production levels of M17-3, M17-4, M17-5, and M17-6 were 99.3%, 99.5%, 99.1%, and 99.2%, respectively.

[0095] This indicates that the M17 mutant has little effect on the expression and activity of glutamate decarboxylase in different hosts (Bacillus subtilis and Corynebacterium glutamicum), and WT and M17 perform similarly in the two hosts, showing good versatility and application potential.

[0096] Example 6 Scale-up production evaluation

[0097] WT, WT-1, WT-2, WT-3, WT-5, and WT-6 wet cells were used as biocatalysts, using glutamate as the substrate for bioconversion to produce γ-aminobutyric acid. A 10-liter catalytic system contained 5 M glutamate, 0.05 mM pyridoxal 5-phosphate, and 20 g / L of wet cells. The reaction system was carried out in an aqueous solution at 40°C, pH 5.0-5.5. After completion of the reaction, cells were removed by centrifugation, and samples were filtered through a 0.22 μm membrane before HPLC analysis of γ-aminobutyric acid production.

[0098] γ-aminobutyric acid (GABA) was produced by bioconversion using wet bacterial cultures of M17, M17-1, M17-2, M17-3, M17-5, and M17-6 as biocatalysts and glutamate as the substrate. A 10-L catalytic system containing 5 M glutamate, 0.05 mM pyridoxal 5-phosphate, and 20 g / L of wet bacterial cultures was used. The reaction was carried out in aqueous solution at 40°C. After completion of the reaction, cells were removed by centrifugation, and samples were filtered through a 0.22 μm membrane before HPLC analysis of GABA yield.

[0099] WT-4 extracellular supernatant was used as a biocatalyst, and glutamate was used as a substrate for bioconversion to produce γ-aminobutyric acid. A 10-liter catalytic system containing 5 M glutamate, 0.05 mM pyridoxal 5-phosphate, and 20 g / L of wet bacterial cells was used. The reaction was carried out in a 40°C, pH 5.0-5.5 aqueous solution. After completion of the reaction, cells were removed by centrifugation, and the sample was filtered through a 0.22 μm membrane before HPLC analysis of γ-aminobutyric acid production.

[0100] GABA was produced by bioconversion using M17-4 extracellular supernatant as a biocatalyst and glutamate as a substrate. A 10-L catalytic system containing 5 M glutamate, 0.05 mM pyridoxal 5-phosphate, and 20 g / L of wet bacterial cells was used. The reaction was carried out in aqueous solution at 40°C. After completion of the reaction, the sample was centrifuged, filtered through a 0.22 μm membrane, and analyzed by HPLC for GABA production.

[0101] The results are shown in Table 4. The maximum yield of γ-aminobutyric acid produced by mutant M17 is close to 5M, which is 510.6g / L. The reaction time is 15h and the production intensity is 34.04g / L / h, which is 1.4 times that of the original bacteria.

[0102] The production intensity of the original bacteria WT and mutant M17 was 100%, the relative production intensities of WT-1, WT-2, WT-3, WT-4, WT-5, and WT-6 were 99.8%, 99.9%, 99.9%, 99.9%, 100%, and 99.8%, respectively; the relative production intensities of M17-1, M17-2, M17-3, M17-4, M17-5, and M17-6 were 99.9%, 99.9%, 99.9%, 99.8%, 99.8%, and 99.9%, respectively.

[0103] The catalytic ability of WT expressed by the engineered bacteria with replaced vectors and hosts was similar to that of the original bacteria WT, and the catalytic ability of M17 expressed by the engineered bacteria with replaced vectors and hosts was similar to that of the mutant M17, indicating that the M17 mutant has stable high catalytic efficiency under different conditions and has broad prospects for industrial application.

[0104] Table 4 Comparison of catalytic ability of engineered bacteria with replacement of vector and host

[0105]

[0106]

[0107] The mutant M17 catalyzed the substrate to produce γ-aminobutyric acid with a maximum yield of nearly 5M, equivalent to 510.6g / L. The reaction time was 15h and the production intensity was 34.0g / L / h, which was 1.4 times that of the original bacteria.

[0108] The catalytic abilities of other engineered bacteria with replaced vectors and hosts were similar to those of the original bacteria WT and mutant M17, indicating that the M17 mutant had stable high catalytic efficiency under different conditions.

[0109] This suggests that the M17 mutant has significant advantages in large-scale production and is suitable for industrial applications.

[0110] Effect of Example 7 on the Separation Process

[0111] (1) Removal of bacteria: The WT and M17 enzyme conversion solutions in Example 6 were centrifuged at 5000 rpm for 10 minutes to remove bacterial cells, and the supernatant was separated to obtain a crude solution containing γ-aminobutyric acid;

[0112] (2) Membrane filtration: The crude γ-aminobutyric acid solution was filtered through a primary ceramic membrane (pore size 50 nm), and the retentate was taken to obtain the γ-aminobutyric acid stock solution;

[0113] (3) Concentration and drying: Using a triple-effect evaporator at a pressure of 25 kPa and a temperature of 65° C., the eluate is concentrated to a dry matter concentration of 50%, and then the wet crystals are dried to obtain white γ-aminobutyric acid crystal particles.

[0114] (4) Purity detection: The γ-aminobutyric acid crystal particles obtained after concentration and drying were made into a liquid solution. The solution was filtered through a 0.22 μm membrane and then the purity of γ-aminobutyric acid was detected by HPLC. The results are shown in Table 5.

[0115] Table 5 γ-aminobutyric acid content

[0116] γ-aminobutyric acid content% Crystal particle moisture % Isolation yield% WT 79.6 0.8 88.4 M17 99.2 0.5 90.7

[0117] The filtrate of M17 is uniform, clear, and stable. No salt ions are introduced into the reaction system, and no desalting and purification processes such as ion exchange are required, thereby reducing product loss and lowering separation costs. However, the separation liquid of WT contains a large amount of salt ions, and high-purity γ-aminobutyric acid crystals cannot be obtained through simple recovery operations.

[0118] Comparative Example 1: Transformation effects of other mutants:

[0119] The wet bacteria of other mutants obtained in Example 1 were used as biocatalysts to prepare γ-aminobutyric acid by biotransformation. The catalytic system was 100 mL, and the reaction system contained 50 mM glutamic acid, 0.05 mM pyridoxal 5-phosphate, and 5 g / L glutamate decarboxylase cells. The reaction system was reacted in an aqueous solution at 40°C and pH = 3.5. After 30 minutes of reaction, the cells were removed by centrifugation. The sample was filtered with a 0.22 μm membrane and then HPLC was used to detect the yield of γ-aminobutyric acid. The mutation sites of the mutants and the γ-aminobutyric acid catalytic ability are shown in Table 5. The results show that the mutation effects of other mutants are not as good as M17, but on the basis of the mutation sites of M17, their catalytic abilities have been greatly improved compared with before.

[0120] Table 5 Comparison of catalytic ability of other mutants

[0121]

[0122] Note: The underlined ones are the mutation sites of the M17 strain screened in this patent.

[0123] In summary, through the comparative analysis of the comparative examples and examples of the present application in Table 5, it can be seen that when the mutation sites (Q38N, R337E, L355D) unique to the M17 strain are added to other mutants, these mutants have a significant improvement in the production efficiency of γ-aminobutyric acid. For example, when the mutants Q65N&D106C&K155I&G287A&F338C are used alone, the γ-aminobutyric acid production is 289.6 g / L, and the reaction time is 20 hours; after combining with the mutation sites of M17, the production is increased to 449.6 g / L, and the reaction time is shortened to 15 hours. Similar trends can be observed in all mutants tested. These mutants all contain the key mutation sites Q38N, R337E, and L355D, and maintain high homology in the core functional region. The mutants obtained can significantly improve their production intensity when applied to the γ-aminobutyric acid synthesis process, and not any similar mutations can achieve the ideal effect. The combination of these specific mutation sites plays an important role in improving the activity of glutamate decarboxylase.

[0124] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included in the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection of the claims.

Claims

1. A glutamate decarboxylase mutant, characterized in that: The amino acid sequence of the mutant is shown in SEQ ID NO.

4.

2. The glutamate decarboxylase mutant according to claim 1, wherein: The mutant is based on glutamate decarboxylase GadB derived from Lactobacillus brevis and is obtained through mutation.

3. The glutamate decarboxylase mutant according to claim 1, wherein: The coding gene sequence of the mutant is shown in SEQ ID NO.

3.

4. A recombinant bacterial cell, characterized in that: The recombinant bacterium comprises a gene expression vector encoding the glutamate decarboxylase mutant according to claim 1, wherein the gene expression vector is selected from one of pET28(a), pUC19, pACYC, pHT254, pHT254-WapA, pXMJ19 or pEC-XK99E; and the expression host cell of the recombinant bacterium is selected from one of Escherichia coli, Bacillus subtilis or Corynebacterium glutamicum.

5. Use of the recombinant bacterial cell according to claim 4 in the preparation of γ-aminobutyric acid, characterized in that: The recombinant bacteria undergo a biotransformation process under conditions of pH 3.0-4.0 and 35-45° C. After the biotransformation is completed, the bacterial cells are removed by centrifugation, and the resulting supernatant is directly concentrated and dried to obtain a high-purity γ-aminobutyric acid product.

6. The use according to claim 5, characterized in that: The catalytic system of the recombinant bacteria in the biotransformation process includes: 4-6M glutamate substrate, 0.03-0.07mM pyridoxal 5-phosphate and 10-25g / L recombinant bacteria cells for reaction.

Images