Alkali-resistant staphylococcus aureus phage recombinant lyase as well as preparation method and application thereof

Abstract

The invention discloses alkali-resistant staphylococcus aureus bacteriophage recombinant lyase as well as a preparation method and application thereof, and relates to the field of bioengineering, the lyase is SALcd, the preparation method comprises amplification, recombinant plasmid construction, transformation expression and protein purification, the lyase is applied to control of various staphylococcus aureus and other staphylococcus, and the lyase can be used for preparing alkali-resistant staphylococcus aureus bacteriophage recombinant lyase. The lyase provided by the invention can be used when active auxiliary factors exist, can be applied to the food processing industry, can tolerate an alkaline environment, and has high cracking activity.

Description

Technical Field

[0001] The invention relates to the field of bioengineering, and in particular to an alkali-resistant Staphylococcus aureus phage recombinant lytic enzyme, a preparation method and an application thereof. Background Art

[0002] Staphylococcus aureus is a Gram-positive pathogen that can cause many diseases and even endanger life. Among them, foodborne Staphylococcus aureus can cause food poisoning and infection, causing vomiting or diarrhea. During food preparation and processing, foodborne Staphylococcus aureus can contaminate food and is commonly found in meat and meat products, milk and dairy products.

[0003] The emergence of penicillin made it possible to better control infectious diseases caused by Staphylococcus aureus at the time. However, with the widespread use of penicillin, penicillin-resistant Staphylococcus aureus appeared in clinical practice. Although new antibiotics have emerged since then, the widespread use of antibiotics has led to an escalation of the bacterial resistance crisis, such as methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant Staphylococcus aureus, and multidrug-resistant Staphylococcus aureus, which pose a serious threat to public health. Therefore, it is necessary to research and develop new antimicrobial agents to combat infections caused by Staphylococcus aureus.

[0004] Phage lytic enzymes have become potential antibacterial drugs due to their high efficiency, safety, low resistance to drug resistance and easy structural modification. Most lytic enzymes of phages that infect Staphylococcus aureus are composed of two parts: the enzymatic activity domain (EAD) and the cell wall binding domain (CBD). EAD is composed of an N-terminal endopeptidase, namely a cysteine, histidine-dependent amidohydrolase / peptidase (CHAP) domain and an amidase (AMI) domain. For most lytic enzymes with two EADs, the cleavage activity mainly depends on the CHAP domain at the N-terminus, and the amidase domain is almost inactive when applied externally.

[0005] At present, the research on Staphylococcus aureus phage lytic enzymes mainly focuses on lytic enzymes that adapt to neutral or weakly acidic environments, and most of them are natural lytic enzymes with low lytic activity, and there are few studies on efficient alkaline-resistant lytic enzymes. Therefore, the development of lytic enzymes that tolerate alkaline environments and have high lytic activity through the method of recombinant domains has become a difficult problem to be solved in this field.

[0006] Therefore, those skilled in the art are committed to developing a new type of bacterial lytic enzyme that is tolerant to alkaline environments and has high lytic activity. Summary of the invention

[0007] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is to provide a new type of bacterial lytic enzyme that is tolerant to alkaline environment and has high lytic activity.

[0008] To achieve the above object, the present invention provides an alkali-resistant Staphylococcus aureus phage recombinant lytic enzyme, characterized in that the lytic enzyme is SALcd, the amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2.

[0009] The present invention also provides a method for preparing the aforementioned alkali-resistant Staphylococcus aureus phage recombinant lytic enzyme, characterized in that the method comprises the following steps:

[0010] Step 1, design primers for the CHAP domain and the CBD domain respectively, and use the artificially synthesized sequence SEQ ID NO.2 as a template for amplification to obtain SALcd-CHAP and SALcd-CBD gene fragments, the sequences of the SALcd-CHAP and SALcd-CBD gene fragments are shown in SEQ ID NO.7 and SEQ ID NO.8 respectively;

[0011] Step 2: clone the gene fragment in step 1 into the expression plasmid in the order of CHAP domain at the N-terminus and CBD domain at the C-terminus to obtain the expression plasmid containing SALcd, and transform it into the expression strain;

[0012] Step 3: Induce expression and purify the strain obtained in step 2 to obtain the truncated lyase SALcd with the amidase domain deleted.

[0013] In a preferred embodiment of the present invention, the primer sequences in step 1 are as follows:

[0014] SEQ ID NO.3

[0015] SAL-CHAP-F:CTTTAAGAAGGAGATATACCATGGCTAAGACTCAAGCAGAA;

[0016] SEQ ID NO.4

[0017] SAL-CHAP-R:TTTTTCCAAGAATTCTTAGAAACTTTTAGTGTTGCT;

[0018] SEQ ID NO.5

[0019] SAL-CBD-F:TTCTAAGAATTCTTGGAAAAAGAACCAGTAC;

[0020] SEQ ID NO.6

[0021] SAL-CBD-R:CAGTGGTGGTGGTGGTGGTGTTTGAATACTCCCCAGGC.

[0022] In another preferred embodiment of the present invention, the steps 2 and 3 specifically include:

[0023] Step 2.1, the gene fragment obtained in step 1 and the pET28a plasmid double-digested with NcoⅠ and XhoⅠ were excised and recovered, and the gene fragment and plasmid were added into the seamless cloning system for reaction;

[0024] Step 2.2, transform the seamless cloned product into E. coli DH5α competent cells, spread the bacterial solution on an LB plate containing kanamycin for culture, and then inoculate it into LB broth containing kanamycin for culture, and extract the plasmid, i.e., the recombinant expression plasmid of SALcd;

[0025] Step 2.3, transforming the obtained recombinant expression plasmid into E. coli BL21 competent cells, spreading the bacterial solution on an LB plate containing kanamycin for culture, inoculating it into LB broth containing kanamycin for culture, and preserving the bacterial solution;

[0026] Step 3.1, activate the strain obtained in step 2.3, then transfer the culture and add IPTG to induce expression;

[0027] Step 3.2, collect the bacteria by centrifugation, wash them, add lysis buffer according to the proportion, centrifuge after the bacterial solution becomes clear, and separate the supernatant precipitate;

[0028] Step 3.3, filter the bacterial crushing supernatant with a filter membrane, use this as the sample, and use a Ni-NTA pre-loaded gravity column to purify the lysate. In each step, control the liquid volume in the column to be consistent, ensure consistent pressure, and liquid flow rate. Perform SDS-PAGE detection on the sample flow-through, wash liquid, and eluate to determine the elution concentration of the target protein with a single band. Collect the eluate of this concentration, perform ultrafiltration concentration, and freeze it at -80°C.

[0029] The present invention also provides application of the above-mentioned alkali-resistant Staphylococcus aureus phage recombinant lytic enzyme.

[0030] In a preferred embodiment of the present invention, the lytic enzyme is used at pH 8.0-11.0.

[0031] In another preferred embodiment of the present invention, the lytic enzyme is used at room temperature.

[0032] In another preferred embodiment of the present invention, the lytic enzyme is used to control a variety of Staphylococcus aureus and other Staphylococci, including Staphylococcus capitis, Staphylococcus sciuri, Staphylococcus veal and Staphylococcus epidermidis.

[0033] In another preferred embodiment of the present invention, the lyase is used in the presence of an active cofactor, wherein the active cofactor is Ca 2+ or Mg 2+ .

[0034] In another preferred embodiment of the present invention, the lyase is applied in the food processing industry and is used directly as a spray, or is encapsulated in pH-sensitive liposomes and triggered to release in an alkaline environment.

[0035] Technical Effects

[0036] 1. The present invention provides a highly efficient alkaline-resistant Staphylococcus aureus phage recombinant lytic enzyme with a simple structure and a molecular weight of 32.2 kD.

[0037] 2. The present invention changes the properties of the lytic enzyme through domain recombination, so that SALcd has stronger tolerance to alkaline environments, with an optimal pH of 11.0, and a wide range of maintaining high activity. The relative activity is above 80% in an environment of pH 9.0-11.0. SALcd can be used in alkaline environments, such as in the food processing industry, and can be used directly as a spray, or can be encapsulated in pH-sensitive liposomes and triggered to release in an alkaline environment; the efficient, alkaline-resistant Staphylococcus aureus phage recombinant lytic enzyme provided by the present invention has an optimal action temperature of room temperature, which is more suitable for application in food processing environments.

[0038] 3. The SALcd of the present invention can quickly kill Staphylococcus aureus at a relatively low concentration. When the sterilization time is 10 min, the lysis rate at a unit concentration is 1.00×10 -3 When sterilization was carried out for 30 minutes, the lysis rate at unit concentration was 6.00×10 -4 By changing the properties of the lytic enzyme through domain recombination, SALcd has higher activity and can kill bacteria faster when used.

[0039] 4. SALcd has a strong metal cofactor Mg 2+ , the activity increased by 102.23% at 1.250mmol / L. By changing the properties of the lyase through domain recombination, SALcd can be used with Mg 2+ Used in combination, such as making a formulated preparation.

[0040] 5. By changing the properties of the lytic enzyme through domain recombination, SALcd can control a variety of Staphylococcus aureus and other Staphylococci, and the application range of SALcd is wider.

[0041] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is an electrophoretic diagram of the identification and purification of SALcd (32.2 kD) in a preferred embodiment of the present invention;

[0043] Figure 2 This is a diagram showing the activity results of SALcd at different pH values ​​in a preferred embodiment of the present invention;

[0044] Figure 3 This is a diagram showing the activity results of SALcd at different temperatures in a preferred embodiment of the present invention;

[0045] Figure 4 This is a SALcd fragmentation spectrum measurement result diagram of a preferred embodiment of the present invention;

[0046] Figure 5 This is a graph showing the activity results of SALcd under different auxiliary factors according to a preferred embodiment of the present invention. DETAILED DESCRIPTION

[0047] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0048] The plasmid pET28a-SALcd and the expression strain of the highly efficient alkaline-resistant Staphylococcus aureus phage recombinant lytic enzyme provided by the present invention are both constructed by this laboratory. All standard strains of Staphylococcus aureus and other Staphylococci involved in the present invention are derived from the American Type Culture Collection (ATCC): ATCC 12600, ATCC 27664, ATCC14458, ATCC 25923, ATCC 13565, ATCC BAA-1717, ATCC 29213, ATCC13813, ATCC 14028 (the above strains are purchased from the American Type Culture Collection); China Industrial Microbiological Culture Collection Center (CICC): CICC21722, CICC 23471, CICC 10850, CICC 10294 (the above strains are purchased from the China Industrial Microbiological Culture Collection Center); China Medical Bacteria Culture Collection Center (CMCC): CMCC (B) 26069 (purchased from the China Medical Bacteria Culture Collection Center).

[0049] The Staphylococcus aureus phage recombinant lytic enzyme SALcd provided by the invention is obtained by recombining the natural lytic enzyme SAL-1 with only the CHAP domain and the CBD domain retained, and SAL-1 is derived from Staphylococcus aureus phage SAP-1.

[0050] By appropriately truncating the natural lyase, the molecular weight of the natural enzyme can be reduced, making its structure simpler, while also improving its effect and changing its optimal range of action.

[0051] Example 1: Construction of plasmid pET28a-SALcd and expression strain

[0052] The gene fragments of SALcd-CHAP and SALcd-CBD were amplified by the primers in Table 1. The lengths of the amplified fragments were 615 bp and 318 bp, respectively. The results were identified by agarose gel electrophoresis, and bright bands with correct positions were obtained. The target gene fragments were cut and recovered from pET28a after double digestion with NcoⅠ and XhoⅠ, and added to the seamless cloning system reaction at a ratio of 3:1 between the fragment and the plasmid.

[0053] Transform the seamless cloning product into E.coli DH5α competent cells, spread the bacterial solution on an LB plate containing kanamycin, and culture overnight. Pick a single colony and use T7 universal primers for colony PCR and gel electrophoresis identification. Sequence and compare the PCR products corresponding to the bright and correctly positioned bands, pick the corresponding colonies with the correct results and inoculate them into LB broth containing kanamycin for culture, preserve the bacterial solution, and extract the plasmid. Transform the obtained recombinant plasmid into E.coli BL21 (DE3) competent cells, spread the bacterial solution on an LB plate containing kanamycin, and culture overnight. Pick a single colony for PCR and gel electrophoresis identification, sequence the corresponding products with the correct band positions, pick the corresponding colonies with the correct comparison results and inoculate them into LB broth containing kanamycin for culture, and preserve the bacterial solution.

[0054] Table 1 Amplification primers

[0055]

[0056] Example 2. Expression and purification of truncated lyase SALcd

[0057] The activated strain was cultured for 8 hours, and then the activated strain was transferred at a ratio of 1:100, and cultured at 37°C, 200rpm until OD600 was 0.4-0.8, and IPTG with a final concentration of 0.5mmol / L was added, and then induced expression overnight at 16°C, 150rpm. The cells were then collected by centrifugation, washed with Tris-HCl, and lysed at 4°C after adding lysis buffer in proportion. After the bacterial solution became clear and transparent, it was centrifuged, the supernatant precipitate was separated, and SDS-PAGE was performed respectively.

[0058] The bacterial supernatant was filtered through a 0.22 μm filter membrane and used as the sample. The lysate was purified using a Ni-NTA pre-loaded gravity column. The liquid volume in the column was controlled to be consistent in each step, and the pressure and liquid flow rate were consistent to obtain a better purification effect.

[0059] (1) Washing: Open the gravity column, wait for the storage buffer to flow out, and then add 10 times the column volume of ddH2O for washing;

[0060] (2) Equilibration: Add 10 column volumes of PBS for equilibration;

[0061] (3) Loading: Add the supernatant after induced expression and collect the flow-through;

[0062] (4) Wash: Add 10 column volumes of PBS for washing and collect the wash solution;

[0063] (5) Elution: add 8 times column volume of imidazole eluent in order to elute from low to high concentration, i.e., from 25 mmol / L, 50 mmol / L, 100 mmol / L, 200 mmol / L, 250 mmol / L, 300 mmol / L to 500 mmol / L imidazole, and collect the eluents respectively;

[0064] (6) Washing: Add 10 column volumes of ddH2O and 20% ethanol for washing;

[0065] (7) Storage: Fill the container with 20% ethanol, seal it, and store it at 2-8°C.

[0066] The sample flow-through, wash solution and eluate were subjected to SDS-PAGE detection to determine the elution concentration at which the target protein has a single band, and the eluate at this concentration was collected for ultrafiltration concentration.

[0067] Take an ultrafiltration concentration tube with a suitable molecular weight cutoff, add 15 mL of ddH2O, centrifuge at 4000g at 4°C for washing, then add the eluate with a single band of the target protein, centrifuge at 4°C, 4000g for 10 min, discard the liquid below, add protein replacement buffer to the small groove above, centrifuge at 4°C, 4000g for 30 min, after replacement 3-5 times, aspirate the buffer containing a large amount of lytic enzyme from the small groove, divide it into portions and freeze it at -80°C.

[0068] Figure 1 This is the electrophoresis diagram for the identification of purified SALcd (32.2kD); M: protein molecular weight standard; 1, 2: 100mmol / L imidazole eluent; 3-6: 200mmol / L imidazole eluent; 7-10: 250mmol / L imidazole eluent. The results show that a single band with high purity SALcd was obtained.

[0069] Example 3, determination of the optimum pH of the truncated lyase SALcd

[0070] Lysase pretreatment: Take out the purified SALcd from the ultra-low temperature freezer and immediately thaw it on ice. Calculate the required concentration and dilute the lysase in a buffer of the corresponding pH. For pH 4 and 5, use 20mmol / L citrate buffer; for pH 6-8, use phosphate buffer solution; for pH 9-12, use 20mmol / L glycine buffer.

[0071] Pretreatment of Staphylococcus aureus: inoculate the standard strain of Staphylococcus aureus ATCC BAA-1717 into TSB broth, culture at 37°C, 200 rpm until the logarithmic phase, centrifuge, wash twice with phosphate buffer solution, and then blow with a buffer of the corresponding pH until the bacteria are evenly dispersed and sterile blocks are precipitated.

[0072] Turbidity reduction experiment: The reaction was carried out in a 96-well plate. 100 μL of bacterial suspension was aspirated and 100 μL of lytic enzyme solution of the corresponding pH was added. At this time, the final concentration of the lytic enzyme was 100 nmol / L, and the initial OD600 value was about 1.0. 100 μL of bacterial suspension was added with 100 μL of enzyme-free buffer of the corresponding pH as a control. Immediately after adding the lytic enzyme, the OD600 value was measured using a microplate reader, and the measurement was performed every 1 minute for a total of 10 minutes, with 3 parallels in each group.

[0073] The results are expressed as relative activity, which is defined as the percentage of the turbidity reduction value at the current pH value to the turbidity reduction value at the pH value at which the turbidity reduction is maximum.

[0074] The lysis activity of SALcd at pH 4.0-12.0 with a pH interval of 1.0 was determined by turbidity reduction experiments. Figure 2 A. The results show that the optimal pH value of the recombinant enzyme is between pH 8.0 and 11.0. The pH intervals within this range were measured at 0.5, and the results are shown in Figure 2 As shown in B.

[0075] The results showed that SALcd preferred an alkaline environment with an optimum pH of 11.0. The enzyme activity was low under acidic conditions and increased with increasing pH. The relative activity was above 80% at pH 9.0-11.0, the highest activity was obtained at pH 11.0, and it was inactivated at pH 12.0.

[0076] Example 4. Determination of the optimum temperature of the truncated lyase SALcd

[0077] Lyase pretreatment: SALcd was diluted with a pH 11.0 buffer, and the remaining steps were the same as in Example 2.

[0078] Pretreatment of Staphylococcus aureus: After washing, a bacterial suspension with a pH of 11.0 was prepared, and the remaining steps were the same as in Example 2.

[0079] Turbidity reduction experiment: The lytic enzyme and Staphylococcus aureus were kept at three key temperatures, namely, the enzyme's common storage temperature of 4°C, the application temperature of 25°C, and the infection temperature of 37°C, for 10 minutes each. The final concentration of the lytic enzyme was determined by the method in Example 2 to be 75 nmol / L.

[0080] The results are as follows Figure 3 As shown, the relative activity of SALcd at 25°C was significantly higher than that at 4°C and 37°C, and was more suitable for application in room temperature environments.

[0081] Example 5. Determination of the cleavage spectrum of the truncated cleavage enzyme SALcd

[0082] Among Gram-positive bacteria, 8 standard strains of Staphylococcus aureus, 5 standard strains of Staphylococci other than Staphylococcus aureus were selected: including Staphylococcus capitis, Staphylococcus sciuri, Staphylococcus vitulinus, Staphylococcus epidermidis, and 2 standard strains of other Gram-positive bacteria: Streptococcus agalactiae and Listeria monocytogenes; among Gram-negative bacteria, due to the differences in cell wall structure, they are probably not the target strains of the lytic enzyme, so only 1 standard strain of Salmonella enterica serovar Typhimurium and 1 standard strain of Escherichia coli were selected for determination.

[0083] The determination was carried out at room temperature and pH 11.0. To reduce the influence of the sample addition order on the determination result, the final concentration of the lytic enzyme was reduced to 50 nmol / L. The turbidity reduction was measured for 30 minutes. The remaining steps were the same as in Example 2.

[0084] The results are as follows Figure 4 As shown, SALcd was able to lyse S. aureus and other staphylococci, but was unable to lyse other G+ strains and G- strains tested.

[0085] Example 6. Cleavage activity of truncated cleavage enzyme SALcd

[0086] The determination process is the same as in Example 4. The 10 minutes when the lytic enzyme is most active in killing bacteria and the 30 minutes when the killing is basically completed are taken to calculate the turbidity change value per unit concentration per unit time, that is, the lysis rate per unit concentration.

[0087] The results are shown in Table 2. SALcd has a faster lysis rate and can quickly kill Staphylococcus aureus at a lower concentration. The initial OD600 value of the reaction system is around 1.0. After 10 minutes of sterilization, the OD600 value decreases rapidly. The lysis rate at unit concentration is 1.00×10 -3 Then continue sterilization to stabilize OD600 below 0.1. At 30 min, OD600 is below 0.05, and the lysis rate at unit concentration is 6.00×10 -4 Around, achieving efficient sterilization.

[0088] Table 2 Lysis activity of SALcd against Staphylococcus aureus

[0089]

[0090]

[0091] Example 7: Screening of metal cofactors for truncated lyase SALcd

[0092] The test was carried out at room temperature and pH 11.0. Different ions were added and gradiently diluted to form bacterial suspensions with different ion concentrations: Mg 2+ With Zn 2+ 0.625mmol / L, 1.250mmol / L, 2.500mmol / L, Ca 2+ In addition, a gradient of 5.000 mmol / L was added, and a buffer solution without the ion to be tested was used as a control. The final concentration of the lyase was 75 nmol / L, and the remaining steps were the same as in Example 2.

[0093] The results are as follows Figure 5 As shown, at a certain concentration of Ca 2+ With Mg 2+ The cleavage activity of SALcd was enhanced, while Zn 2+ It has an inhibitory effect on the cleavage activity of SALcd.

[0094] Ca 2+ SALcd promoted the lysis of Staphylococcus aureus in the concentration range of 0.625-5.000mmol / L. The maximum relative activity was reached at 0.125mmol / L, with an average of 121.10%, which was significantly different from 0 and 5.000mmol / L, but not significantly different from 0.625mmol / L and 2.500mmol / L.

[0095] Mg 2+ The cleavage activity of SALcd was greatly increased in the concentration range of 0.625-2.500mmol / L. The increases were 84.09%, 102.23%, and 88.42% at 0.625mmol / L, 1.250mmol / L, and 2.500mmol / L, respectively. The maximum relative activity was reached at 1.250mmol / L, which was significantly different from 0 and 0.625mmol / L, but not significantly different from 2.500mmol / L.

[0096] Zn 2+ The cleavage activity of SALcd was strongly inhibited in the concentration range of 0.625-2.500mmol / L. The relative activity of SALcd was only less than 15%, which can be judged as almost lost, and the difference was significant compared with 0.

[0097] In summary, Mg 2+ It is the best metal cofactor for SALcd, Ca 2+ It has a certain auxiliary effect on SALcd, while Zn2+ The inhibitory effect on SALcd is relatively strong, which may destroy the structure of SALcd and make it inactive.

[0098] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. An alkaline-resistant Staphylococcus aureus phage recombinant lytic enzyme, characterized in that: The lyase is SALcd, the amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.

2.

2. A method for preparing the alkaline-resistant Staphylococcus aureus phage recombinant lytic enzyme according to claim 1, characterized in that: The method comprises the following steps: Step 1, design primers for the CHAP domain and the CBD domain respectively, and use the artificially synthesized sequence SEQ ID NO.2 as a template for amplification to obtain SALcd-CHAP and SALcd-CBD gene fragments, the sequences of the SALcd-CHAP and SALcd-CBD gene fragments are shown in SEQ ID NO.7 and SEQ ID NO.8 respectively; Step 2: clone the gene fragment in step 1 into the expression plasmid in the order of CHAP domain at the N-terminus and CBD domain at the C-terminus to obtain the expression plasmid containing SALcd, and transform it into the expression strain; Step 3: Induce expression and purify the strain obtained in step 2 to obtain the truncated lyase SALcd with the amidase domain deleted.

3. The method according to claim 2, characterized in that The primer sequences in step 1 are as follows: SEQ ID NO.3 SAL-CHAP-F:CTTTAAGAAGGAGATATACCATGGCTAAGACTCAAGCAGAA; SEQ ID NO.4 SAL-CHAP-R:TTTTTCCAAGAATTCTTAGAAACTTTTAGTGTTGCT; SEQ ID NO.5 SAL-CBD-F:TTCTAAGAATTCTTGGAAAAAGAACCAGTAC; SEQ ID NO.6 SAL-CBD-R:CAGTGGTGGTGGTGGTGGTGTTTGAATACTCCCCAGGC.

4. The method according to claim 2, characterized in that The steps 2 and 3 specifically include: Step 2.1, the gene fragment obtained in step 1 and the pET28a plasmid double-digested with NcoⅠ and XhoⅠ were excised and recovered, and the gene fragment and plasmid were added into the seamless cloning system for reaction; Step 2.2, transform the seamless cloned product into E. coli DH5α competent cells, spread the bacterial solution on an LB plate containing kanamycin for culture, and then inoculate it into LB broth containing kanamycin for culture, and extract the plasmid, i.e., the recombinant expression plasmid of SALcd; Step 2.3, transforming the obtained recombinant expression plasmid into E. coli BL21 competent cells, spreading the bacterial solution on an LB plate containing kanamycin for culture, inoculating it into LB broth containing kanamycin for culture, and preserving the bacterial solution; Step 3.1, activate the strain obtained in step 2.3, then transfer the culture and add IPTG to induce expression; Step 3.2, collect the bacteria by centrifugation, wash them, add lysis buffer according to the proportion, centrifuge after the bacterial solution becomes clear, and separate the supernatant precipitate; Step 3.3, filter the bacterial crushing supernatant with a filter membrane, use this as the sample, and use a Ni-NTA pre-loaded gravity column to purify the lysate. In each step, control the liquid volume in the column to be consistent, ensure consistent pressure, and liquid flow rate. Perform SDS-PAGE detection on the sample flow-through, wash liquid, and eluate to determine the elution concentration of the target protein with a single band. Collect the eluate of this concentration, perform ultrafiltration concentration, and freeze it at -80°C.

5. Use of the alkaline-resistant Staphylococcus aureus phage recombinant lytic enzyme as claimed in claim 1.

6. The use according to claim 5, characterized in that The lytic enzyme was used at pH 8.0-11.

0.

7. The use according to claim 5, characterized in that The lytic enzyme was used at room temperature.

8. The use according to claim 5, characterized in that The lytic enzymes are used to control a variety of S. aureus and other staphylococci including S. capitis, S. sciuri, S. veal and S. epidermidis.

9. The use according to claim 5, characterized in that The lyase is used in the presence of an active cofactor, which is Ca 2+ or Mg 2+ .

10. The use according to claim 5, characterized in that The lyase is used in the food processing industry, and is used directly as a spray, or is encapsulated in pH-sensitive liposomes and released in an alkaline environment.

Images