DsRNA-S9 for inhibiting rice black-streaked dwarf virus as well as preparation method and application of dsRNA-S9

Abstract

The invention discloses dsRNA (double-stranded ribonucleic acid) for inhibiting pathogenicity of rice black-streaked dwarf virus and application of the dsRNA. The dsRNA disclosed by the invention targets a gene S9 of a rice black-streaked dwarf virus coding RBSDV P9 protein, so that the replication and expression level of the rice black-streaked dwarf virus in a plant body are inhibited, and the occurrence of the rice black-streaked dwarf virus is effectively reduced. The dsRNA disclosed by the invention is inhibited before virus infection, so that the pathogenicity of the rice black-streaked dwarf virus is greatly reduced; the biological antiviral agent prepared from the dsRNA has an obvious effect of improving the disease resistance of plants, and is safe, environment-friendly, simple in preparation process and higher in applicability.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a dsRNA for inhibiting Rice black-streaked dwarf virus (RBSDV) and a preparation method and application thereof. Background Art

[0002] Rice black-streaked dwarf virus is a rice virus disease caused by the vector, the gray planthopper, which transmits RBSDV in a persistent manner. The typical symptoms of rice plants infected by rice black-streaked dwarf virus are obvious stunting of the diseased rice, short, stiff, dark green leaves, twisted and wrinkled new leaves, wax tear-like white protrusions on the veins and stems on the back of the leaves at the beginning of the disease, which later become short dark brown nodular protrusions, rice does not ear or ear is small, and eventually can lead to serious yield reduction. Since the beginning of this century, the main rice varieties promoted in my country are not resistant to black-streaked dwarf virus, which has caused the disease to be widely prevalent in Zhejiang, Shanghai, Jiangsu, Anhui and other places, making it a major disease of rice. Generally, the yield loss of diseased fields is 10% to 40%, and the incidence rate of serious fields is 80%-90%, with a yield loss of 70% to 80%, and some even have no harvest, posing a serious threat to agricultural production. In addition to infecting rice, RBSDV can also infect other grass crops such as corn, wheat, barley, sorghum, and millet, as well as grass weeds such as barnyard grass, oatstraw, and foxtail grass.

[0003] RNA interference (RNAi) is a process in which dsRNA (double-stranded RNA) recognizes mRNA with homologous complementary sequences and inhibits its expression or even degrades its molecules. It is also called gene silencing. This pathway plays a very important role in eukaryotic organisms' resistance to biological stress. In nature, there are a large number of cross-kingdom small RNAs that are bidirectionally transmitted between plants and pathogens. Spraying dsRNA derived from pathogenic genes of pathogens on the surface of plants can induce the RNA silencing system in the plant, thereby inhibiting the expression of viral genes and reducing their pathogenicity, effectively protecting plants from pathogens. Therefore, exploring the use of dsRNA based on the RBSDV genome for viral disease prevention and control, solving the problems of lack of drugs for viral disease prevention and control in production, pollution caused by insecticide application, and scarcity of resistant variety resources, is a new green and environmentally friendly agricultural technology. Summary of the invention

[0004] Objective of the invention: The first objective of the present invention is to provide a dsRNA that inhibits rice black-streaked dwarf disease by targeting rice black-streaked dwarf virus RBSDV.

[0005] The technical problem that the present invention needs to solve is to provide the application of the dsRNA in inhibiting rice black-streaked dwarf virus.

[0006] Technical solution: The dsRNA for inhibiting the pathogenicity of RBSDV in the present invention has an RNA sequence as shown in SEQ ID NO.3.

[0007] The preparation method of the above-mentioned dsRNA of the present invention comprises the following steps: using the cDNA of RBSDV as a template, performing PCR amplification with primers having nucleotide sequences as shown in SEQ ID NO.1-2, obtaining a dsRNA fragment having a nucleotide sequence as shown in SEQ ID NO.4, connecting the dsRNA fragment to an expression vector, and constructing a recombinant vector; introducing the recombinant expression vector containing the dsRNA fragment into Escherichia coli HT115 for cultivation; inducing dsRNA production by IPTG, and collecting the bacterial solution after cultivation.

[0008] Wherein, the expression vector is a commercially purchased pet28 vector.

[0009] Furthermore, during the IPTG induction, the initial concentration of Escherichia coli HT115 was OD 600 =0.4-0.8; IPTG concentration is 0.5-1.0mmol / mL; culture time is 4-5h.

[0010] The dsRNA of the present invention is used in the preparation of a medicament for preventing and treating rice black-streaked dwarf disease.

[0011] Furthermore, the rice black-streaked dwarf disease is caused by rice black-streaked dwarf virus RBSDV.

[0012] Furthermore, the concentration of the dsRNA is 1.0 μg / μL.

[0013] The agent of the invention can be sprayed on leaves or stems of rice.

[0014] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages:

[0015] 1. The dsRNA of the present invention targets the gene S9 encoding the P6 protein of the rice black-streaked dwarf virus RBSDV, and can play a role in preventing and controlling rice black-streaked dwarf disease in the early stage of virus infection;

[0016] 2. Bacterial-induced dsRNA has low cost, high yield, simple process, strong specificity, obvious antiviral effect, and is safe and environmentally friendly, making RNAi technology better used in the prevention and control of rice black-streaked dwarf disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Select the conserved domains of the segment (both ends);

[0018] Figure 2 Clustered distribution of non-conserved domain small RNAs in selected segments;

[0019] Figure 3 The electrophoresis diagram of dsRNA induced by bacteria;

[0020] Figure 4 The figure is a bar graph showing the incidence of rice Huaidao No. 5 (H5) inoculated with Rice Black-streaked Dwarf Virus RBSDV treated with different concentrations of dsRNA of the present invention, treated with control dsGFP and untreated rice, wherein * indicates significant difference (p-value<0.05);

[0021] Figure 5 A bar graph showing the relative expression analysis of RBSDV in rice leaves of the treated and control groups of the rice Huaidao No. 5 treated with the dsRNA of the present invention and the control group of dsGFP treated and untreated rice after inoculation with RBSDV. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is further described below in the form of embodiments in conjunction with the accompanying drawings.

[0023] The materials and instruments used in the following examples are all commercially available. The rice material used is Huaidao No. 5, and the population of gray planthoppers carrying RBSDV was obtained and screened by the rice virus disease resistance innovation team of the Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, where the applicant of the present invention is located.

[0024] The cDNA coding sequence of RBSDV S9 of the present invention is derived from the gene numbered NC003731 in the database of the National Center for Biotechnology Information (https: / / www.ncbi.nlm.nih.gov). First, the sequence was compared with the rice genome sequence in two rice genome databases (http: / / rice.plantbiology.msu.edu / ; http: / / www.gramene.org / ) by conservative comparison, excluding the conservative region-enriched segments at both ends, and excluding the possibility of silencing rice genes ( Figure 1 ). Then, based on the analysis of the distribution of small RNA of the inoculated sample virus on the genome, select the area with high abundance of small RNA distribution to improve the silencing efficiency ( Figure 2 ). Finally, a 398 bp base sequence in RBSDVS9 was successfully amplified as the transcription template of the target dsRNA in the present invention.

[0025] The RNA sequence of the dsRNA molecule derived from RBSDV S9 of the present invention is shown in SEQ ID No.3, and the cDNA coding sequence thereof is shown in SEQ ID No.4.

[0026] SEQ ID No.3:

[0027]

[0028] SEQ ID No.4

[0029]

[0030] The cDNA coding sequence of RBSDV S9 is derived from the gene numbered NC003731 in the database of the National Center for Biotechnology Information (https: / / www.ncbi.nlm.nih.gov / nucleotide / ) and ttps: / / www.ncbi.nlm.nih.gov / nuccore / KM921678.1). The base sequence of the cDNA coding sequence of ORF2 from 382 to 779 was selected as the template sequence of the dsRNA of the present invention. This sequence was again compared with the rice genome sequence in two rice genome databases (http: / / rice.plantbiology.msu.edu / and http: / / www.gramene.org / ) to detect the possibility of non-specific silencing of rice genes. The comparison results show that the dsRNA molecule of the present invention cannot reach the effective length of RNA silencing the rice genome, further eliminating the possibility that the fragment interferes with silencing rice genes.

[0031] The dsRNA molecule of the present invention (its cDNA sequence is shown in SEQ ID No. 4) is amplified from the cDNA of RBSDV S9 preserved by the Institute of Plant Protection of Jiangsu Academy of Agricultural Sciences.

[0032] The present invention refers to the Ministry of Agriculture industry standard NYT2955 / 2016 "Technical Specifications for Identification and Evaluation of Rice Black-streaked Dwarf Disease Resistance in Rice Variety Tests" to classify the symptoms of black-streaked dwarf disease into:

[0033] Level 0, immune, morbidity rate is 0;

[0034] Level 1, high resistance, incidence rate 0-5%;

[0035] Level 3, resistant, with an incidence rate of 5.1% to 15%:

[0036] Grade 5, moderate infection, with an incidence rate of 15.1% to 30%;

[0037] Level 7, infectious disease, with an incidence rate of 30.1% to 50%;

[0038] Level 9, high infection, incidence rate greater than 50.1%.

[0039] Example 1: Preparation of bacterial induced expression dsRNA preparation

[0040] (1) Construction of vector and recombinant:

[0041] 1.1 Extraction of Rice Black-streaked Dwarf Virus RNA: Collect leaves of diseased rice plants and use TRIzol (TaKaRa) method to extract RNA. The specific operation is as follows:

[0042] 1.1.1. Use liquid nitrogen to evenly grind an appropriate amount of diseased rice plant leaves, and then quickly transfer the ground powder or liquid into a 1.5 mL RNase-free centrifuge tube.

[0043] 1.1.2. Quickly pipette 1 mL of Trizol into a centrifuge tube, then add 200 μL of chloroform. Vortex the liquid in the tube to mix well and let it stand at 4°C for 5 min.

[0044] 1.1.3. Centrifuge at 12000 rpm for 15 min at 4°C.

[0045] 1.1.4. Pipette the supernatant after centrifugation and add it to a new 1.5mL RNase-free centrifuge tube. Then add 600μL isopropanol to the centrifuge tube and place the centrifuge tube at -80℃ for 2h.

[0046] 1.1.5. Centrifuge at 12000 rpm for 15 min at 4°C and discard the supernatant.

[0047] 1.1.6. Pipette 1 mL of 75% ethanol solution into a centrifuge tube, use a pipette to resuspend the precipitate, centrifuge at 12,000 rpm for 3-5 min at 4°C, and discard the supernatant.

[0048] 1.1.7. Repeat step 1.1.6, then empty the tube and absorb the remaining liquid with a pipette.

[0049] 1.1.8. Dry the precipitate until it is transparent, add 30 μL RNase-free water to the centrifuge tube, and mix by pipetting to fully dissolve the precipitate to obtain the total RNA of the diseased rice plant leaves.

[0050] 1.2 Transcription of Rice Black-streaked Dwarf Virus Template, adjust the RNA concentration to 500 ng / μL, and select PrimeScript TM The extracted total RNA was reverse transcribed into cDNA using RT reagent Kit gDNA Eraser (TaKaRa). Specific primers for the stem-loop structure were designed based on the sequence information, and PCR amplification was performed using the cDNA of RBSDV S9 as a template.

[0051] The primer sequences are as follows:

[0052] F: 5' AGACAGGCAAATATAAGCGTGAA -3'(SEQ ID NO.1);

[0053] R: 5' GGAACTCTTGTTCCGATGAGA -3'(SEQ ID NO.2);

[0054] The underlined part is the introduced restriction site.

[0055] 1.3. The amplified product was detected by 1.0% agarose gel electrophoresis, showing a single band at about 400 bp, which was consistent with the expected sequence size, and gel recovery and purification were performed.

[0056] 1.4. The double-enzyme-digested target fragment and the pet28 vector stored in the laboratory (purchased from the commercial company Tiandz, Mianyang, China) were purified together, and the enzyme-digested fragment and the vector were ligated using T4 DNA Ligase (TaKaRa) to obtain a recombinant plasmid.

[0057] 1.5. The method for preparing GFP dsRNA fragments for control treatment was based on the article published by Annette Niehl et al. in New Phytologist (Double-stranded RNAs induce a pattern-triggered immune signaling pathway in plants. New Phytologist Volume 211, Issue 3, https: / / doi.org / 10.1111 / nph.13944)

[0058] 1.6. Transform the recombinant plasmid into competent E. coli HT115 preserved in the laboratory to obtain the desired recombinant and preserve the glycerol bacteria.

[0059] (2) Inducing bacteria to express dsRNA. The specific operation is as follows:

[0060] 2.1. Inducible expression of dsRNA

[0061] The stored glycerol bacteria containing the target gene were added with ampicillin and tetracycline resistance (12.5 μg / mL Tet + , 50μg / mL Amp + ) in LB sterile culture medium. Place in a constant temperature shaker at 37°C, 220 rpm for initial overnight culture.

[0062] In the clean bench, the initial culture solution was taken out and added into 400 mL of liquid LB sterile culture solution (500 mL conical flask) containing ampicillin and tetracycline resistance (concentrations as above) at a volume ratio of 4:100, and then placed in a 37°C constant temperature shaker at 220 rpm for 2 h to OD 600 =0.4-0.8.

[0063] Sterile IPTG was added to the clean bench to a final concentration of 1.0 mmol / L, and the culture was continued for 5 h under the above conditions.

[0064] 2.2. The total RNA of Escherichia coli HT115 was extracted using the TRIzol (TaKaRa) method. The specific steps are as in step 1.1 of Example 1.

[0065] 2.3 Purification and identification of induced dsRNA

[0066] 2.3.1. The extracted total RNA of E. coli was first treated with DNase I (final concentration of 200 U / ml) at 37°C for 30 min, and then with RNase A (final concentration of 100 μg / μl) at 37°C for 30 min.

[0067] 2.3.2. Measure the dsRNA concentration using a spectrophotometer. The total RNA extracted by this method can reach 5 mg per 200 ml of bacterial solution. Perform agarose gel electrophoresis to verify the band size of dsRNA to confirm whether dsRNA is successfully synthesized. Figure 3 Display, confirm the successful synthesis of the correct dsRNA band. According to the electrophoresis results, the dsRNA content in the expression system of the present invention accounts for 40%-60% of the total RNA, that is, the yield per 200ml bacterial liquid can reach 2-3mg, and the original concentration can reach 2-4μg / μl, which is twice the conventional level. The final concentration of dsRNA is adjusted to 1.5μg / μl with DEPC water and stored as the test treatment solution.

[0068] Example 2: Inoculation of rice with RBSDV and detection of dsRNA to inhibit the pathogenicity and expression level of RBSDV

[0069] (1) Extraction of Rice Black-streaked Dwarf Virus RNA, refer to step 1.1 of Example 1.

[0070] (2) Rice inoculation with RBSDV

[0071] Healthy Huaidao No. 5 rice seedlings were cultivated in growth cups (35 plants per cup). When they grew to the 1.5-leaf stage, the final expressed dsRNA product was mixed with RNase-free water, and the concentration was adjusted to 1.0 μg / μl. 800 μl was sprayed per cup, and a total of 1200 μg was evenly sprayed on the leaves and stems. The dsRNA solution was replaced with RNase Free ddH2O and GFP dsRNA at a concentration of 1.0 μg / μl as a non-viral dsRNA treatment control. After 24 hours of treatment, the rice was inoculated with a highly toxic 3-4-year-old gray leafhopper population. The amount of insects to be inoculated per cup of rice seedlings was calculated based on 2 effective insects per plant, and the gray leafhoppers of the corresponding amount were sucked with a simple insect sucker (taking a 40% toxicity rate as an example) and 175 insects were inoculated per cup. The gray leafhopper population used in this example is a laboratory-preserved gray leafhopper virus (RBSDV) high affinity population, which is derived from Liu Haijian et al. (2007) and Zhou Tong et al. (Liu Haijian, Cheng Zhaobang, Wang Yue, Wei Bangqing, Ren Chunmei, Zhou Yijun, Fan Yongjian, 2007. Preliminary report on the transmission of rice black-streaked dwarf virus by gray leafhoppers. Journal of Jiangsu Agricultural Sciences, 23 (5): 492-494). After 48 hours of inoculation, the gray leafhoppers were swept out and the seedlings were transplanted to the test field to observe the disease. After 5 days, samples were taken to observe the phenotype. Three materials were mixed for each treatment, and the incidence of live plants was detected after 14 days.

[0072] (3) In vivo RNA extraction and quantitative expression

[0073] The total RNA of the rice sample was extracted using TRIzol reagent (Invitrogen), and the expression level of RBSDV was analyzed by real-time quantitative PCR after reverse transcription according to steps 1.1 and 1.2 of Example 1.

[0074] from Figure 4 It can be seen that the incidence of the plants treated with the dsRNA of the present invention and then infected with RBSDV was significantly reduced compared with the H2O treatment and GFP dsRNA control groups. Figure 5 It can be seen that the relative expression level of RBSDV in rice plants treated with dsRNA was significantly decreased compared with the control.

[0075] It can be seen that the above examples and data illustrate that the dsRNA of the present invention has a significant effect in inhibiting the pathogenicity of rice black-streaked dwarf virus and regulating the expression of rice black-streaked dwarf virus in plants.

[0076] Example 3 Effect of dsRNA Aqueous Solution Concentration on Control Effect

[0077] The dsRNA prepared in Example 1 was dissolved in an aqueous solution to prepare aqueous solutions with concentrations of 0.5, 1.0, 1.5, and 2.0 μg / μl, and 800 μl per cup was evenly sprayed on rice leaves. RBSDV was inoculated 24 hours after treatment (1.5 effective poisonous insects per seedling). After 48 hours of inoculation, the gray leaf hoppers were swept out and the seedlings were transplanted to the test field. The disease was observed after 14-20 days.

[0078] Table 1: Optimal control concentration test of dsRNA-RBS9 aqueous solution

[0079] dsRNA concentration (μg / μl) Control effect (%) 0.5 72.59 1.0 100.00 1.5 82.77 2.0 83.77

[0080] According to Table 1 and Figure 4 It can be seen that the optimal control concentration is 1.0μg / μl. When the dsRNA concentration is 0.5μg / μl and 1.0μg / μl, there is a significant difference in the control level; when the dsRNA concentration is 1.5 or 2.0μg / μl, the control level is significantly different from the control, but the increase in concentration will increase the application cost.

[0081] Example 4 Detection of the inhibitory effect of dsRNA on rice black-streaked dwarf virus

[0082] Healthy Huaidao No. 5 rice seedlings were cultivated in growth cups (35 plants per cup). When they grew to the 1.5-leaf stage, a mixture of 1.0 μg / μl dsRNA and DEPC-H2O was selected, and a volume of 800 μl per cup was added to a spray bottle treated with an RNase scavenger (Beijing Tianenze Biotechnology Co., Ltd., item number 3090-250), and evenly sprayed on the leaves of Huaidao No. 5 rice plants at the 1.5-leaf stage. After treatment, the pre-inoculated Huaidao No. 5 rice seedlings were moved into a 26°C constant temperature culture room, and artificial inoculation of RBSDV was performed 24 hours later. The inoculation steps are shown in Example 2.

[0083] Experiments have shown that after spraying dsRNA on the plants, the inoculated rice was moved to the identification nursery to detect the level of viral expression in the plants. Figure 5 The Q-PCR results showed that the virus content in the living plants of Huaidao No. 5 was reduced after dsRNA-RBS9 treatment compared with the controls treated with H2O and dsRNA GFP at 7, 14, and 21 days after inoculation (7 dpi, 14 dpi, and 21 dpi).

[0084] Based on the above results, the dsRNA in the present invention has a good effect in preventing and controlling rice black-streaked dwarf virus and has broad market application prospects.

Claims

1. A dsRNA for inhibiting the pathogenicity of rice black-streaked dwarf virus, characterized in that: The sequence of the dsRNA is shown as SEQ ID NO.

3.

2. The method for preparing dsRNA according to claim 1, characterized in that: The method comprises the following steps: using RBSDV cDNA as a template, performing PCR amplification with primers having nucleotide sequences as shown in SEQ ID NO.1-2, obtaining a dsRNA fragment having a nucleotide sequence as shown in SEQ ID NO.4, connecting the dsRNA fragment to an expression vector, and constructing a recombinant vector; introducing the recombinant expression vector containing the dsRNA fragment into Escherichia coli HT115 for cultivation; inducing dsRNA production by IPTG, and culturing and collecting bacterial liquid.

3. The method for preparing dsRNA according to claim 2, characterized in that: The expression vector is a pet28 vector.

4. The method for preparing dsRNA according to claim 2, characterized in that: The initial concentration of E. coli HT115 was OD 600 =0.4-0.

6.

5. The method for preparing dsRNA according to claim 2, characterized in that: The IPTG concentration is 0.5-1.0 mmol / mL.

6. The method for preparing dsRNA according to claim 2, characterized in that: The culture time is 4-5h.

7. Use of the dsRNA according to claim 1 in preventing and treating rice black-streaked dwarf disease.

8. The use according to claim 7, characterized in that: The concentration of the dsRNA is 1.0-2.0 μg / μL.

9. The use according to claim 7, characterized in that: The application comprises spraying the dsRNA aqueous solution on rice leaves or stems.

Images