Antibacterial peptide Hcattacin1 gene dsRNA for preventing and treating fall webworm and application thereof

Abstract

The invention discloses an antibacterial peptide Hcatacin1 gene dsRNA for preventing and treating fall webworm and application of the antibacterial peptide Hcatacin1 gene dsRNA in prevention and treatment of fall webworm. The nucleotide sequence of the Hcattacin1 gene of the Chinese white moth is SEQ ID NO: 1. The dsRNA is designed on the basis of the antibacterial peptide Hcatacin1 gene, a hyphantria cunea Hcatacin1 RNA interference system implemented by an injection method is established, an obvious gene silencing effect of injection in hyphantria cunea is obtained, and in addition, the control effect of biocontrol bacteria can be remarkably improved by combining the hyphantria cunea Hcatacin1 dsRNA with the biocontrol bacteria. The invention lays a theoretical foundation for development of immunosuppressants safe to human and livestock, provides a new theory for biological control of pests, and finally provides a new strategy and a new way for pest control for green agricultural production and sustainable development in China.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an antimicrobial peptide Hcattacin1 gene dsRNA for controlling the gypsy moth and an application thereof. Background Art

[0002] Hyphantria cunea (Drury) (Lepidoptera: Erebidae) is native to North America and has been found in more than 30 countries. It is an important forest pest worldwide (Ge et al. 2019). The gypsy moth infests the forests in its larval stage. In the 1st and 2nd instars, it lives in groups on the back of plant leaves and eats the mesophyll, leaving only the veins. During the feeding process, it will spit out a lot of silk to wrap itself up for protection. The feeding ability of the 3rd instar larvae is enhanced, and it can bite through the leaves into holes. When it grows to the 4th instar, its activity is enhanced, and it begins to disperse into small groups to feed on the leaves. In the 5th instar, it enters the gluttonous stage, eating the leaves of the tree until only the main veins and petioles are left. The 6th and 7th instar larvae eat the entire leaf except the main petiole (Wang Wei 2020; Liu Xiaoxia 2020). The gypsy moth has more than 600 host plants, including various trees, fruit trees, shrubs, herbaceous plants and crops (Edosa et al. 2019). Because the gypsy moth has complex host plants, large food intake, strong reproduction and transmission capabilities, its invasion has seriously affected China's ecological environment, landscape, agriculture, forestry and many other aspects, causing huge losses to China (Zhao Tiezhen 2005). Chemical control is an important means of controlling the gypsy moth. Chemical control is fast and effective. It can achieve immediate control effects when the affected area is large, the occurrence is large, and the damage is serious. However, the long-term and large-scale use of chemical pesticides has brought many adverse effects. Therefore, it is imperative to discover new biological control methods and explore new strategies for controlling the gypsy moth.

[0003] RNA interference (RNAi) refers to the phenomenon in eukaryotic organisms where double-stranded RNA (dsRNA) induces efficient and specific degradation of homologous mRNA, thereby silencing target gene expression (Zamore et al. 2000). At present, gene silencing caused by dsRNA has been confirmed in many studies related to insects such as Hemiptera, Neuroptera, Diptera, Coleoptera, Lepidoptera and Hymenoptera (Dietzl et al. 2007; Schlüns and Crozier 2007; Konopova and Jindra 2008; Sattar and Thompson 2016; Chaitanya et al. 2017). RNAi is widely used in many aspects of research, such as the exploration of gene functions and the development of new biological pesticides. It is considered to be a potential pest control method. By using dsRNA to silence the expression of important genes in insects, it can cause defects or obstacles in the corresponding physiological activities, growth and development, and behavior of insects, leading to the death of insects (Zhang Jianzhen et al. 2021; Gao Liwen et al. 2022). Insects are often exposed to various pathogens. They have a self-protective immune response to resist pathogen infection, which plays an important role in their successful survival. Among them, antimicrobial peptides play an important role in the insect immune system. Insect antimicrobial peptides are a class of small molecule alkaline polypeptide substances induced in insects. They are important effector molecules of insect innate immunity. They are not easy to form drug resistance, have broad-spectrum antibacterial properties, and have small molecular weight. They also have killing effects on viruses, bacteria, fungi, and cancer cells (Zhao Zihan et al. 2021). Silencing this gene can reduce the ability of the gypsy moth to resist infection by pathogenic microorganisms, eventually leading to its death. Therefore, it is expected that dsRNA can be designed against antimicrobial peptide genes through RNA interference technology for the control of the gypsy moth. Summary of the invention

[0004] The purpose of the present invention is to provide the use of dsRNA of the Hcattacin1 gene of the cuneiform moth in the control of the cuneiform moth. The Hcattacin1 gene of the cuneiform moth was cloned by the applicant for the first time, and dsRNA designed based on the gene and introduced into the cuneiform moth can effectively control the cuneiform moth.

[0005] Specifically, the present invention proposes a dsRNA of the antimicrobial peptide Hcattacin1 gene for controlling the gypsy moth, wherein the nucleotide sequence of the Hcattacin1 gene is shown in SEQ ID NO: 1; the dsRNA uses the Hcattacin1 plasmid of the gypsy moth as a template, and is amplified by PCR using the upstream primer dsHcattacin1F and the downstream primer dsHcattacin1R, wherein:

[0006] The upstream primer dsHcattacin1F is:

[0007] The downstream primer dsHcattacin1R is:

[0008] The present invention also provides an application of the above antimicrobial peptide Hcattacin1 gene in controlling the gypsy moth.

[0009] The present invention also provides a dsRNA for controlling the gypsy moth. The dsRNA is a dsRNA of the antimicrobial peptide Hcattacin1 gene. The nucleotide sequence targeted by the synthesized dsHcattacin1 is shown in SEQ ID NO:1.

[0010] A DNA encoding any of the above-mentioned dsRNA targets.

[0011] A recombinant expression vector, which expresses any of the above-mentioned dsRNAs.

[0012] A host bacterium is transformed with the above-mentioned recombinant expression vector.

[0013] The present invention also discloses a method for controlling the gypsy moth, which comprises treating the gypsy moth with any of the above-mentioned dsRNAs in combination with Serratia marcescens. That is, the gypsy moth may be treated with dsRNA first and then with Serratia marcescens, or the dsRNA and Serratia marcescens may be used simultaneously to treat the gypsy moth.

[0014] Furthermore, the dsRNA concentration is 1 μg / μL, and the 9.5×10 9 CFU / mL Serratia marcescens.

[0015] Furthermore, the gypsy moth is first treated with the dsRNA concentration for 48 hours, and then treated with Serratia marcescens.

[0016] Furthermore, the treatment method is to feed the bacterial liquid of Serratia marcescens.

[0017] Beneficial effects:

[0018] The present invention designs dsRNA based on the Hcattacin1 gene, studies and establishes an Hcattacin1 RNA interference system for the gypsy moth by injection, and concludes that the injection method achieves a significant gene silencing effect in the gypsy moth, providing a theoretical basis for the application of the Hcattacin1 RNAi technology. At the same time, by using the HT115 strain to construct a dsRNA expression system, the interference cost is compressed. The present invention successfully interferes with the expression of the Hcattacin1 gene by using the system, and finds that the sensitivity of the gypsy moth with Hcattacin1 gene silenced to the Serratia marcescens SM1 strain is significantly improved. It is found through experiments that when Hcattacin1 dsRNA and SM1 are used simultaneously, the mortality rate of the gypsy moth is significantly improved, indicating that it can improve the control effect of biocontrol bacteria. These provide a theoretical basis for the application of Hcattacin1 dsRNA in the control of the gypsy moth. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The expression level of Hcattacin1 after the treatment of the American moth with Serratia marcescens;

[0020] Figure 2 Relative expression of the target gene 48 hours after dsRNA injection. Note: Different lowercase letters indicate significant differences among treatments.

[0021] Figure 3 Survival analysis after 48 h of dsRNA treatment, where A is the survival analysis graph, Note: ns means no significant difference between survival curves, "*" means P value is less than 0.05, "**" means P value is less than 0.005, and "***" means P value is less than 0.0001; B is the mortality rate at 24, 60, and 96 h, Note: Different lowercase letters indicate significant differences among treatments. DETAILED DESCRIPTION

[0022] The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials and reagents used are commercially available unless otherwise specified.

[0023] Experimental materials and methods involved in the examples:

[0024] (1) Test insects: Larvae of the gypsy moth were collected from Xuzhou City, Jiangsu Province, and were raised in a transparent plastic box (20 cm × 14 cm × 10 cm) in a constant temperature incubator at an ambient temperature of 26 ± 1°C and a light condition of 16 h light: 8 h dark, using fresh mulberry leaves.

[0025] (2) Cultivation of Serratia marcescens SM1

[0026] Culture medium: Bacterial basic medium (g / L): peptone 10g, beef extract 20g, NaCl 2g, K2HPO42g, agar 18g pH 7.2~7.4.

[0027] Bacterial seed culture medium (g / L): peptone 10 g, yeast extract 20 g, NaCl 2 g, K2HPO4 2 g.

[0028] Bacterial fermentation medium (g / L): peptone 10 g, soybean oil 30 g, NaCl 2 g, K2HPO4 2 g.

[0029] The isolated Serratia marcescens strain SM1 was transferred to the bacterial basal medium, cultured in the dark at 27°C for 24 hours, and a single colony was obtained after streaking. A single colony was taken out and placed in a sterilized 250mL conical flask containing 50mL seed culture medium, and cultured in a constant temperature shaker at 30°C and 200r / min for 12 hours for seed liquid culture. Then, 70mL of the cultured seed liquid was added to 250mL of fermentation medium, and cultured in a shaking incubator at a speed of 200r / min at a temperature of 30°C for 36 hours, and then taken out for use after culture.

[0030] (3) Determination of the concentration of Serratia marcescens SM1 fermentation broth

[0031] Within a certain range, as the number of bacteria in the fermentation broth of Serratia marcescens SM1 increased, its OD 600 The value of also increases.

[0032] The present invention is further described in detail below in conjunction with specific embodiments. The embodiments will help to understand the present invention, but the protection scope of the present invention is not limited to the following embodiments.

[0033] Example 1 Cloning of Hcattacin1 gene

[0034] (1) Primer design: Primers were designed using Primer 5 software based on the Hcattacin1 sequence obtained from transcriptome data:

[0035] Hcattacin1F: ATGTACGCAGTCAGTTTACTTGC;

[0036] Hcattacin1R:TTAAGGAAAGGATCTGCTGAAC.

[0037] (2) cDNA amplification and TA cloning:

[0038] The total RNA of Hyphantria cunea was extracted by Trizol.

[0039] Total RNA was used as a template and reverse transcription was performed according to the instructions of HiScriptⅡQ RT SuperMix for qPCR (+gDNAwiper) kit from Novozymes to synthesize cDNA. The reverse transcription system is shown in Table 1.

[0040] Table 1 Reverse transcription system

[0041]

[0042]

[0043] Using cDNA as a template, primers Hcattacin1F and Hcattacin1R were used for amplification. The PCR amplification reaction system is shown in Table 2. The PCR amplification reaction conditions are: 94°C pre-denaturation for 3 minutes; 94°C denaturation for 30 seconds, 52°C annealing for 30 seconds, 72°C extension for 30 seconds, a total of 35 cycles; 72°C final extension for 10 minutes. The PCR amplification product was detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. The identified correct PCR product was purified and recovered by a gel recovery kit. The TA cloning conditions are shown in Table 3. The gel recovery product was connected to pCE3 at room temperature for 5 minutes, and the connection product was transformed into Escherichia coli DH5α competent cells. The transformation of the connection product:

[0044] (1) Take out the E. coli DH5α competent cells from the -80°C refrigerator and dissolve them in ice water;

[0045] (2) Use a pipette to add 10 μL of the ligation product to 100 μL of E. coli DH5α competent cells and place on ice for 30 min;

[0046] (3) Heat shock in a 42°C water bath for 45 seconds, then immediately place in ice water for 2 minutes;

[0047] (4) Add SOC or LB liquid culture medium and culture at 37°C and 200 rpm for 1 h;

[0048] (5) Spread 200 μL of bacterial solution on LB solid medium containing Amp penicillin (final concentration 50 μg / mL) and culture inverted in a 37°C incubator overnight.

[0049] The transformation product was cultured in LB (Amp+) solid medium for 12-16 hours. The positive clones were selected and identified by bacterial liquid PCR. The recombinant plasmid containing the correct inserted fragment was named pCE3-Hcattacin1 and sent to the company for sequencing.

[0050] Table 2 PCR reaction system

[0051] Template cDNA 1μL Primer Hcattacin1F 1μL Primer Hcattacin1R 1μL <![CDATA[ddH2O]]> 9.5μL Composite Taq 12.5μL

[0052] Table 3TA cloning ligation system

[0053]

[0054]

[0055] Example 2 Induced expression of Hcattacin1 in the nymph of the American moth by Serratia marcescens SM1

[0056] The 4th instar larvae with similar developmental stage were selected for the experiment. 7 and 1×10 8 CFU / mL SM1 medium for 10-15s, soak mulberry leaves in water as the control group, dry them and put them in separate feeding boxes, with 20 larvae in each box. The feeding environment temperature is 26℃. The larvae treated above are set up with 3 replicates. Collect samples at 12, 24, 36 and 48h and store them at -80℃ for later use.

[0057] like Figure 1 As shown in the figure, the fluorescence quantitative experiment found that the expression of Hcattacin1 in both treatment groups showed a gradual upward trend, reaching the highest level at 36h and decreasing at 48h. Hcattacin1 in the low-concentration treatment group was significantly upregulated at 24, 36 and 48h, and Hcattacin1 in the high-concentration treatment group was significantly upregulated at 12, 24 and 36h.

[0058] Example 3 Synthesis and induction of dsRNA of the Hcattacin1 gene of the Hyphantria cunea

[0059] (1) Primer design of dsRNA of the Hcattacin1 gene of the American gypsy moth.

[0060] Based on the cloned Hcattacin1 sequence, its potential RNAi target sites were predicted using online software, and primers were designed using Primer 5 software:

[0061] dsHcattacin1F:

[0062] dsHcattacin1R:

[0063] The restriction sites SmaⅠ and SacⅠ were introduced upstream and downstream (the bold letters are restriction sites, and the italic letters are protected bases). The primers for dsGFP were designed as follows:

[0064] dsGFPF:

[0065] dsGFPR:

[0066] The restriction sites SacI and HindⅢ were introduced upstream and downstream. All primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0067] (2) Construction of dsRNA expression vector.

[0068] The full-length plasmid pCE3-Hcattacin1 with correct sequencing was used as a template, and the upstream and downstream primers dsHcattacin1F and dsHcattacin1R designed for synthesizing dsRNA were used for PCR amplification; the PCR amplification reaction conditions were: 94℃ pre-denaturation for 3min; 94℃ denaturation for 30s, 57℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles; 72℃ final extension for 10min. The PCR amplification product was detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. The correctly identified PCR product was purified and recovered by a gel recovery kit.

[0069] Using the existing GFP plasmid in the laboratory as a template, a 500bp fragment was cloned, and the target fragment and L4440 vector were digested and linked to successfully construct L4440-dsHcattacin1 and L4440-dsGFP recombinant plasmids.

[0070] Specifically, taking L4440-dsHcattacin1 as an example, the above PCR product was double-digested with SmaⅠ and SacⅠ to recover the target fragment; at the same time, the expression vector L4440 was double-digested with these two enzymes to recover the target vector. The double-digestion system is shown in Table 4. The target fragment and the target vector were connected at 16℃ for 16h under the action of T4 DNA ligase. The ligation product was transformed into E.coliDH5α competent cells and cultured in LB (Amp+) solid medium for 12h. After selecting positive clones and identifying them by enzyme digestion, the recombinant plasmid containing the correct inserted fragment was named L4440-dsHcattacin1 and sent to the company for sequencing.

[0071] Table 4 Double enzyme digestion system

[0072]

[0073] (3) Induced expression and extraction of dsRNA.

[0074] The HT115 strain containing L4440-dsHcattacin1 and L4440-dsGFP recombinant plasmids were induced to express dsRNA, and the target bands were 287bp and 500bp, which were consistent with the expected sizes of dsHcattacin1 and dsGFP, indicating that the interference vector was successfully constructed.

[0075] Taking L4440-dsHcattacin1 as an example, the sequenced L4440-dsHcattacin1 recombinant plasmid was transformed into HT115 (DE3) competent bacteria and spread on a plate containing ampicillin (50 μg mL -1 ) and tetracycline (12.5 μg mL -1 ) on LB solid medium with dual antibodies and inverted culture at 37°C overnight. Pick a single clone and inoculate it in a medium containing ampicillin (50 μg mL -1 ) and tetracycline (12.5 μg mL -1 ) in LB liquid medium with double antibodies, 37°C, 180 r·min -1 The culture was shaken until the bacterial solution OD 600 When the temperature is about 0.5-0.6, add IPTG (final concentration 0.8 mM) and continue to incubate at 37°C and 180 r·min -1 Continue shaking and culturing for 3 hours, then use RNA isolater total RNA extraction reagent from Novozymes to extract dsRNA. Use Eppendorf BioSpectrometer basic for quantification to reach a final concentration of 1 μg / μL. Store in a -80℃ ultra-low temperature freezer for later use.

[0076] Example 4 Detection of Hcattacin1 expression level after RNAi.

[0077] Healthy 4th-instar gypsy moth larvae with similar conditions were selected as experimental materials. Transparent plastic boxes (20cm×14cm×10cm) were used as breeding containers, and 20 gypsy moth larvae were placed in each box. The breeding environment temperature was 26°C. The dsHcattacin1 (1μg / μL) treatment group was set as the experimental group, the dsGFP (1μg / μL) treatment group was set as the control group, and the water treatment group was set as the blank control group. 1μL of reagent was injected into each larva. Three repeated experiments were set up. The gypsy moth larvae were placed in an environment with a temperature of 26±1°C for breeding, and samples were collected every 24h. Samples were collected 24h, 48h and 72h after treatment and stored at -80°C.

[0078] A fluorescence quantitative PCR (RT-qPCR) experiment was performed on the gene to examine the changes in gene expression at different times. The fluorescence quantitative primers are as follows (RPS16 and RPL13 are internal reference genes):

[0079] q-Hcattacin1 F: AGGGATTCGGATTGGCTTTAG

[0080] q-Hcattacin1 R: GTCCTGCACCTGTCAGTTT

[0081] q-RPS16 F:GTGGTCATGTTGCACAGGTT

[0082] q-RPS16 R: CTGGACCACCGAACTTCTTG

[0083] q-RPL13 F:GTTAGCTACACAGCTCCGTGG

[0084] q-RPL13 R:GCAGCAGTTGGGGCTTTAGT;

[0085] The fluorescence quantitative PCR reaction system is as follows:

[0086]

[0087] Reaction procedure:

[0088] 95℃30s

[0089] {95℃5s, 60℃34s}30cycles

[0090] {95℃15s, 60℃1min, 95℃15s}

[0091] The experiment was designed with 3 biological replicates. After obtaining the Ct values ​​of the target gene and the reference gene, 2 -ΔΔt Methods The relative expression of target gene mRNA was calculated and the obtained data were analyzed for significant differences using InStat software.

[0092] In order to detect the changes in the expression of the target gene at different sampling intervals after Hcattacin1 dsRNA injection, the cDNA samples of the control group and the treatment group were subjected to real-time fluorescence quantitative PCR detection. The results showed that at 24h, 48h, and 72h after dsRNA injection, the relative expression levels of Hcattacin1 in the treatment group were 0.31, 0.30, and 0.67, respectively, compared with the control group, which were significantly lower than those in the control group ( Figure 2 ).

[0093] Example 5 Changes in the sensitivity of the Hyphantria cunea to Serratia marcescens SM1 after RNAi

[0094] Healthy 4th-instar nymphs of similar status were selected as experimental materials. The dsHcattacin1 (1 μg / μL) treatment group was set as the experimental group, the dsGFP (1 μg / μL) treatment group was set as the control group, and the water treatment group was set as the blank control group. Each larva was injected with 1 μL of the reagent and fed normally for 48 hours before subsequent experiments. Equal weights of fresh mulberry leaves were mixed with water and 9.5×10 9 CFU / mL SM1 bacterial solution was soaked for 10-15s, and then dried and fed to each group of gypsy moth larvae. Transparent plastic boxes (20cm×14cm×10cm) were used as breeding containers, and 20 gypsy moth larvae of the same treatment were placed in each box. The breeding environment temperature was 26℃. Three replicate experiments were set up. Observation was performed every 6 hours, and the number of deaths of gypsy moth larvae in each group was recorded.

[0095] It can be clearly seen from the survival curves that there is no difference between the CK group and the dsGFP group, and there is no significant difference between the CK-SM1 and dsGFP-SM1 groups. However, there is a significant difference between the dsHcattacin1-SM1 and dsHcattacin1 groups, and their mortality rate is also significantly increased ( Figure 3 ).

[0096] In summary, this patent uses the technology of bacterial dsRNA propagation to synthesize the dsRNA of Hcattacin1 of the gypsy moth for the first time, establishes the RNA interference system of Hcattacin1 of the gypsy moth, and achieves obvious gene silencing effect in the gypsy moth, providing technical support for the application of Hcattacin1 RNAi technology. The expression of the antimicrobial peptide Hcattacin1 gene was successfully interfered with by this system, and it was found that the sensitivity of the gypsy moth with Hcattacin1 gene silenced to the SM1 strain of Serratia marcescens was significantly improved. Through experiments, it was found that the mortality rate of the gypsy moth was significantly improved when Hcattacin1 dsRNA and SM1 were used simultaneously, indicating that it can improve the control effect of biological control bacteria. These provide a theoretical basis for the application of Hcattacin1 dsRNA in the control of gypsy moth. The present invention lays a theoretical foundation for the development of immunosuppressants that are safe for humans and animals, and provides a new theory for the biological control of pests, and ultimately provides new strategies and new ways of pest control for my country's green agricultural production and sustainable development.

[0097] The present invention provides a control idea and method for the American white moth. There are many methods and ways to implement the scheme. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. An antimicrobial peptide for controlling the gypsy moth Hcattacin1 Gene dsRNA, characterized in that Said Hcattacin1 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the dsRNA is based on the Hcattacin1 Plasmid was used as template and upstream primer ds Hcattacin1 F and downstream primer ds Hcattacin1 R is amplified by PCR, where Upstream primer ds Hcattacin1 F is: C GAGCTCCTTGCAGCTATGGTATTATTGG; Downstream primer ds Hcattacin1 R is: TCC CCCGGG GATGCCGTGTTCATCTTATTG.

2. The antimicrobial peptide according to claim 1 Hcattacin1 Application of genes in the control of the American white moth.

3. A dsRNA for controlling the gypsy moth, characterized in that: The dsRNA is an antimicrobial peptide Hcattacin1 The dsRNA of the gene, the synthesized ds Hcattacin1 The targeted nucleotide sequence is shown in SEQ ID NO:

1.

4. A DNA encoding the dsRNA targeting protein according to any one of claims 1 to 3.

5. A recombinant expression vector, characterized in that: It expresses the dsRNA according to any one of claims 1 to 3.

6. A host bacterium, characterized in that The recombinant expression vector according to claim 5 is transformed therein.

7. A method for controlling the gypsy moth, characterized in that: The dsRNA according to any one of claims 1 to 3 is used in combination with Serratia marcescens to treat the American white moth.

8. The method according to claim 7, characterized in that The dsRNA concentration was 1 μg / μL, and the 9.5×10 9 CFU / mL of Serratia marcescens.

9. The method according to claims 7-8, characterized in that The gypsy moth was first treated with the dsRNA concentration for 48 hours, and then treated with Serratia marcescens.

10. The method according to claim 9, characterized in that The treatment method comprises feeding the bacterial liquid of Serratia marcescens.

Images