FaSAP6 gene for regulating and controlling strawberry fruit hardness and application of FaSAP6 gene

Abstract

The invention belongs to the technical field of plant molecular genetic engineering, and particularly relates to a FaSAP6 gene for regulating and controlling strawberry fruit hardness and application of the FaSAP6 gene. The nucleotide sequence of the FaSAP6 gene is as shown in SEQ ID NO. 1. A strawberry instantaneous transformation test proves that the FaSAP6 gene can positively regulate and control the strawberry fruit hardness, when the FaSAP6 gene is over-expressed, the strawberry fruit hardness can be improved by increasing cell wall substances of fruits, and when the FaSAP6 gene expression is reduced, the strawberry fruit softening can be accelerated. The invention provides a new gene resource for molecular breeding for delaying strawberry fruit softening and improving strawberry fruit storage and transportation performance.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular gene engineering, and in particular to a FaSAP6 gene for regulating the hardness of strawberry fruit and an application thereof. Technical Background

[0002] Strawberry is a horticultural crop with important economic value. However, in the late stage of fruit development, the degradation of cell wall materials leads to the destruction of fruit cell walls, softening of fruits, and reduction of hardness, which seriously affects the shelf life of fruits. The softening of fruits during development is mainly attributed to the degradation of cell wall materials by cell wall enzymes, which causes the cells to dissociate from each other. Pectin in the middle lamina and primary cell wall of higher plants is an important component of cell wall support and rigidity. It can be lysed by pectinase, thereby destroying the adhesion of pectin and achieving the purpose of fruit softening. Transcription factors directly or indirectly respond to the process of fruit ripening and softening. At the same time, transcription factors can also participate in the degradation of fruit cell walls by regulating the transcription of cell wall enzyme genes. Studies have shown that the NAC transcription factor FvRIF positively regulates fruit softening by binding to the promoters of FvPL2, FvPG2, FvXTH and FvEXP3. At the same time, FvRIF is located upstream of the regulation of strawberry fruit ripening and positively regulates fruit ripening by binding to the promoters of anthocyanin pathway genes FvCHS1, FvDFR, FvANS and FvUFGT. FvWRKY48 can bind to the W-box element of the FvPLA promoter, promote the expression of FvPLA, and cause fruit softening.

[0003] Stress-associated proteins (SAPs) are a class of zinc finger proteins containing A20 / AN1 domains, and SAP proteins can improve the resistance of plants to biotic and abiotic stresses, ultimately achieving the purpose of protecting crop yields. Hou et al. (2022) demonstrated that soybean A20 / AN1 zinc finger protein GmSAP5 confers drought tolerance by increasing plant sensitivity to abscisic acid (ABA) and reducing stomatal aperture. Chang et al. (2018 and 2022) confirmed that orchid SAP genes Pha13 and Pha21 play a central role in SA-mediated antiviral immunity. SAP genes can also regulate plant growth and development, but their effects on fruit hardness have not been reported. Summary of the invention

[0004] In order to solve the problems in the prior art, one of the objects of the present invention is to provide a FaSAP6 gene for regulating the firmness of strawberry fruit, the nucleotide sequence of the FaSAP6 gene is shown in SEQ ID NO.1; the amino acid sequence encoded by the FaSAP6 gene is shown in SEQ ID NO.2.

[0005] A second object of the present invention is to provide an application of the FaSAP6 gene as described above in regulating the firmness of strawberry fruit.

[0006] Preferably, the firmness of strawberry fruit is increased by increasing the expression or activity of the FaSAP6 gene; or the firmness of strawberry fruit is reduced by inhibiting the expression or activity of the FaSAP6 gene.

[0007] Preferably, the expression of the FaSAP6 gene is increased by a FaSAP6 overexpression vector, the FaSAP6 overexpression vector is pCAMBIA1302-FaSAP6, and the PCR product of the FaSAP6 gene is obtained using strawberry fruit cDNA as a template, and is connected to a pCAMBIA1302-GFP vector.

[0008] Preferably, the expression of the FaSAP6 gene is inhibited by an RNAi interference vector, the RNAi interference vector is FaSAP6-TRV2, and the PCR product of the FaSAP6 gene is obtained using strawberry fruit cDNA as a template, and is connected to the TRV2 vector in the VIGS system. The sequence of the RNAi interference vector is shown in SEQ ID NO.3.

[0009] A third object of the present invention is to provide a construct for increasing the expression level of the FaSAP6 gene in strawberry, wherein the construct contains the FaSAP6 gene as described above.

[0010] A fourth object of the present invention is to provide a construct for reducing or eliminating the expression of the FaSAP6 gene in strawberry, wherein the construct comprises an siRNA complementary to the target mRNA of the FaSAP6 gene.

[0011] A fourth object of the present invention is to provide a host cell containing the construct as described above.

[0012] Preferably, the host cell is Agrobacterium tumefaciens GV3101.

[0013] Finally, the present invention provides an application of the construct or the host cell described above in regulating the firmness of strawberry fruit.

[0014] The beneficial effects of the present invention are:

[0015] 1) The present invention proves through strawberry transient transformation experiments that the FaSAP6 gene can positively regulate the fruit hardness of strawberries. When the FaSAP6 gene is overexpressed, the fruit hardness of strawberries can be improved by increasing the cell wall substances of the fruits. When the FaSAP6 gene expression is reduced, the softening of strawberry fruits will be accelerated.

[0016] 2) The present invention uses biochemistry, molecular biology and transgenic technology to explore the molecular regulatory mechanism of the FaSAP6 gene in regulating the hardness of strawberry fruit, providing new gene resources for molecular breeding to delay fruit softening and improve the storage and transportation performance of strawberry fruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the PCR gel electrophoresis diagram of the FaSAP6 gene cloning in Example 1 of the present application, wherein M is the DL2000 marker; 1 is the PCR amplified fragment of FaSAP6.

[0018] Figure 2 This is a comparison diagram of fruit phenotypes after transient expression of the FaSAP6 gene in Example 3 of the present application.

[0019] Figure 3 This is a comparison chart of the expression levels of FaSAP6 and FaPL1 in strawberry fruit after transient expression in Example 3 of the present application.

[0020] Figure 4 This is a comparison chart of fruit hardness after transient expression in Example 3 of the present application.

[0021] Figure 5 This is a comparison chart of the pectin lyase activity in Example 3 of the present application.

[0022] Figure 6 This is a comparison chart of pectin content in Example 3 of the present application. DETAILED DESCRIPTION

[0023] For ease of understanding, the technical solution of the present invention is described in more detail below in conjunction with embodiments:

[0024] Example 1

[0025] Cloning of the Strawberry Transcription Factor FaSAP6 Gene

[0026] With the help of yeast one-hybrid system, the 'bait' vector pFaPL1-pAbAi was constructed by the FaPL1 promoter of octoploid strawberry 'Sweet Charlie' and the 'prey' vector was constructed by the cDNA library of strawberry fruits at different developmental stages. The clones were screened in yeast strain Y1HGold and sequenced. The FaSAP6 gene was identified and obtained by comparing with the strawberry genome database.

[0027] Design the full-length primer pair based on the full-length sequence of FaSAP6 gene:

[0028] FaSAP6-F:

[0029]

[0030] FaSAP6-R:

[0031]

[0032] The underlines indicate the homology arms on the pCAMBIA1302 vector, and the wavy lines indicate the restriction sites of Bgl II and Spe I.

[0033] Total RNA of "Sweet Charlie" strawberry fruit during the color change period was extracted and reverse transcribed into cDNA using a reverse transcription kit. Using this cDNA as a template, a PCR reaction was performed under the action of TaKaRa LA Taq heat-resistant DNA polymerase at 94°C for 4min; 35 cycles of 95°C for 30sec, 56°C for 30sec, 72°C for 40sec; 72°C for 10min to obtain a PCR product of the full length of the FaSAP6 gene. The PCR product was purified and recovered, and then connected to the pCAMBIA1302 vector that had been recovered by Bgl II and Spe I restriction enzymes at 25°C for 30min under the action of homologous cloning enzymes. The ligated product was then introduced into E. coli by heat shock method and coated with LB solid medium (50mg·L -1 Ampicillin) and incubated at 37°C in the dark for 16 hours to obtain a single clone. The positive clone carrying the FaSAP6 gene was identified by PCR reaction and sequenced to finally determine the nucleotide sequence of the FaSAP6 gene.

[0034] Figure 1 It is the PCR gel electrophoresis diagram of FaSAP6 gene cloning. The open reading frame length of FaSAP6 gene sequence is 507bp. The nucleotide sequence of FaSAP6 gene is shown in SEQ ID NO.1. FaSAP6 gene encodes 168 amino acids (including the stop codon), and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0035] Example 2

[0036] Construction of FaSAP6 binary expression vector and RNAi interference vector

[0037] 1) Construction of FaSAP6 binary expression vector: The positive monoclonal plasmid DNA of Example 1 and the plasmid DNA carrying the empty vector pCMABIA1302 were introduced into Agrobacterium tumefaciens GV3101 to obtain the positive monoclonal 1302-FaSAP6.

[0038] 2) Construction of RNAi interference vector: A fragment of about 212 bp was selected near the 5' end of the FaSAP6 gene, avoiding the conserved domain, and a primer pair for the fragment was designed:

[0039] FaSAP6-TRVF:CG GAATTC TGGCAGCAACATCCATTGGT

[0040] FaSAP6-TRVR:CG GGATCC TAAACCAACACGCTTTCGGC

[0041] The underlined lines represent the EcoR I and BamH I restriction sites, respectively.

[0042] The monoclonal plasmid DNA of Example 1 was used as a template to perform PCR amplification of the FaSAP6 gene fragment. The fragment and the plasmid DNA carrying the TRV2 vector were subjected to double restriction digestion reaction of EcoR I and BamH I, respectively. The FaSAP6 gene fragment and the TRV2 vector fragment after restriction digestion were recovered using a gel recovery kit, and then the two recovered fragments were connected using T4 ligase. The ligation product was transformed into E. coli using the heat shock method, and coated with 50 mg·L -1 Single clones were obtained after culturing in the dark at 37°C for 16 h on LB medium containing kanamycin. After detecting the positive clones carrying the FaSAP6 fragment by PCR, sequencing was performed to obtain positive single clones whose sequences matched those of Example 1. The plasmid DNA and the plasmid DNA carrying the TRV2 vector were used to transform Agrobacterium tumefaciens GV3101, respectively, to obtain positive single clones of GV3101 carrying FaSAP6-TRV2 (SEQ ID NO. 3) and the TRV2 vector.

[0043] Example 3

[0044] Effect of FaSAP6 gene on strawberry fruit firmness

[0045] Agrobacterium tumefaciens carrying 1302-FaSAP6, 1302 (control), FaSAP6-TRV2 and TRV2 (control) in Example 2 were respectively injected into strawberry fruits at the green-white stage through needles using disposable 1 mL syringes to transiently express the carried vectors in the strawberry fruits.

[0046] In order to reduce the differences between fruits and the impact of the growth environment on fruit phenotype changes, the expression vector and empty vector were injected into the left and right sides of the same fruit respectively to facilitate the observation of fruit phenotype.

[0047] When using a texture analyzer to test the hardness of fruit, the hardness of 2-3 different positions of a fruit needs to be measured. In order to reduce uneven injection, which leads to excessive hardness differences at the injection sites, the entire fruit is injected. That is, the needle is inserted into the fruit through the fruit stalk and the injection liquid is injected. The hardness of the fruit is compared after the fruit is fully ripe.

[0048] The specific steps are as follows:

[0049] 1) Agrobacterium tumefaciens GV3101 carrying pCMABIA1302-FaSAP6, pCMABIA1302 (control), FaSAP6-TR V2 and TRV2 (control) were cultured in LB solid medium (containing 50 mg·L -1 Kanamycin and 50 mg L -1 After obtaining a single clone by streaking on the rifampicin, pick a single clone and inoculate it into 20 mL containing 50 mg·L -1 Kanamycin and 50 mg L -1 Rifampicin was added to the LB liquid medium and shaken at 200 rpm for 12 h at 28 °C until the OD 600 About 0.6-0.8;

[0050] 2) Transfer the bacterial solution in 1) to a 50 mL centrifuge tube, centrifuge at 5000 rpm for 5 min at room temperature, discard the supernatant, and collect the colonies;

[0051] 3) Use the impregnation solution (containing MES with a final concentration of 1.0 mol·L -1 , the final concentration of MgCl2 is 1.0 mol·L -1 The final concentration of acetosyringone was 1.0 mol·L -1 ) Resuspend the colony to obtain injection solution;

[0052] 4) Select strawberry green-white fruits with uniform size and no deformity, and use a 1mL sterile syringe to draw the injection solution. To observe the phenotypic changes of the fruit, insert the needle to a depth of 0.5cm from the surface of the fruit, and squeeze out 100μL of injection solution. To measure the fruit hardness and other indicators, insert the needle 1cm from the fruit stalk, and then squeeze 500μL of injection solution into the fruit. The injected strawberry fruits are set up in three replicates, with three fruits in each replicate.

[0053] 5) Take fruit samples for real-time quantitative analysis 3 days after injection; observe the phenotypic changes of strawberry fruits and take photos about 10 days after injection; after the fruit is fully ripe, use a texture analyzer to measure the fruit hardness. Method for measuring fruit hardness using a texture analyzer: Analyze the hardness of strawberry fruit using a texture analyzer, select a TA39 probe, and insert it 6mm into the fruit at a speed of 0.5mm / s. The insertion position is a point at the equator of the fruit and its opposite side, and the average of the two measured values ​​is the hardness of the fruit.

[0054] Experimental results:

[0055] See also Figure 2-Figure 6 . Figure 2This is a comparison of fruit phenotypes after transient expression of the FaSAP6 gene, where 1302 indicates that the pCAMBIA1302 empty vector was injected into strawberry fruit, FaSAP6-1302 indicates that the FaSAP6-1302 fusion expression vector was injected into strawberry fruit; TRV2 indicates that the TRV2 and TRV1 empty vectors were injected into strawberry fruit; FaSAP6-TRV2 indicates that the FaSAP6-TRV2 recombinant vector and the TRV1 empty vector were injected into strawberry fruit. It can be seen that overexpression of the FaAL6 gene in the fruit inhibits fruit ripening, while interference with FaAL6 gene expression promotes fruit ripening.

[0056] Figure 3 The figure is a comparison of the expression levels of FaSAP6 and FaPL1 in strawberry fruit after transient expression; A in the figure is the expression level of the FaSAP6 gene in the fruit after injection of the FaSAP6-1302 fusion expression vector, B is the expression level of the FaPL1 gene in the fruit after injection of the FaSAP6-1302 fusion expression vector, C is the expression level of the FaSAP6 gene in the fruit after injection of the FaSAP6-TRV2 vector, and D is the expression level of the FaPL1 gene in the fruit after injection of the FaSAP6-TRV2 vector. It can be seen that the expression of the FaSAP6 gene in the strawberry fruit injected with the FaSAP6-1302 fusion expression vector increased, while the expression level of FaPL1 decreased; the expression of the FaSAP6 gene in the strawberry fruit injected with the FaSAP6-TRV2 vector decreased, while the expression level of FaPL1 increased. Increasing the expression of the FaSAP6 gene inhibits the transcriptional activity of the FaPL1 gene, thereby slowing down the softening process of the fruit.

[0057] Figure 4 This is a comparison of fruit hardness after transient expression. Compared with the control, the hardness of strawberry fruit injected with the FaSAP6-1302 fusion expression vector increased significantly, while the hardness of strawberry fruit injected with the FaSAP6-TRV2 vector decreased significantly, indicating that the expression of the FaSAP6 gene is related to the hardness of strawberry, and increasing the expression of the FaSAP6 gene is beneficial to improving the hardness of strawberry fruit.

[0058] Figure 5 This is a comparison of pectin lyase activity in fruits after transient expression. Pectin lyase hydrolyzes pectin in the cell wall components, resulting in the destruction of the cell wall structure and accelerating the softening of the fruit. Compared with the control, the pectin lyase activity of strawberry fruits injected with the FaSAP6-1302 fusion expression vector was significantly reduced, while the pectin lyase activity of strawberry fruits injected with the FaSAP6-TRV2 vector was increased.

[0059] Figure 6This is a comparison of pectin content in the fruit after transient expression. WSP is water-soluble pectin, CBP is covalent pectin, and ISP is ionic pectin. It can be seen that WSP is significantly reduced when FaSAP6 is overexpressed, while the ISP content has no significant change. In the strawberry fruit where FaSAP6 gene expression is transiently inhibited, WSP is significantly increased compared with the control, and CBP content is reduced. Pectin is an important component of the cell wall. Increasing the expression of the FaSAP6 gene can increase the pectin content in strawberry fruit, thereby increasing the hardness of the fruit.

[0060] The above implementation modes are only used to illustrate the technical solutions of the present invention, but not to limit the present invention. Although the present invention has been described in detail with reference to the above implementation modes, those skilled in the art should understand that any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A FaSAP6 gene for regulating strawberry fruit firmness, characterized in that: The nucleotide sequence of the FaSAP6 gene is shown in SEQ ID NO.

1.

2. The FaSAP6 gene for regulating strawberry fruit firmness according to claim 1, characterized in that: The amino acid sequence encoded by the FaSAP6 gene is shown in SEQ ID NO.

2.

3. Use of the FaSAP6 gene as claimed in claim 1 in regulating the firmness of strawberry fruit.

4. The use according to claim 3, characterized in that By increasing the expression or activity of the FaSAP6 gene, the firmness of the strawberry fruit is increased; by inhibiting the expression or activity of the FaSAP6 gene, the firmness of the strawberry fruit is reduced.

5. The use according to claim 4, characterized in that The expression of the FaSAP6 gene is improved by a FaSAP6 overexpression vector, wherein the FaSAP6 overexpression vector is pCAMBIA1302-FaSAP6, and the PCR product of the FaSAP6 gene is obtained by using strawberry fruit cDNA as a template, and then connected to a pCAMBIA1302-GFP vector.

6. The use according to claim 4, characterized in that The expression of the FaSAP6 gene is inhibited by an RNAi interference vector, wherein the RNAi interference vector is FaSAP6-TRV2. The PCR product of the FaSAP6 gene is obtained by using strawberry fruit cDNA as a template and connected to the TRV2 vector in the VIGS system. The sequence of the RNAi interference vector is shown in SEQ ID NO.

3.

7. A construct for increasing the expression of FaSAP6 gene in strawberry, characterized in that: Contains the FaSAP6 gene as claimed in claim 1.

8. A construct for reducing or eliminating the expression of the FaSAP6 gene in strawberry, characterized in that It includes siRNA complementary to the target mRNA of the FaSAP6 gene.

9. A host cell, characterized in that Containing the construct according to claim 7, or containing the construct according to claim 8.

10. Use of the construct according to claim 7 or 8 or the host cell according to claim 9 in regulating strawberry fruit firmness.

Images