Application of LbMYB88 gene or overexpression vector of LbMYB88 gene in improving drought stress resistance of plant

Abstract

The invention belongs to the field of gene engineering, and particularly relates to application of an LbMYB88 gene or an overexpression vector of the LbMYB88 gene to improvement of drought stress resistance of plants. According to the application disclosed by the invention, by creating an overexpression Chinese wolfberry plant of the LbMYB88 gene, the fact that the overexpression Chinese wolfberry plant of the LbMYB88 gene subjected to drought treatment shows obvious resistance compared with a wild type Chinese wolfberry plant is found, a gene resource is provided for cultivating a stress-resistant Chinese wolfberry variety, a relatively good potential application value is achieved, and a theoretical foundation is laid for researching a drought-resistant molecular mechanism of Chinese wolfberry.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and specifically relates to LbMYB88 Gene or LbMYB88 Application of gene overexpression vector in improving plant resistance to drought stress. Background Art

[0002] Drought stress is a key factor affecting plant survival and growth. In recent years, due to global warming, water evaporation has increased, and the threat of drought stress to plants has become increasingly severe. Northwest my country is an arid and semi-arid region, and water shortage is the main feature of the region. The cultivation of drought-resistant varieties is of great significance to the agricultural development and ecological protection of the region.

[0003] Wolfberry ( Lycium barbarum ) belongs to Solanaceae ( Solanaceae ) Lycium Lycium ) is a perennial deciduous shrub. Its fruit contains a large amount of carotenoids, anthocyanins, vitamin C, polysaccharides and other substances, which have multiple physiological functions such as anti-oxidation, anti-aging, hypoglycemia and blood lipids. Lycium barbarum has strong drought resistance, cold resistance, salt and alkali resistance, and is an important plant in the saline-alkali desert area in northwest my country. In order to make Lycium barbarum have stronger drought resistance to adapt to more severe environments, it is necessary to accelerate the breeding process and cultivate Lycium barbarum germplasm that is resistant to drought and other abiotic stresses.

[0004] The R2R3-MYB transcription factor family is widely involved in plant growth, development, and abiotic stress processes. AtMYB59 Plays a negative regulatory role in inhibiting root growth. OsMYB30 transcription factor in rice negatively regulates the expression of downstream low-temperature response genes in the low-temperature stress response and participates in the cold stress response. SlMYB102 The gene improves tomato salt tolerance by upregulating the expression of salt stress-related genes. As a positive regulator, tomato SlMYB49 can enhance the ability to remove ROS, inhibit cell membrane damage and cell death, and improve plant resistance to salt stress. However, whether there are related factors involved in abiotic stress in wolfberry remains to be explored. Summary of the invention

[0005] In view of the above technical problems, the present invention provides LbMYB88 Gene or LbMYB88 Application of gene overexpression vector in improving plant resistance to drought stress. LbMYB88 Gene or LbMYB88 Gene overexpression vectors can be used to cultivate wolfberry plants with improved drought resistance.

[0006] The specific technical solutions provided by the present invention are as follows: In a first aspect, the present invention provides LbMYB88 Gene or LbMYB88 Application of gene overexpression vectors in improving plant resistance to drought stress; Said LbMYB88 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the plant is wolfberry.

[0007] As a preferred embodiment of the present invention, the overexpression vector is composed of LbMYB88 The gene was connected with the overexpression vector pHellsgate2; the overexpression vector was used LbMYB88 Gene function research to improve plant resistance to drought stress.

[0008] Further preferably, the construction of the overexpression vector is carried out according to the following steps: Using wolfberry cDNA as a template, primers were designed for PCR amplification to obtain PCR amplification products; Endonuclease XB I and XOt I. Double-digest the overexpression vector pHellsgate2 to obtain a linearized overexpression vector pHellsgate2; The PCR amplification product is connected to the linearized overexpression vector pHellsgate2, and the obtained recombinant product is transformed into tool cells to obtain the overexpression vector.

[0009] Furthermore, the primer sequences for PCR amplification are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0010] Furthermore, the reaction system of the PCR amplification is: 1 μL of each primer, 7.5 μL of ddH2O, 2 μL of cDNA; the reaction program is: 95°C for 2 min; 95°C for 30 s, 57°C for 30 s, 72°C for 90 s, 35 cycles; 72°C for 5 min.

[0011] In a second aspect, the present invention provides LbMYB88 Gene or LbMYB88 Application of gene overexpression vector in cultivating drought-resistant plants, the LbMYB88 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant is wolfberry.

[0012] As a preferred embodiment of the present invention, cultivating drought-resistant plants includes promoting LbMYB88 Gene expression.

[0013] Further, breeding drought resistant plants comprises LbMYB88 Gene or LbMYB88 The gene overexpression vector is introduced into the plant.

[0014] Furthermore, cultivating drought resistant plants comprises the following steps: The overexpression vector is transferred into competent cells, cultured, and an infection fluid is obtained; The infection liquid is used to infect plant cotyledons, and then cultured to obtain drought-resistant plants.

[0015] The overexpression vector is transferred into plants to construct transgenic plants, which are used to inhibit the accumulation of MDA content, reduce relative conductivity, and increase the SOD and POD activities of wolfberry leaves, thereby reducing the damage of drought stress to wolfberry.

[0016] The competent cells mentioned above can be Agrobacterium competent cells GV3101.

[0017] The cotyledons of the plants are infected with the infection liquid, and then subcultured, screened and rooted, and finally transferred to a matrix for culture to obtain drought-resistant transgenic plants; the matrix is ​​vermiculite.

[0018] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides LbMYB88 The gene overexpression vector can inhibit the accumulation of MDA content in wolfberry, reduce relative conductivity, and increase the SOD and POD activities of wolfberry, thereby reducing the damage of drought stress to wolfberry. LbMYB88 The gene and its overexpression vector can be used to improve the resistance of wolfberry to drought stress or to breed drought-resistant wolfberry varieties.

[0019] The present invention provides LbMYB88 Gene overexpression vector was used to analyze drought resistance of genetically transformed plants. LbMYB88 It provides a theoretical basis for the resistance mechanism and utilization of genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 For pHELLSgate2- LbMYB88 Diagram of the vector construction process; wherein, Figure 1 The A in LbMYB88 PCR amplification results of gene sequences; Figure 1 B in the figure represents the result of double restriction digestion of pHELLSgate2 vector; Figure 1 The C in the code indicates pHELLSgate2- LbMYB88 Vector E. coli detection results diagram; Figure 1 The D in the equation indicates pHELLSgate2- LbMYB88 Diagram of the results of vector recombinant plasmid Agrobacterium detection.

[0021] Figure 2 This is a diagram of the genetic transformation stages of black wolfberry; among them, Figure 2A in the figure indicates the black-fruited wolfberry seedlings cultured at 25℃ / 22℃, 16 h light / 8 h dark for 7 days; Figure 2 The B in the formula indicates that it contains pHELLSgate2- LbMYB88 Cotyledon explants of Lycium ruthenicum after Agrobacterium infection of plasmid; Figure 2 C in the figure indicates the explants of Lycium ruthenicum cultured in the screening medium for 34 days; Figure 2 D in the figure indicates the positive plants of Lycium ruthenicum transferred to the rooting medium.

[0022] Figure 3 for LbMYB88 The results of obtaining and identifying gene overexpression strains; Figure 3 The A in it indicates pHELLSgate2- LbMYB88 Carrier detection result diagram; Figure 3 The B in the LbMYB88 Gene expression detection results.

[0023] Figure 4 for LbMYB88 Phenotypes of gene overexpressing plants before and after drought stress treatment and after rehydration, with two parallels in each group.

[0024] Figure 5 for LbMYB88 The results of the tolerance identification of gene overexpression plants before and after drought treatment; Figure 5 A in the figure represents the relative conductivity measurement results of plants before and after drought treatment; Figure 5 B in the figure shows the results of measuring the malondialdehyde content in plants before and after drought treatment; Figure 5 C in the figure represents the results of SOD activity determination of plants before and after drought treatment; Figure 5 D in the figure represents the results of POD activity measurement of plants before and after drought treatment. DETAILED DESCRIPTION

[0025] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0026] Embodiment 1: LbMYB88 Gene overexpression vector construction 0. Plant materials: Ningxia wolfberry( Lycium barbarum L.), provided by Lycium barbarum Research Institute, Ningxia Academy of Agriculture and Forestry Sciences.

[0027] two, LbMYB88 Gene overexpression vector construction 1. RNA extraction RNA was extracted from the leaves of Lycium barbarum using NGzol Reagent Total RNA Rapid Extraction Kit (Huiling) according to the instructions of the kit and stored at -80°C for later use.

[0028] 2. Synthesis of the first strand of cDNA Reverse transcription was performed using RNA as a template and All-in-One First-Strand Synthesis MasterMix (with dsDNase) (Jiangsu Yugong Biology, EG15133S) was used to synthesize the first strand of cDNA. The specific operation is as follows:

[0029] Gently pipette and mix 1 μg of RNA, 1 μL of dsDNase, 1 μL of 10× dsDNase buffer and 10 μL of Nuclease-Free Water, centrifuge and incubate at 37°C for 2 min to remove genomic DNA contamination, then incubate at 65°C for 2 min to obtain the reaction product, which is placed on ice for later use; then take 10 μL of the reaction product, 4 μL of All-in-One First-Strand Synthesis Master Mix and 6 μL of Nuclease-Free Water, gently pipette and mix, centrifuge and incubate at 50°C for 15 min. After the reaction is completed, incubate at 65°C for 5 min to terminate the reaction, obtain cDNA, and store at -20°C.

[0030] 3. Construction of overexpression vector (1) Obtaining PCR products: Designing primers using Primer Premier 5.0 software LbMYB88 F and LbMYB88 R, using the cDNA obtained in step 2 as a template, PCR amplification was performed using a high-fidelity enzyme (Phanta Max SuperFidelity DNA Polymerase, Vazyme) to obtain the target gene LbMYB88 The PCR product was detected by agarose gel electrophoresis (eg Figure 1 As shown in A, the target gene LbMYB88 The PCR product was recovered using a purification recovery kit (Hui Ling, Shanghai).

[0031] PCR reaction conditions: 95°C for 3 min; 95°C for 30 s, 57°C for 30 s, 72°C for 90 s, 35 cycles; 72°C for 5 min.

[0032] PCR reaction system, a total of 25 μL: ddH2O 7.5 μL, 2×Phanta Max Master Buffer 12.5 μL, LbMYB88-F 1 μL, LbMYB88-R 1 μL, dNTP 0.5 μL, template cDNA 2 μL, Phanta Max Super-Fidelity DNA Polymerase 0.5 μL.

[0033] (2) Use XOt I and XB I restriction endonuclease linearized pHELLSgate2 vector. pHELLSgate2 vector as Figure 1 As shown in B.

[0034] (3) Use homologous recombination to connect the target gene fragment and the linearized vector.

[0035] Reaction system: LbMYB88 3μL of target gene fragment, 2μL of linearized pHELLSgate2 Vector, and 5μL of LightNing DNA Assembly Mix Plus.

[0036] Reaction conditions: 50°C for 60 min.

[0037] (4) pHELLSgate2- LbMYB88 The ligation product was transformed into E. coli by heat shock method. The specific operation is as follows: take out 100 μL of E. coli competent cells (DH5α) from 80℃, place them on ice to melt naturally; after the E. coli competent cells melt, add 10 μL of recombinant product to 100 μL of E. coli competent cells, flick the test tube to mix evenly, and let it stand on ice for 30 minutes; heat shock at 42℃ for 90 seconds and quickly put it on ice for 5 minutes; then add 600 μL of LB liquid culture medium without any antibiotics, shake and culture at 200 rpm / min in a 37℃ shaker for 1 hour to obtain bacterial solution; centrifuge the bacterial solution at 5000 rpm for 5 minutes, discard the supernatant, and resuspend the bacterial solution with 50 μL of sterile water; apply the resuspended bacterial solution to the solid LB culture medium containing 50 mg / mL spectinomycin (spec) with a spreader, and pick a single colony after inverting and culturing at 37℃; resuspend the picked single colony in water, and use it as a template, 35S-F and LbMYB88 -R primers for PCR detection, PCR test results are as follows Figure 1 C, the product length is 1451bp. After PCR detection, liquid LB medium containing 50mg / mL spec was used to extract the recombinant plasmid after overnight culture at 37℃. 35S-F was used as primer and sent to the company for sequencing. The plasmid with correct sequencing was named pHELLSgate2- LbMYB88 .

[0038] (5) The correctly sequenced plasmid pHELLSgate2- LbMYB88 The specific operation is as follows: 100 μL of Agrobacterium competent cells GV3101 (Weidi Biotechnology, Shanghai) was taken out from 80°C and placed on ice to thaw naturally; after the Agrobacterium competent cells GV3101 were thawed, 5 μL of the recombinant plasmid pHELLSgate2- LbMYB88 Add to Agrobacterium competent cells GV3101, flick the test tube to mix evenly, let stand on ice for 30 minutes, then put in liquid nitrogen for 5 minutes, 28°C water bath for 5 minutes, and then quickly put on ice for 5 minutes; then add 600 μL of LB liquid culture medium without antibiotics, shake at 28°C, 200 rpm / min for 3 hours; centrifuge the bacterial solution at 5000 rpm for 5 minutes, discard the supernatant, and resuspend the bacterial solution with 100 μL of sterile water; apply the resuspended bacterial solution to solid LB culture medium containing 50 mg / mL Kana and 50 mg / mL Rif with a spreader, and invert and culture at 28°C; pick a single colony on the solid LB culture medium and culture it in LB liquid culture medium containing 50 mg / mL kana and 50 mg / mL Rif, and then use this as a template, 35S-F and LbMYB88 -R primers for PCR detection, the results are as follows Figure 1 The product length was 1451 bp, and the recombinant plasmid pHELLSgate2- LbMYB88 The obtained Agrobacterium bacterial liquid was stored at 80°C with 50% glycerol for later use.

[0039] LbMYB88 The sequences and detection primers are as follows: LbMYB88 sequence:

[0040] LbMYB88 -F:5'- CATTTGGAGAGGACACGCTCGAG ATGCAAAATATGAAGAAAAGTGG-3', SEQ IDNO.2; LbMYB88 -R:5'- TCTCATTAAAGCAGGACTCTAGA TTATAGACTGTGGAGGAGGGCT-3', SEQ IDNO .3; 35S-F: 5'-GACGCACAATCCCACTATCC-3', SEQ ID NO.4.

[0041] Note: The underlined regions indicate upstream / downstream vector end homology sequences.

[0042] Embodiment 2, LbMYB88 Obtaining gene overexpression plants 1. Treatment of black wolfberry seeds Soak the black wolfberry seeds in clean water for 20 minutes, pour out the clean water, wash with 75% ethanol for 60 seconds, and then wash the seeds with 84 disinfectant and sterile water in a volume ratio of 1:1 for 8 minutes, shaking continuously during the period, pour out the disinfectant, wash with sterile water for 3 times, inoculate the black wolfberry seeds on 1 / 2MS culture medium, and culture them in an artificial climate chamber at 25℃ / 22℃ and 16 h / 8 h light for 7 days, until most of the cotyledons are fully expanded and the seeds are visible. Figure 2 Middle A.

[0043] 2. Preparation of Explants Select sterile seedlings with fully expanded cotyledons in a clean bench, cut each cotyledon into one explant, The obtained cotyledon explants were placed on KCMS pre-culture medium and cultured at 25°C in the dark for 1 day.

[0044] The formula of KCMS pre-culture medium is as follows: weigh 4.43 g / L MS powder, 30 g / L sucrose, adjust pH to 5.8, add 7.5 g / L agar, and sterilize at 121°C under high pressure for 21 min.

[0045] 3. Explant Infection 1. Take pHELLSgate2- LbMYB88 GV3101 Agrobacterium was streaked and activated on LB solid medium containing 50 mg / L Rif and 50 mg / L Kan.

[0046] 2. Pick a single clone and add it to 15 mL of LB liquid medium containing 50 mg / L Rif and 50 mg / L Kan. Culture at 28°C with shaking until OD 600 =about 0.8.

[0047] 3. Centrifuge at 5000rpm for 5min to collect the bacteria, remove the supernatant, add an equal volume of Agrobacterium suspension, and infect wolfberry explants. Figure 2 Middle B.

[0048] Among them, LB liquid culture medium: yeast extract 5g / L, tryptone 5g / L, sodium chloride 10g / L; LB solid culture medium: yeast extract 5g / L, tryptone 5g / L, sodium chloride 10g / L and agar 15g / L.

[0049] Agrobacterium suspension: weigh 4.43 g / L MS powder and 30 g / L sucrose, adjust the pH to 5.8, and sterilize at 121°C for 21 min.

[0050] Among them, MS powder: Phytotech, M524.

[0051] 4. Screening and Rooting Culture After the explants were infected, the Agrobacterium on the surface was dried and cultured in KCMS medium for two days in the dark. Then, the culture medium was transferred to the screening medium until adventitious buds grew. The screening medium was changed every 2 weeks. Figure 2 C; transfer the adventitious buds to the rooting medium to make them take root, such as Figure 2 Middle D; After rooting, wild-type and transgenic plants with the same growth potential were selected and transferred to vermiculite to obtain wolfberry seedlings for subsequent experiments.

[0052] Screening medium formula: Weigh 4.43g MS powder (Phytotech, M519), dissolve in 800mL ultrapure water, add 30g sucrose, and dilute to 1L. Adjust pH to 5.8, add 7.5g agar, autoclave at 121℃ for 21min, and add antibiotics 0.05mg / L 6-BA + 0.02mg / L NAA + 360mg / L TMT (Timentin) + 50mg / L kana after cooling.

[0053] Rooting medium: Weigh 4.43g MS powder (Phytotech, M519), dissolve in 800mL ultrapure water, add 30g sucrose, 2mg / L IBA (indole-3-butyric acid), and dilute to 1000mL. Adjust pH to 5.8, add 7.5g agar, autoclave at 121℃ for 21min, and add antibiotics 360mg / L TMT + 50mg / L kana after cooling.

[0054] 5. Identification of transgenic plants 1. Extraction of transgenic black wolfberry plants by CTAB method ( LbMYB88 -OE-Lr) and wild-type Lycium barbarum (WT-Lr) plant leaves. The specific operation is:

[0055] (1) Place fresh leaves in a 2 mL centrifuge tube filled with steel balls, freeze them quickly with liquid nitrogen, and grind them evenly into powder.

[0056] (2) Add 600 μL of C TAAB extract, vortex to mix, and place in a 65°C water bath for 30 min.

[0057] (3) Add 600 μL of chloroform in a fume hood, shake to mix, and centrifuge at 12,000 rpm for 10 min.

[0058] (4) Use a 1 mL pipette to carefully aspirate 400 μL of the supernatant and transfer it to a new centrifuge tube. Add an equal volume of isopropanol, mix well, and place in a -20 °C refrigerator to settle for 1 h.

[0059] (5) Centrifuge at 12000 rpm for 10 min and discard the supernatant.

[0060] (6) Add 1 mL of 75% ethanol by volume, shake to mix, centrifuge at 12,000 rpm for 5 min, discard the supernatant, and place in a fume hood to evaporate the ethanol.

[0061] (7) Finally, add 100 μL Tris-HCl solution, mix thoroughly, and store the DNA sample in a -20°C refrigerator. Tris-HCl: 10 mM, pH 8.0.

[0062] 2. Using primers 35SF and LbMYB88 R performed PCR on the extracted DNA. The results were as follows Figure 3 As shown in A in Figure 1, positive wolfberry seedlings were successfully obtained. LbMYB88 RTF and LbMYB88 RTR, LbACTIN The internal reference gene was used to detect the expression of 8 positive wolfberry seedlings and leaves of wild-type wolfberry plants by qRT-PCR. LbMYB88 The expression of genes was detected, and the results showed that compared with the wild type, the expression of 8 overexpressed wolfberry seedlings LbMYB88 The expression levels of the genes were significantly higher than those of the wild type ( Figure 3 B).

[0063] Table 1 Quantitative primers Embodiment 3, LbMYB88 Analysis of genes for drought resistance in wolfberry 1. Select wild-type wolfberry plants WTLr and transgenic wolfberry plants with consistent growth LbMYB88 OELr8 and LbMYB88- OELr14 was subjected to drought treatment.

[0064] The specific operation is as follows: wild-type wolfberry plants (WTLr) and transgenic wolfberry plants cultured for 30 days were respectively LbMYB88 OELr8 and LbMYB88- OELr14 was watered sufficiently, and after absorbing enough water, the excess water was poured out, and watering was stopped to allow it to dry naturally; wild-type wolfberry plants (WTLr) and transgenic wolfberry plants that were not subjected to drought treatment (normal water supply) LbMYB88 OELr8 and LbMYB88- OELr14 served as a control (CK).

[0065] The results are as follows Figure 4 As shown in Figure 2, on the 10th day of drought treatment, the leaves of the wild-type wolfberry plant WTLr wilted to a greater extent, while the leaves of the transgenic wolfberry plant LbMYB88 OELr8 and LbMYB88- OELr14 wilted to a lesser extent; on the 13th day of drought treatment, the wild-type wolfberry plants WTLr wilted completely, while the transgenic wolfberry plants LbMYB88 OELr8 and LbMYB88- The degree of leaf wilting of OELr14 was still less than that of the wild-type wolfberry plant WTLr. After 2 days of rehydration, the wild-type wolfberry plant WTLr did not survive, while the transgenic wolfberry plant LbMYB88 OELr8 and LbMYB88- OELr14 survived normally.

[0066] 2. Detection of wild-type wolfberry plants WTLr and transgenic wolfberry plants after 13 days of drought treatment LbMYB88 OELr8 and LbMYB88- The relative conductivity, malondialdehyde (MDA) content, superoxide dismutase (SOD) and peroxidase (POD) activities of OELr14 leaves were measured as follows:

[0067] (1) Determination of relative conductivity: Add 10 mL of ultrapure water to a 15 mL centrifuge tube, and then add 6 leaves with a diameter of 0.5 cm to the centrifuge tube. Place the centrifuge tube in a shaker at 28°C for 2 hours and measure the initial conductivity (EC1). Subsequently, boil the sample in water for 30 minutes, cool it naturally to room temperature, and measure the final conductivity (EC2). The calculation formula for relative conductivity (REL) is REL=EC1 / EC2×100%.

[0068] (2) Determination of malondialdehyde content and SOD and POD enzyme activities: 1) Enzyme extraction: Weigh 0.1-0.2g of wolfberry leaves with a 1 / 10,000 balance and place in a pre-cooled mortar. Transfer the ground homogenate to a centrifuge tube, dilute to 1mL with phosphate buffer, and then place the centrifuge tube in an ice box. Centrifuge at 4℃ 12000rpm for 20min. The supernatant is the enzyme solution. After centrifugation, keep it in the ice box and immediately measure the activity of antioxidant enzymes.

[0069] 2) Determination of malondialdehyde content 0.5% TBA by volume: Weigh 5 g of trichloroacetic acid and dissolve it in 100 mL of water. Then weigh 0.5 g of TBA and dissolve it in 10 mL of 1M NaOH, and finally dilute to 100 mL with the freshly prepared 5% trichloroacetic acid solution.

[0070] The NaOH solution was prepared by dissolving 4 g in 100 mL of water.

[0071] This reagent should be prepared and used immediately, placed at room temperature, and protected from light. Add 300μL of 0.5% TBA and 150μL of enzyme solution to a 1.5mL centrifuge tube, mix well, and boil in 100℃ water bath for 20min. When the time is up, immediately cool it to room temperature in an ice water bath, centrifuge at 3000rpm for 10min, take the supernatant, and measure the absorbance at 532nm, 600nm, and 450nm using a UV spectrophotometer.

[0072] The calculation formula is: MDA concentration (μmol / L) = 6.45 (OD 532nm −OD 600nm )−0.56×OD 450nm .

[0073] MDA content (μmol / g Fw) = MDA concentration (μmol / L) × extract volume (mL) / plant tissue fresh weight (g).

[0074] 3) Determination of POD activity 50mM (pH 7.0) phosphate buffer; 100mM H2O2: 1021μL 30% H2O2, dilute to 100mL, store at 4℃ away from light, use immediately after preparation; 100mM guaiacol: draw 0.4mL and dilute to 100mL, store at 4℃. Add 230μL 50mM (pH 7.0) phosphate buffer, 30μL 100mM guaiacol, 15μL enzyme solution, and 30μL 100mM H2O2 to start the reaction. The measurement wavelength is 470nm, and the kinetic curve is used.

[0075] The calculation formula is: POD activity (μmol g -1 s -1)=(ΔA470nm×1) / (0.015×FW×26.8×60×3)=(absorbance value×volume of extract) / (amount of enzyme solution used in the assay×fresh weight of sample×extinction coefficient×time).

[0076] 4) Determination of SOD activity 160 μL of 0.05 mol / L phosphate buffer (pH 7.8), 30 μL of 130 mmol / L methionine (Met) solution, 30 μL of 750 μmol / L nitroblue tetrazolium solution (NBT), 30 μL of 100 μmol / L EDTA-Na2 solution, 20 μL of enzyme solution, and 30 μL of 20 μmol / L riboflavin solution were added to the sample tube in sequence. No enzyme solution was added to the control tube, and 180 μL of 0.05 mol / L phosphate buffer (pH 7.8), 30 μL of 130 mmol / L methionine (Met) solution, 30 μL of 750 μmol / L nitroblue tetrazolium solution (NBT), 30 μL of 100 μmol / L EDTA-Na2 solution, and 30 μL of 20 μmol / L riboflavin solution were added in sequence. The absorbance value was measured at a wavelength of 560 nm.

[0077] The calculation formula of SOD activity is: SOD activity (U / g Fw) = ((absorbance of control tube - absorbance of sample tube) × volume of extract) / (absorbance of control tube × 0.5 × fresh weight of sample × amount of enzyme solution used in the assay).

[0078] The results showed that after drought treatment, transgenic wolfberry plants LbMYB88 OELr8 and LbMYB88- The relative conductivity and MDA content of OELr14 leaves were significantly lower than those of wild type ( Figure 5 A and B), SOD and POD activities were significantly higher than those of the wild type ( Figure 5 C and D); the above results show that LbMYB88 Overexpression of the gene can inhibit the accumulation of MDA content, reduce the ion release rate, and reduce the damage of drought to wolfberry by increasing the SOD and POD activities of wolfberry plants. LbMYB88 Overexpression of the gene can improve the resistance of wolfberry to drought stress.

[0079] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0080] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. LbMYB88 Gene or LbMYB88 The use of a gene overexpression vector in improving plant resistance to drought stress is characterized in that: Said LbMYB88 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant is wolfberry.

2. The use according to claim 1, characterized in that: The overexpression vector is LbMYB88 The gene was obtained by connecting with the overexpression vector pHellsgate2.

3. The use according to claim 2, characterized in that: The construction of the overexpression vector is carried out according to the following steps: Using wolfberry cDNA as a template, primers were designed for PCR amplification to obtain PCR amplification products; Endonuclease XB I and XOt I. Double-digest the overexpression vector pHellsgate2 to obtain a linearized overexpression vector pHellsgate2; The PCR amplification product is connected to the linearized overexpression vector pHellsgate2, and the obtained recombinant product is transformed into a tool cell to obtain the overexpression vector.

4. The use according to claim 3, characterized in that: The primer sequences for PCR amplification are shown in SEQ ID NO.2 and SEQ ID NO.

3.

5. The use according to claim 4, characterized in that: The reaction system for PCR amplification was: 1 μL of each primer, 7.5 μL of ddH2O, and 2 μL of cDNA; The PCR amplification reaction program was: 95°C for 3 min; 95°C for 30 s, 57°C for 30 s, 72°C for 90 s, 35 cycles; 72°C for 5 min.

6. LbMYB88 Gene or LbMYB88 The use of a gene overexpression vector in cultivating drought-resistant plants is characterized in that: Said LbMYB88 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant is wolfberry.

7. The use according to claim 6, characterized in that: Breeding drought-resistant plants includes promoting LbMYB88 Gene expression.

8. The use according to claim 7, characterized in that: Breeding drought-resistant plants involves LbMYB88 Gene or LbMYB88 The gene overexpression vector is introduced into the plant.

9. The use according to claim 8, characterized in that: Breeding drought-resistant plants involves the following steps: The overexpression vector is transferred into competent cells, cultured, and an infection fluid is obtained; The infection liquid is used to infect plant cotyledons, and then cultured to obtain drought-resistant plants.

10. The use according to claim 9, characterized in that: The competent cells are Agrobacterium competent cells GV3101.

Images