Cloning primer, method and application of okra AeC4H gene

Abstract

The invention belongs to the technical field of biology, and relates to a cloning primer pair of an okra AeC4H gene, a cloning method and application of the okra AeC4H gene, and the primer pair can efficiently amplify a full-length CDS sequence of the AeC4H gene; the cloning method comprises the following steps: extracting total RNA (Ribonucleic Acid) of okra tissues, carrying out reverse transcription, carrying out PCR (Polymerase Chain Reaction) amplification, recovering a product, connecting a vector, screening positive clones and the like. The recombinant expression vector contains an AeC4H gene coding sequence which is inserted into the vector through a specific restriction enzyme cutting site. The invention also provides a method for transforming a plant by using the vector and a method for increasing the flavonoid content of the plant, which are realized by overexpressing the AeC4H gene. The invention also provides an application of the AeC4H gene or the encoded protein thereof in regulation and control of plant flavonoid biosynthesis. According to the invention, overexpression of the AeC4H gene in the plant is realized, so that the flavonoid content of the plant is increased, and the application of the AeC4H gene in regulation and control of biosynthesis of the flavonoid of the plant is disclosed.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a cloning primer and a cloning method of an okra AeC4H gene and application of the primer in improving the flavonoid content of okra and other crops. Background Art

[0002] Okra (Abelmoschus esculentus) is an important vegetable crop. Its capsule is rich in nutrients such as flavonoids, amino acids and proteins, and has high nutritional value and multiple health benefits. Flavonoids play an important role in plant growth and development, disease resistance and insect resistance, and adaptation to environmental stress. They also have medicinal values ​​such as antibacterial, antioxidant, anti-tumor, anti-allergic, and promoting the recovery of cardiovascular and cerebrovascular diseases. Therefore, increasing the content of flavonoids in okra is of great significance to improving its nutritional value and market competitiveness.

[0003] Cinnamate-4-hydroxylase (C4H) is one of the key enzymes in the biosynthesis pathway of flavonoids. The expression level of its encoding gene (AeC4H) directly affects the synthesis and accumulation of flavonoids. Although some progress has been made in the study of C4H genes in other plants, there has been no report on the study of AeC4H gene in okra. The prior art lacks the cloning method, expression regulation mechanism and application research of AeC4H gene in okra in increasing the content of flavonoids, which limits the research progress of increasing the content of flavonoids in okra by genetic engineering.

[0004] Therefore, developing an effective method for cloning the okra AeC4H gene, revealing its expression regulation mechanism, and exploring its application in increasing the flavonoid content of okra and other crops have important theoretical significance and practical application value. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a primer pair for cloning the AeC4H gene of okra, a cloning method and application thereof, so as to fill the gap in the prior art and provide technical support for increasing the flavonoid content of okra and other crops.

[0006] The inventors have continuously innovated and reformed through long-term exploration and attempts, as well as multiple experiments and efforts, to solve the above technical problems. The technical solution provided by the present invention is to provide a primer pair for cloning the AeC4H gene of okra, and the nucleotide sequence of the primer pair is:

[0007] Forward primer C4H-F: 5′-TAATCCCAATCTCCACCCT-3′;

[0008] Primer C4H-R: 5'-AATCAGAACATACGAGGCTTG-3'.

[0009] Compared with the prior art, the present invention has the following beneficial effects:

[0010] Compared with the prior art, the present invention provides a primer pair with strong specificity and high amplification efficiency for cloning the okra AeC4H gene, and the nucleotide sequence thereof is as described above. The primer pair can efficiently and accurately amplify the full-length CDS sequence of the okra AeC4H gene, laying a foundation for subsequent gene function research and application. By using the primer pair of the present invention, combined with optimized PCR amplification conditions, the success rate and accuracy of gene cloning can be significantly improved, and an effective technical means is provided for the cloning and functional research of related genes in okra and other plants. In addition, the primer pair of the present invention also has good specificity and stability, can effectively avoid nonspecific amplification and the formation of primer dimers, and further improves the reliability and repeatability of gene cloning.

[0011] On the basis of the above technical solution, the present invention can also be improved as follows:

[0012] Furthermore: the primer pair is used to amplify the full-length CDS sequence of the okra AeC4H gene, the CDS sequence is shown in SEQ ID NO:1, and encodes the amino acid sequence shown in SEQ ID NO:2.

[0013] Compared with the prior art, the beneficial effects of adopting the above further technical solution are:

[0014] The present invention further provides a primer pair for amplifying the full-length CDS sequence of the okra AeC4H gene, which encodes a specific amino acid sequence and provides an accurate molecular basis for the functional research and application of the okra AeC4H gene.

[0015] The present invention also provides a method for cloning the okra AeC4H gene, comprising the following steps:

[0016] (a) extracting total RNA from okra tissue and reversely transcribing it into cDNA;

[0017] (b) PCR amplification of C4H-F / C4H-R was performed using the primers, and the reaction system was: 12.5 μL of Max enzyme, 0.6 μL of each 10 μmol / L primer, 1 μL of cDNA template, and ddH2O was added to 25 μL;

[0018] (c) The amplification program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 54°C for 15 s, extension at 72°C for 20 s, 32 cycles; final extension at 72°C for 10 min;

[0019] (d) The PCR product was recovered and ligated to the pMD19-T vector, transformed into Escherichia coli DH5α competent cells, and positive clones were screened and sequenced for verification.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The invention provides a method for cloning the okra AeC4H gene. The method comprises the following steps: extracting total RNA from okra tissue and reversely transcribing the RNA into cDNA, performing PCR amplification using a specific primer pair, and combining an optimized reaction system and an amplification program. The full-length CDS sequence of the target gene can be amplified efficiently and accurately, and the reliability of the result is ensured by subsequent cloning and sequencing verification. Compared with the prior art, the method of the invention has the advantages of simple operation, strong specificity, high amplification efficiency, accurate results, and the like, and provides an effective technical means for cloning and functional research of the okra AeC4H gene.

[0022] Furthermore, the PCR amplification product is a 1506 bp nucleotide fragment, comprising the complete coding sequence of the AeC4H gene.

[0023] The present invention also provides a recombinant expression vector pBA-C4H-YFP, comprising the AeC4H gene coding sequence as shown in SEQ ID NO: 1, wherein the gene is inserted into the pBA-YFP vector via Xho I and BamH I restriction sites.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] Compared with the existing technology, this vector not only provides a powerful tool for the functional research of the AeC4H gene, but also provides a new approach for the research on the regulatory mechanism of the plant flavonoid biosynthesis pathway, which helps to deeply explore the role of the AeC4H gene in plants and its impact on the flavonoid content, and thus provides technical support for improving the content and quality of plant flavonoids.

[0026] The present invention also provides a method for transforming plants using the recombinant expression vector, comprising the following steps:

[0027] (a) transforming the recombinant vector into Agrobacterium tumefaciens EHA105 competent cells;

[0028] (b) Infecting Arabidopsis thaliana inflorescences by the floral dipping method and screening to obtain T1 transgenic seeds;

[0029] (c) Two generations of continuous screening were carried out in 1 / 2MS medium containing Basta to obtain homozygous T3 plants

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] Compared with the prior art, the method of the present invention is simple to operate and has high transformation efficiency. By continuously screening two generations in a 1 / 2MS medium containing Basta, homozygous T3 generation plants can be obtained, which provides strong technical support for studying the function of the AeC4H gene in plants and its effect on the flavonoid content.

[0032] Furthermore, the expression level of the AeC4H gene in the transgenic plant is significantly higher than that in the wild-type plant, and the total flavonoid content is 2.83 times that of the wild-type plant.

[0033] The present invention also provides a method for increasing the content of flavonoids in plants, comprising overexpressing the AeC4H gene shown in SEQ ID NO: 1 in a target plant.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] Compared with the prior art, the method of the present invention provides an effective genetic improvement strategy for increasing the content of plant flavonoids and has broad application prospects.

[0036] Furthermore, the plant is Arabidopsis thaliana, okra or an economic crop.

[0037] The present invention also provides the use of the AeC4H gene shown in SEQ ID NO: 1 or its encoded protein in regulating the biosynthesis of plant flavonoids.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] The present invention provides the application of the AeC4H gene or its encoded protein in regulating the biosynthesis of plant flavonoids, and reveals its regulatory effect on the flavonoid biosynthesis pathway in plants. Compared with the prior art, the present invention provides new targets and strategies for the study of the regulatory mechanism of plant flavonoid biosynthesis, helps to deeply understand the function of the AeC4H gene in plant flavonoid metabolism, and provides a theoretical basis and application prospect for improving the content and quality of plant flavonoids. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0041] Figure 1 This is a diagram showing the PCR amplification results of the AeC4H gene. Figure 1In the middle, M is Marker D2000; other lanes are AeC4H gene amplification products.

[0042] Figure 2 This is a diagram analyzing the hydrophilicity and hydrophobicity of the AeC4H protein.

[0043] Figure 3 This is the predicted tertiary structure of AeC4H protein.

[0044] Figure 4 This is the predicted transmembrane structure of AeC4H protein.

[0045] Figure 5 This is a phylogenetic tree based on the C4H gene.

[0046] Figure 6 This is an analysis diagram of the expression pattern of the AeC4H gene in different tissues of okra.

[0047] Figure 7 This is the double enzyme digestion verification diagram of the recombinant vector pBA-C4H-YFP. Figure 7 In the figure, M is Marker D12000; lane 1 is pBA-C4H-YFP plasmid; lane 2 is double-enzyme-digested pBA-C4H-YFP.

[0048] Figure 8 This is the result of resistance screening of transgenic Arabidopsis.

[0049] Fig. 9 This is the PCR identification result of transgenic Arabidopsis.

[0050] Fig.10 This is a graph showing the results of determining the total flavonoid content in transgenic Arabidopsis thaliana.

[0051] Fig.11 This is a diagram showing the expression of the AeC4H gene in transgenic Arabidopsis.

[0052] Fig.12 This is the distribution of pBA-C4H-YFP in cells under the YFP fluorescent protein channel.

[0053] Fig.13 This is the distribution of pBA-C4H-YFP in cells under DAPI. DETAILED DESCRIPTION

[0054] The following describes the invention in conjunction with specific embodiments.

[0055] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention.

[0056] In the present invention, unless otherwise specified, all equipment and raw materials can be purchased from the market or are commonly used in the industry. The methods in the following embodiments, unless otherwise specified, are conventional methods in the art.

[0057] This example simultaneously describes the primer pair for cloning the okra AeC4H gene, the method for cloning the okra AeC4H gene, the recombinant expression vector pBA-C4H-YFP, the method for transforming plants using the recombinant expression vector, the method for increasing the flavonoid content of plants, and the application of the AeC4H gene.

[0058] In this embodiment, okra materials were collected from Sichuan Provincial Institute of Agricultural Characteristic Plants, located at the Chengdu Pidu Experimental Base (30.818°N, 103.834°E), and the samples were quickly frozen in liquid nitrogen after collection and stored in a -80°C ultra-low temperature refrigerator for standby use. Arabidopsis thaliana was available in this laboratory and planted in an artificial climate incubator (culture conditions: light intensity 60%, darkness 8h, temperature 23°C; light 16h, temperature 25°C), and Arabidopsis thaliana grown for about 4 weeks was selected for the experiment.

[0059] The pMD19-T vector was purchased from Beijing Polymerase Biotechnology Co., Ltd.; Escherichia coli DH5α competent cells and Agrobacterium tumefaciens EHA105 competent cells were purchased from Beijing Bomade Gene Technology Co., Ltd.; the vector pBA-YFP was already available in this laboratory; the RNA extraction kit was purchased from FOREGENE; the reverse transcription cDNA kit, high-fidelity DNA polymerase, restriction endonuclease and ligase T4DNA Ligase were all purchased from TaKaRa; the agarose gel DNA recovery kit and plasmid extraction kit were purchased from Kangwei Century Biotechnology Co., Ltd.

[0060] Table 1 Primer sequences used Primer name

[0061] Primer name Primer sequence (5'–3') C4H-F TAATCCCAATCTCCACCCT C4H-R AATCAGAACATACGAGGCTTG C4HYFP-F CCGCTCGAGATGGACCTTCTCCTCCTTGAG(Xoh I) C4HYFP-R CGCGGATCCGAACATACGAGGCTTGGCA(BamH I) eIF4A-F ATGCATATGGTTTTGAGAAGCC eIF4A-R AAAGTTGCAGTCTTCCCAGTTC qC4H-F CAAGCAGCAAGAGAAGCGAC qC4H TGGACCATAAGGTTGTTTCA YFP-F GCGACGTAAACGGCCACAAGT YFP-R CAGCTCGTCCATGCCGAGAGT qAtEFIα-F ATTGACAGGCGTTCTGGTAAG qAtEFIα-R CAGCAACGGTCTGCCTCAT

[0062] 1. Cloning of Okra AeC4H gene

[0063] Total RNA from okra fruit was extracted using an RNA extraction kit, and cDNA was obtained by reverse transcription using a reverse transcription cDNA kit. Primers for AeC4H (C4H-F / C4H-R in Table 1) were designed based on the transcriptome data obtained by the research group in the early stage. The expression sequence of the AeC4H gene was cloned using the polymerase chain reaction (PCR) method with cDNA as a template. The total volume of amplification was 25 μL, including 12.5 μL of Max, 0.6 μL of 10 μmol / L primers F / R, 1 μL of cDNA, and 10.3 μL of ddH2O. The amplification program was: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 54°C for 15 s, extension at 72°C for 20 s, 32 cycles; extension at 72°C for 10 min, and storage at 10°C. After electrophoresis of the PCR product, the target fragment was recovered, connected to the pMD19-T vector and transformed into Escherichia coli DH5α competent cells, and the single clones with positive colony PCR were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0064] Using okra cDNA as template and C4H-F and C4H-R as primers, the AeC4H gene was amplified. Figure 1 shown. Figure 1 The first lane is a marker, which shows DNA fragments of different sizes and is used to determine the size of the PCR product. The marker bands are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom. Figure 1 The second lane is the PCR amplification product, showing a band of about 1500 bp.

[0065] from Figure 1 As can be seen in the figure, the PCR product band in the C4H lane is located around 1500 bp, which is consistent with the expected size of the okra AeC4H gene (about 1500 bp). This indicates that the full-length CDS sequence of the AeC4H gene was successfully amplified using the designed primer pairs C4H-F and C4H-R.

[0066] There is only one obvious band in the C4H lane, indicating that the PCR amplification has a high specificity and no non-specific amplification products are produced. This further verifies the specificity and effectiveness of the primer pairs C4H-F and C4H-R.

[0067] The brightness of the band is moderate, indicating that the efficiency of PCR amplification is high and sufficient PCR products can be produced for subsequent cloning and sequencing.

[0068] 2 Bioinformatics analysis of okra AeC4H

[0069] The physicochemical properties of the AeC4H gene were analyzed using the ProtParam (https: / / www.expasy.org / resources / protparam) and ProtScale (https: / / www.expasy.org / resources / protscale) online tools in the ExPASy database;

[0070] The protein tertiary structure was predicted using SWISS MODEL (https: / / swissmodel.expasy.org / interactive);

[0071] TMHMM (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ) was used to predict protein transmembrane structures;

[0072] The Neighbor-Joining method in MEGA 11 was used to construct the phylogenetic tree.

[0073] The full length of the coding sequence of the AeC4H gene is 1506 bp, as shown in SEQ ID NO:1; it encodes 501 amino acids, as shown in SEQ ID NO:2.

[0074] The physicochemical properties of the AeC4H gene were analyzed using the ProtParam and ProtScale online tools in the ExPASy database. The results showed that the molecular formula of AeC4H was C2636H4160N716O715S16, the relative molecular weight was 57.84 kD, the theoretical isoelectric point was 9.19; the instability coefficient was 44.87, indicating that it was an unstable protein. AeC4H was a hydrophilic protein ( Figure 2 );Use SWISS MODEL to predict protein tertiary structure ( Figure 3 ), the template sequence has a homology of 91.02% with the okra AeC4H protein sequence, and the global model quality estimate (GMQE) is about 0.95, and the modeling result has a high credibility; TMHMM is used to predict the protein transmembrane structure ( Figure 4), there is a transmembrane region between the 5th and 24th amino acids. By comparing the C4H genes of okra with those of 11 other plants at the amino acid level, it was found that the sequence similarities between okra and Gossypium hirsutum (XP_016677259.1), Althaea officinalis (UOI87840.1), Theobroma cacao (EOY20175.1), Quillajasaponaria (KAJ7959943.1), and Saraca asoca (XBR96853.1) were 94.84%, 93.47%, 92.28%, 88.91%, and 90.10%, respectively. The highest similarity was with Hibiscus trionum (GMI80261.1), with a similarity of 96.63%, while the lowest similarity was with Osmanthus fragrans (ANF04753.1), with a value of 88.32%. The phylogenetic tree was constructed using MEGA11, as shown in Figure 5 As shown, the protein encoded by the okra C4H gene was first clustered with hibiscus, with the closest relationship in genetic evolution (90% confidence), and was relatively closely related to cotton and cornus officinalis, but relatively distantly related to osmanthus and striga.

[0075] 3 Analysis of the expression pattern of AeC4H gene in okra

[0076] cDNA of young roots, young stems, young leaves in the seedling stage of okra, mature roots, mature leaves, buds, flowers, pericarp 6 days after flowering, 6 days after seeds, and seeds in the mature stage were used as templates, eIF4A was used as the internal reference gene (see eIF4A-F / eIF4A-R in Table 1), and the fluorescence quantitative PCR reaction system was: TB Green Premix Ex Taq II (Tli RNaseH Plus) (2×) 6μL, upstream and downstream primers (see eIF4A-F / eIF4A-R in Table 1) 0.2μL each, cDNA template 1.6μL, ddH2O 4μL. The reaction conditions were: 95℃ pre-denaturation for 30s, 95℃ denaturation for 5s, 60℃ annealing for 30s, and 39 cycles.

[0077] In this example, the expression level of AeC4H gene in okra tissues at different growth stages was analyzed by qPCR technology. The results are as follows: Figure 6 As shown, the expression level of AeC4H gene in the pericarp 6 days after flowering was extremely low, and the highest expression level was in young roots, followed by grains 6 days after flowering and young stems in the seedling stage, which were 66.46, 56.16 and 54.57 times of the expression level in the pericarp 6 days after flowering, respectively, and the lowest expression level was in mature seeds.

[0078] 4 Construction and genetic transformation of okra AeC4H expression vector

[0079] According to the obtained AeC4H full-length sequence, primers containing Xoh I and BamH I restriction sites were designed (see C4HYFP-F / C4HYFP-R in Table 1), and the pBA-YFP vector was double-digested with Xoh I and BamH I to establish a 40 μL restriction system. The restriction reaction system is as follows: 1 μg DNA, 1 μL Xoh I, 1 μL BamH I, 4 μL 10×K Buffer, and ddH2O was used to make up the total reaction system to 40 μL. After 30°C for 1h and 37°C for 1h, the obtained restriction products were detected by 1.0% agarose gel electrophoresis, and the AeC4H target gene fragment and pBA-YFP vector were recovered by gel extraction using a gel recovery kit. The obtained AeC4H target gene fragment and pBA-YFP vector were ligated with T4 DNA ligase at 16°C for 5h. The obtained ligation product was transformed into competent Escherichia coli cells, and the positive colonies were screened to extract the plasmid. After PCR and restriction digestion verification, the recombinant plasmid pBA-C4H-YFP was transformed into Agrobacterium EHA105, and the Arabidopsis inflorescence was infected by the floral dip method (Clough & Bent, 1998).

[0080] The plasmid of the recombinant vector pBA-C4H-YFP was extracted using the Kangwei Century Plasmid Extraction Kit. The results are as follows: Figure 7 shown. Figure 7 In the above analysis, two major bands were shown in both lane 1 and lane 2, one of which was located around 1500 bp and the other around 12000 bp.

[0081] The size of the recombinant vector pBA-C4H-YFP is about 12000 bp. Figure 7 It can be seen that the band in lane 1 is consistent with the size of the recombinant vector pBA-C4H-YFP, indicating that the plasmid of the recombinant vector pBA-C4H-YFP was successfully extracted. Then the recombinant vector was double-digested for verification, and the results are as follows Figure 7 As shown in the figure, after double enzyme digestion, a single band appeared near 1500bp in the recombinant vector pBA-C4H-YFP, and the fragment size was consistent with the expected AeC4H coding frame size, indicating that the recombinant vector pBA-C4H-YFP was successfully constructed and the AeC4H gene had been correctly inserted into the pBA-YFP vector. The double enzyme digestion verification results were clear, indicating that the enzyme digestion reaction had strong specificity and high efficiency, providing a reliable vector for subsequent transformation and functional studies.

[0082] 5 Screening and identification of transgenic Arabidopsis

[0083] The obtained T1 generation transgenic seeds were cultured in 1 / 2MS medium containing 100 μg / mL Basta at 23-25°C with 16 h of light / 8 h of darkness. The surviving seedlings were transplanted into nutrient soil and continued to be cultured at 23-25°C with 16 h / 8 h of light / darkness. After two consecutive generations of screening, T3 generation homozygous seeds were obtained.

[0084] PCR was used to verify the positive transgenic Arabidopsis plants using Arabidopsis DNA as template, YFP (F, R) as primer (see YFP-F / YFP-R in Table 1), pBA-YFP plasmid as positive control, wild-type Arabidopsis and ddH2O as negative control. The total volume of PCR reaction amplification was 25 μL, including Max 12.5 μL, 10 μmol / L primer F / R 0.6 μL each, template cDNA 1 μL, and deionized water (ddH2O) to make up. The amplification program was: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 58℃ annealing for 15s, 72℃ extension for 20s, 32 cycles; 72℃ extension for 10min, and storage at 10℃.

[0085] The obtained T1 generation seeds were respectively subjected to preliminary positive screening on 1 / 2MS medium containing Basta, such as Figure 8 As shown, after about 14 days, the positive plants grew normally, while the wild-type plants slowly turned yellow and died. Using Arabidopsis genomic DNA as a template and YFP-F and YFP-R as primers (see YFP-F / YFP-R in Table 1), PCR amplification was performed, and the results were as follows Fig. 9 As shown. Fig. 9 It can be seen that the first marker on the right is the positive control, the second marker on the right is the negative control, and the third marker on the right is the water control. Lanes 1-12 can amplify specific bands with the same size as the positive control fragment, while the wild-type Arabidopsis plants and water controls used as negative controls have no bands. Combined with the antibiotic screening results, this shows that the AeC4H gene has been integrated into the Arabidopsis genome.

[0086] 6 Determination of total flavonoids content in transgenic Arabidopsis

[0087] The aboveground parts of 40-day-old Arabidopsis plants (T3 generation) under normal growth conditions (23-25°C, 16 h light / 8 h dark) were cut, and three plants from each strain were ground into powder with liquid nitrogen. The total flavonoid content was determined by aluminum nitrate colorimetry (Yang Feiyun et al., 2017), with three biological replicates.

[0088] A rutin standard curve was drawn with rutin concentration (mg / L) as the X-axis and absorbance (Abs) as the Y-axis, and the total flavonoid content of transgenic Arabidopsis was calculated based on this curve. Fig.10As shown, the total flavonoid content of the transgenic positive plant pBA-C4H-YFP was 0.85 mg / g, which was 2.83 times that of the wild type (0.30 mg / g). The total flavonoid content of the transgenic positive plant was significantly higher than that of the wild type, indicating that overexpression of the AeC4H gene can significantly increase the total flavonoid content of Arabidopsis.

[0089] 7 Expression analysis of AeC4H gene in transgenic positive plants

[0090] Using cDNA of Arabidopsis transgenic positive plants and wild-type plants as templates, AtEFIα was used as an internal reference gene (see qAtEFIα-F / qAtEFIα-R in Table 1), and the fluorescence quantitative PCR reaction system was: 2×SYBR Premix Ex TaqII (TliRNaseH Plus, TaKaRa) 5μL, 0.15μL of upstream and downstream primers (see qC4H-F / qC4H-R in Table 1), 2.7μL ddH2O, and 2μL of cDNA template diluted 10 times. The reaction conditions were: 95℃ pre-denaturation for 30s, 95℃ denaturation for 5s, 60℃ annealing for 30s, and 39 cycles.

[0091] The expression of AeC4H gene in transgenic pBA-C4H-YFP and wild-type plants was compared by qPCR. Fig.11 As shown, the expression level of AeC4H gene in positive plants was 10 times that in wild-type plants.

[0092] Subcellular localization of 8AeC4H

[0093] The T1 transgenic Arabidopsis seeds were sterilized and cultured on 1 / 2MS medium at 23-25°C with 16 h light / 8 h dark conditions for about 1 week. The root tips were then lysed in 0.5 mol / L EDTA for 5 min, rinsed with water, and then stained in DAPI staining solution for 5 min. Temporary slides were prepared and the fluorescence in the cells was observed under a fluorescence microscope.

[0094] The T1 generation seeds of the obtained pBA-C4H-YFP positive transgenic plants were cultured in an artificial incubator for about a week, and then the root tips were cut, stained with DAPI, and observed under a fluorescence microscope. Figures 12-13 shown. Fig.12 This is the distribution of pBA-C4H-YFP in cells under the YFP fluorescent protein channel. Fig.13 The distribution of pBA-C4H-YFP in cells under DAPI. Figures 12-13 It can be seen that the fluorescence is mainly concentrated in the cell nucleus, which indicates that AeC4H is localized in the cell nucleus.

[0095] In the description of the present invention, it should be understood that "-" and "~" represent the range between two values, and the range includes the endpoints. For example: "AB" represents a range greater than or equal to A and less than or equal to B. "A~B" represents a range greater than or equal to A and less than or equal to B.

[0096] In the description of the present invention, the term "and / or" herein is merely a description of the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B may represent three situations: A exists alone, A and B exist at the same time, and B exists alone.

[0097] In the description of the invention, the numerical values ​​of time, temperature, ratio, mass, etc. involved may be based on actual measurements, standard parameters of equipment, simplified rounding results, or within an acceptable error range, ensuring the practicability and repeatability of the invention.

[0098] In the description of the present invention, the term "about" or "approximately" is used to express the approximate value of a numerical value or range, allowing a certain error to ensure the flexibility and practicality of the description while remaining within an acceptable error range, with the maximum error range not exceeding 10% of the corresponding numerical value or numerical range.

[0099] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A primer pair for cloning the okra AeC4H gene, characterized in that: The nucleotide sequence of the primer pair is: Forward primer C4H-F: 5′-TAATCCCAATCTCCACCCT-3′; Reverse primer C4H-R: 5′-AATCAGAACATACGAGGCTTG-3′.

2. The primer pair according to claim 1, characterized in that The primer pair is used to amplify the full-length CDS sequence of the okra AeC4H gene, the CDS sequence is shown in SEQ ID NO: 1, and encodes the amino acid sequence shown in SEQ ID NO:

2.

3. A method for cloning the okra AeC4H gene, characterized in that: The following steps are involved: (a) extracting total RNA from okra tissue and reversely transcribing it into cDNA; (b) PCR amplification was performed using the primer pair of claim 1, and the reaction system was: 12.5 μL of Max enzyme, 0.6 μL of each 10 μmol / L primer, 1 μL of cDNA template, and ddH2O was added to 25 μL; (c) The amplification program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 54°C for 15 s, extension at 72°C for 20 s, 32 cycles; final extension at 72°C for 10 min; (d) The PCR product was recovered and ligated into the pMD19-T vector, transformed into Escherichia coli DH5α competent cells, and positive clones were screened and sequenced for verification.

4. The method according to claim 3, characterized in that: The PCR amplification product is a 1506 bp nucleotide fragment, which contains the complete coding sequence of the AeC4H gene.

5. A recombinant expression vector pBA-C4H-YFP, characterized in that: The invention comprises the coding sequence of the AeC4H gene as shown in SEQ ID NO: 1, and the gene is inserted into the pBA-YFP vector through the Xho I and BamH I restriction sites.

6. A method for transforming plants using the recombinant expression vector according to claim 5, characterized in that: The following steps are involved: (a) transforming the recombinant vector into Agrobacterium tumefaciens EHA105 competent cells; (b) Infecting Arabidopsis thaliana inflorescences by the floral dipping method and screening to obtain T1 transgenic seeds; (c) Two generations of continuous screening were carried out in 1 / 2MS medium containing Basta to obtain homozygous T3 plants.

7. The method according to claim 6, characterized in that The expression level of the AeC4H gene in the transgenic plant is significantly higher than that in the wild-type plant, and the total flavonoid content is 2.83 times that of the wild-type plant.

8. A method for increasing the content of plant flavonoids, characterized in that: The method comprises overexpressing the AeC4H gene as shown in SEQ ID NO: 1 in the target plant.

9. The method according to claim 8, characterized in that The plant is Arabidopsis thaliana, okra or an economic crop.

10. Use of the AeC4H gene as shown in SEQ ID NO: 1 or its encoded protein in regulating plant flavonoid biosynthesis.

Images