Overexpression bacteriocin synthesis regulatory gene and construction method and application of recombinant plant lactobacillus of over-expression bacteriocin synthesis regulatory gene

Abstract

The invention discloses an overexpression bacteriocin synthesis regulatory gene and a construction method and application of recombinant plant lactobacillus of the overexpression bacteriocin synthesis regulatory gene, and is characterized in that the overexpression bacteriocin synthesis regulatory gene comes from a gene of L (+)-tartaric acid dehydratase encoded by plant lactobacillus ZY-1, and the nucleotide sequence of the overexpression bacteriocin synthesis regulatory gene is shown as SEQ ID NO.1; the method comprises the following specific steps: (1) amplifying a ttdB gene by taking genome DNA (Deoxyribose Nucleic Acid) of phytobacterium plantarum as a template, and inserting a PCR (Polymerase Chain Reaction) amplification product into an expression vector pMG36e to construct a recombinant expression vector after double-enzyme cutting gel of the expression vector pMG36e is recovered; and 2) extracting overexpression plasmids, electrically transforming the overexpression plasmids, introducing the overexpression plasmids into the plant lactobacillus, recovering the overexpression plasmids, coating the overexpression plasmids on an erythromycin resistance plate, screening transformants, and verifying the transformants through PCR (Polymerase Chain Reaction) to obtain the recombinant plant lactobacillus ZY-1-ttdB of the overexpression L (+)-tartrate dehydratase gene, and the recombinant plant lactobacillus ZY-1-ttdB has the advantage that the bacteriocin yield of the plant lactobacillus can

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering and microbial fermentation technology, and specifically relates to overexpression of bacteriocin synthesis regulatory genes ( ttdB ) and the construction method and application of its recombinant Lactobacillus plantarum. Background Art

[0002] Bacteriocins are polypeptides or proteins with antibacterial effects that are synthesized by ribosomes during the growth and metabolism of certain bacteria. Bacteriocins produced by lactic acid bacteria have shown great potential as a new type of biological preservative in the food industry due to their many advantages such as wide sources, high safety, good stability, broad antibacterial spectrum, and no pollution. However, the yield of lactic acid bacteria bacteriocins is low, the molecular weight is small, and it is difficult to separate and purify them to obtain pure eggs. In addition, the quorum sensing genes of bacteriocin-producing lactic acid bacteria are diverse, and there is currently no universal bacteriocin regulation system, which affects the application and development of lactic acid bacteria bacteriocins.

[0003] At present, the main methods for increasing the synthesis of bacteriocin by lactic acid bacteria include high-yield strain screening, fermentation condition optimization, mutation breeding, protoplast fusion, genetic engineering, regulation using quorum sensing systems and co-cultivation. Among them, co-cultivation is more common in multi-bacteria fermentation, and it has the advantages of short time, high equipment utilization, easy operation and relatively low cost to increase the synthesis of bacteriocin. The synthesis of bacteriocin requires the environment to provide additional metabolic energy, which increases the "cost" of bacterial growth to a certain extent. Many bacteria will "selectively" synthesize bacteriocin according to environmental changes to promote their own growth and save energy. The interactions between microorganisms during co-cultivation, such as synergistic metabolism, nutrition provision, competition for substrates, and changes in pH, all have a certain impact on the yield of target products and the production of new substances in the co-cultivation system.

[0004] At present, there are many reports on inducing the biosynthesis of bacteriocin in lactic acid bacteria by adding exogenous specific microorganisms as environmental conditions, but there are few reports on screening key differentially expressed genes by studying co-culture conditions. Therefore, screening differential genes that affect bacteriocin synthesis under co-culture conditions through transcriptomics and then improving the bacteriocin production of Lactobacillus plantarum through molecular biology modification of strains has important economic value and social significance. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a construction method and application of an overexpressed bacteriocin synthesis regulatory gene and a recombinant Lactobacillus plantarum capable of significantly improving the yield of bacteriocin.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: an overexpression bacteriocin synthesis regulatory gene, the gene is from the gene encoding L(+)-tartrate dehydratase of Lactobacillus plantarum ZY-1 (abbreviated asttdB gene), whose nucleotide sequence is shown in SEQ ID NO.1.

[0007] The present invention also provides a method for constructing a recombinant Lactobacillus plantarum that overexpresses a bacteriocin synthesis regulatory gene, and the specific steps are as follows: (1) Recombinant expression vector pMG- ttdB Construction Using the genomic DNA of Lactobacillus plantarum ZY-1 as a template, we designed ttdB Upstream and downstream amplification primers, amplification ttdB The expression vector pMG36e was double-digested with restriction endonucleases Sac I and Hind III, and then subjected to agarose gel electrophoresis. After gel cutting and recovery, the recombinase ligation method was used to ttdB The gene fragment was connected to the linear vector pMG36e to construct the recombinant plasmid pMG36e- ttdB ; (2) Construction of recombinant Lactobacillus plantarum The recombinant plasmid pMG36e- ttdB The cells were electrotransformed into Lactobacillus plantarum ZY-1, revived at 35-40°C for 1-5 hours, coated with erythromycin-resistant plates, and then cultured at 35-40°C for 36-48 hours to screen transformants. The transformants were verified by PCR to obtain recombinant Lactobacillus plantarum ZY-1 overexpressing the bacteriocin synthesis regulatory gene. ttdB .

[0008] Furthermore, step (1) ttdB The nucleotide sequence of the upstream amplification primer of the gene is shown in SEQ ID NO.2: aaaaattcgtaattcgagctcATGAAAACTTACCACTTAACCACCC; ttdB The nucleotide sequence of the downstream amplification primer of the gene is shown in SEQ ID NO.3: gttttcagactttgcaagcttTTATTTAATGAATTTAACTTGTTCGTTGA.

[0009] Furthermore, the PCR amplification procedure in step (1) is as follows: (1) 95°C for 3 min; (2) 95°C for 15 s, 60°C for 15 s, 72°C for 60 s; repeat 35 cycles; (3) 72°C for 5 min; the PCR reaction system is as follows: template DNA 50-400 ng, 2 × Phanta Max Master Mix 25 μL, ttdB 2 μL of upstream gene amplification primer, ttdB 2 μL of primers for downstream gene amplification, supplemented with ddH2O to 50 μL.

[0010] Furthermore, the specific steps of the electro-conversion are as follows: (1) Preparation of competent cells of Lactobacillus plantarum Inoculate 50 mL competent medium with 1% volume ratio of overnight activated Lactobacillus plantarum ZY-1, place in a 37°C incubator to expand and culture to the logarithmic phase, place the cultured bacterial solution in ice water to cool the cells, collect the cells by low-speed centrifugation at 4°C, add pre-cooled washing buffer to resuspend the cells, repeat washing twice after low-speed centrifugation, and finally add pre-cooled washing buffer equal to the volume of the bacterial suspension to resuspend the cells to obtain a competent cell solution of Lactobacillus plantarum ZY-1; (2) Electrotransformation of Lactobacillus plantarum Take 1 μg of recombinant plasmid pMG- ttdB Gently mix with 100 μL of Lactobacillus plantarum ZY-1 competent cell solution, let stand on ice for 10 min, transfer the recombinant plasmid and competent cell mixture to a pre-cooled electroporation cup, let stand on ice for 10 min and then perform electroporation. Immediately after the electroporation, add 900 μL of pre-cooled resuscitation medium and mix evenly. Transfer the mixture to a centrifuge tube with a 1 mL sterile syringe, shake at 37 °C at 200 rpm for 3 h, centrifuge at low speed and discard the supernatant, re-add 1 mL of sterile MRS broth medium and resuspend with a pipette, spread each 100 μL of culture solution on an MRS plate containing 5 μg / mL erythromycin, culture at 37 °C for 36-48 h, pick a milky white single colony and culture it in 1 mL of MRS broth containing 5 μg / mL erythromycin for 12-16 h, take 1 μL of the turbid bacterial solution for bacterial solution PCR verification to obtain recombinant Lactobacillus plantarum ZY-1-overexpressing bacteriocin synthesis regulatory genes. ttdB.

[0011] Furthermore, the formula of the competent medium is as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol and 10 g / L glycine; the formula of the washing buffer is as follows: 326 g / L sucrose and hexahydrate and 0.72 g / L magnesium chloride; the formula of the resurrection medium is as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol and 1.12 g / L calcium chloride.

[0012] The present invention also provides the use of the recombinant Lactobacillus plantarum overexpressing the bacteriocin synthesis regulatory gene in the preparation of bacteriocin.

[0013] Compared with the prior art, the present invention has the advantages that: the present invention discloses for the first time a strain of overexpressed L(+)-tartrate dehydratase gene that can significantly increase the yield of bacteriocin and the construction method and application of its recombinant Lactobacillus plantarum ZY-1-ttdB. Lactiplantibacillus plantarum )L(+)-tartrate dehydratase gene of ZY-1( ttdB ) fragment was connected to the pMG36e expression vector and introduced into Lactobacillus plantarum by electroporation. The recombinant bacteria carrying the target gene were obtained by erythromycin resistance screening and identification, that is, the recombinant bacteria overexpressing the L(+)-tartrate dehydratase gene ( ttdB ) of recombinant Lactobacillus plantarum ZY-1- ttdB The bacteriocin production of the recombinant Lactobacillus plantarum strain was increased by 18% compared with the empty control ZY-1-0 strain. It was the first time that a recombinant Lactobacillus plantarum strain ZY-1 overexpressing the L(+)-tartrate dehydratase gene that could significantly increase the bacteriocin production was constructed, providing an important basis for the further research and application of bacteriocins.

[0014] The above-mentioned Lactobacillus plantarum ( Lactiplantibacillus plantarum ) ZY-1 strain, with the deposit number CGMCC NO. 29542, was deposited on January 8, 2024 at the General Microbiology Center of China Culture Collection Administration, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 To overexpress bacteriocin synthesis regulatory genes ( ttdB The results of agarose gel electrophoresis of PCR products of genes) are shown in Figure 1, where 1 represents Lane 1, and Lane 1 represents the gene ttdB Amplified product, Lane is the swimming lane, M refers to Marker, which is the molecular weight standard reference; Figure 2 For the recombinant plasmid pMG36e- ttdB Graph construction process; Figure 3 For pMG36e- ttdB Colony PCR product electrophoresis results of positive clones, where 1 represents Lane 1, 2 represents Lane 2, and 3 represents Lane 3. Lane (1-3) is pMG36e- ttdB Colony PCR products of positive clones, Lane is the swimming lane, M refers to Marker, which is the molecular weight standard reference; Figure 4 For the recombinant plasmid pMG36e- ttdBand plasmid pMG36e double enzyme digestion verification results, where 1 represents Lane 1, 2 represents Lane 2, 3 represents Lane 3, and 4 represents Lane 4. Lane 1 is pMG36e- ttdB Double enzyme digestion product, Lane 2 is pMG36e- ttdB Lane 3 is the pMG36e double digestion product, Lane 4 is the pMG36e undigested product, Lane is the lane, M refers to Marker, which is the molecular weight standard reference; Figure 5 The results of electroporation PCR verification, where (a) is the electrophoresis of the PCR product of pMG36e electroporated into Lactobacillus plantarum ZY-1, M refers to Marker, which is a molecular weight standard reference, and 1-4 refers to the PCR product of the bacterial solution; (b) is the electrophoresis of pMG36e- ttdB Electrophoresis of PCR products electrotransferred into Lactobacillus plantarum ZY-1. M refers to Marker, which is a molecular weight standard reference. 1-4 refers to PCR products of the bacterial solution. Figure 6 It is a genetically engineered strain of Lactobacillus plantarum ZY-1- ttdB qPCR relative quantitative results of ZY-1-0, where **** indicates P < 0.0001, and the dotted line indicates that the relative expression of the control ZY-1-0 is 1; Figure 7 Cell morphology under scanning electron microscope, where (a) is wild-type Lactobacillus plantarum ZY-1; (b) is Lactobacillus plantarum ZY-1-0; (c) is Lactobacillus plantarum ZY-1- ttdB ; Figure 8 It is a genetically engineered strain of Lactobacillus plantarum ZY-1- ttdB The antibacterial activity changes of bacteriocins produced by ZY-1-0 and ZY-1-0, where ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, Escherichia coli, Human Staphylococcus aureus indicates Staphylococcus aureus, and Staphylococcus aureus indicates Staphylococcus aureus. DETAILED DESCRIPTION

[0016] The present invention is further described in detail below with reference to the accompanying drawings.

[0017] Example 1, recombinant expression vector pMG- ttdB The construction method is as follows: Step 1: Design PCR primers for amplifying the overexpressed L(+)-tartaric acid dehydratase ( ttdB ) gene fragment, the sequences of PCR primers are as follows: ttdBThe nucleotide sequence of the upstream amplification primer of the gene is shown in SEQ ID NO.2: aaaaattcgtaattcgagctcATGAAAACTTACCACTTAACCACCC; ttdB The nucleotide sequence of the primer for downstream amplification of the gene is shown in SEQ ID NO.3: gttttcagactttgcaagcttTTATTTAATGAATTTAACTTGTTCGTTGA.

[0018] Step 2: Lactobacillus plantarum ( Lactiplantibacillus plantarum ) ZY-1 (this Lactobacillus plantarum has been deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, and the registration number of the collection center is CGMCC NO. 29542) genomic DNA was used as a template, and the following PCR program was performed: (1) 95℃ 3 min; (2) 95℃ 15 s, 60℃ 15 s, 72℃ 60 s; repeat 35 cycles (3) 72℃ 5 min. The PCR reaction system is as follows: 2 × PhantaMax Master Mix 25μL, 10μM ttdB Gene upstream amplification primer 2 μL, 10 μM ttdB 2 μL of downstream gene amplification primers, 50-400 ng of template DNA, add ddH2O to a total volume of 50 μL. Figure 1 The agarose gel electrophoresis test results of the PCR amplification products of the target gene, where Lane 1 is the gene ttdB The PCR amplification product has a roughly correct molecular weight as can be seen from the position of the product band. Then the gel is cut and recovered and sequenced. ttdBThe nucleotide sequence of the gene is shown in SEQ ID NO.1:.

[0019] Step 3: Double digest the expression vector pMG36e with restriction endonucleases Sac I and Hind III, and then perform agarose gel electrophoresis and gel recovery. Use the recombinase ligation method to connect the target fragment ( ttdB ) PCR amplification product was connected with the linear vector (pMG36e) at 37°C for 30 min and 4°C for 10 min to construct the recombinant plasmid pMG36e- ttdB . Figure 2 For the recombinant plasmid pMG36e- ttdB Graph construction process.

[0020] Figure 3 For pMG36e- ttdB Colony PCR product electrophoresis results of positive clones. Lane (1-3) is pMG36e- ttdBColony PCR products of positive clones. The colony PCR products are single and the size of about 1000 bp is consistent with the recombinant plasmid sequence.

[0021] Figure 4 For the recombinant plasmid pMG36e- ttdB The double restriction enzyme digestion results of the plasmid pMG36e showed that Lane 1 was pMG36e- ttdB Double enzyme digestion product; Lane 2 is pMG36e- ttdB Lane 3 is the product of pMG36e double digestion; Lane 4 is the product of pMG36e without digestion; the results show the linear plasmid band and the target gene band. ttdB Build successful.

[0022] Example 2, genetically engineered Lactobacillus plantarum ZY-1- ttdB 、Construction of ZY-1-0 The pMG- ttdB The overexpression plasmid was extracted by a plasmid mass extraction kit and then electroporated into Lactobacillus plantarum ZY-1. After 3 hours of recovery at 37°C, it was coated with erythromycin resistance plates and then cultured at 37°C for 36-48 hours. Transformants were screened and verified by PCR to obtain the overexpression of L(+)-tartrate dehydratase gene. ttdB Recombinant Lactobacillus plantarum ZY-1- ttdB .

[0023] At the same time, the untreated expression vector pMG36e was extracted using a plasmid large-scale extraction kit, and then electroporated and introduced into Lactobacillus plantarum ZY-1. After recovery at 37°C for 3 hours, it was coated on an erythromycin-resistant plate and cultured at 37°C for 36-48 hours. Transformants were screened and verified by PCR to obtain empty Lactobacillus plantarum ZY-1-0.

[0024] The specific steps of the above-mentioned electroporation are as follows: (1) Preparation of competent cells of Lactobacillus plantarum The overnight activated Lactobacillus plantarum ZY-1 was inoculated into 50 mL competent medium at a volume ratio of 1%, and then cultured in a 37°C incubator until the logarithmic phase (OD 600Reach 0.3 - 0.6). Place the cultured bacterial solution in ice water to cool the cells for 30 min, and collect the bacteria by low-speed centrifugation at 4°C and 6000 g for 5 min. Add pre-cooled washing buffer to resuspend the bacteria, centrifuge at 4°C and 3000 rpm for 5 min, and repeat the washing twice. Finally, add an equal volume of pre-cooled washing buffer to resuspend the bacteria, and dispense 100 μL per tube into 1.5 mL centrifuge tubes, freeze in liquid nitrogen for 15 min, and store in a -80°C refrigerator. The formula of the competent medium is as follows: MRS broth 52.24g / L, sorbitol 136.64g / L, and glycine 10g / L; the formula of the washing buffer is as follows: sucrose 326g / L and hexahydrate and magnesium chloride 0.72g / L; the formula of the resurrection medium is as follows: MRS broth 52.24g / L, sorbitol 136.64g / L, and calcium chloride 1.12g / L; (2) Electrotransformation of Lactobacillus plantarum Take out the frozen competent cells and plasmids of Lactobacillus plantarum and place them on ice to thaw. Take 1 μg of the recombinant plasmid pMG- ttdB Gently mix with 100 µL of Lactobacillus plantarum ZY-1 competent cell solution, let stand on ice for 10 min, transfer the recombinant plasmid and competent cell mixture to a pre-cooled electroporation cup, let stand on ice for 10 min, and then perform electroporation. The electroporation parameters are: 1.2 KV, 4 ms. Immediately after the electroporation, add 900 μL of pre-cooled resuscitation medium and mix evenly. Use a 1 mL sterile syringe to transfer the mixture to a 1.5 mL centrifuge tube. After shaking at 200 rpm for 3 hours at 37 °C, centrifuge at 3000 rpm for 2 minutes, discard the supernatant, re-add 1 mL of sterile MRS broth medium and resuspend with a pipette. Spread each 100 μL of culture solution on an MRS plate containing 5 μg / mL erythromycin and culture at 37 °C for 36-48 hours. A single milky white colony was picked and cultured in 1 mL of MRS broth containing 5 μg / mL erythromycin for 12-16 h. 1 μL of the turbid bacterial solution was taken for bacterial solution PCR verification. The PCR products were sequenced and compared. The nucleotide sequence of the forward identification primer pMG36e-F is shown in SEQ ID NO.4: CAATCTGCCTCCTCATCCT, and the reverse identification primer pMG36e- ttdB The nucleotide sequence of -R is shown in SEQ ID NO.5: TCCACTGGGCATCAACAAT. Take 5 μL of the colony PCR product for agarose gel electrophoresis (agarose concentration 2%), and send the PCR product with the target band shown in the nucleic acid electrophoresis results for detection.

[0025] Figure 5(a) is the electrophoresis of the PCR product of pMG36e electrotransformed into Lactobacillus plantarum ZY-1. The verification primers pMG36e-F / R of pMG36e are located at both ends of the cloning site. The product length is 350 bp. The position of the electrophoresis band of the product is consistent with the theoretical size of the product. The nucleotide sequence of the reverse identification primer pMG36e-R is shown in SEQ ID NO.6: GCCACCTTCGTTTTCAGACT; Figure 5 Middle (b) is pMG36e- ttdB Electrophoresis of PCR products electrotransformed into Lactobacillus plantarum ZY-1, pMG36e- ttdB Designed primers pMG36e-F, pMG36e- ttdB -R, the upstream primer is located on the plasmid, the downstream primer is located on the inserted target gene, the product length is 716 bp, and the position of the product electrophoresis band is consistent with the theoretical size of the product.

[0026] Example 3, genetically engineered bacteria ZY-1- ttdB Validation at the genetic level.

[0027] The overexpression strain ZY-1- ttdB After RNA extraction, reverse transcription was performed to obtain cDNA products. ttdB RT-qPCR primers for genes, ttdB The nucleotide sequence of the forward primer for real-time quantitative PCR of the gene is shown in SEQ ID NO.7: 5'-CGCCTTACACCTCGTCTACC-3'; ttdB The nucleotide sequence of the reverse primer of the real-time quantitative PCR of the gene is shown in SEQ ID NO.8: 5'-CAAGTTGTCGCCATTCGTATCG-3', and the nucleotide sequence of the forward primer of the real-time quantitative PCR of the internal reference gene is shown in SEQ ID NO.9: GGCGTGCTATTCATACCAGTC; the nucleotide sequence of the reverse primer of the real-time quantitative PCR of the internal reference gene is shown in SEQ ID NO.10: CAGGTGTTATCCCGTGCTTC. The real-time quantitative PCR system is: 1.5 μL of cDNA template, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 10 μL of 2 × Taq Pro Universal SYBR qPCR Master Mix, and dd H2O is used to make up to 20 μL. The amplification program is set as follows: (1) pre-denaturation (95℃, 30 s); (2) denaturation (95℃, 10 s), annealing and extension (60℃, 30 s), 40 cycles; (3) cooling (37℃, 10 min). Use 2 -△△CTThe relative expression levels of target genes were calculated.

[0028] Figure 6 for ttdB The relative quantitative results of RT-qPCR were obtained. ZY-1-0 was used as the control strain, and its relative expression level was always 1. The results showed that compared with ZY-1-0, the overexpression strain ZY-1- ttdB of ttdB The expression level increased significantly by more than 6.54 times, proving that ttdB Overexpression at the gene level.

[0029] Example 4: Scanning electron microscope observation of ZY-1, ZY-1-0 and ZY-1- ttdB Morphological changes The strain ZY-1-0 obtained in Example 2 was combined with ZY-1- ttdB After culturing the wild-type ZY-1 in MRS broth overnight, ZY-1, ZY-1-0 and ZY-1- ttdB The cells were precipitated, washed, and resuspended in 2.5% glutaraldehyde and fixed at 4°C for 3 h. The cells were then washed three times with 0.1 M phosphate buffered saline (PBS, pH 7.2) and dehydrated in gradient ethanol (30, 50, 70, 80, 90, 100%) for 15 min each time. Finally, the cells were resuspended in 1 mL of anhydrous tert-butyl alcohol and vacuum freeze-dried (-49°C, 24 h, and 9 Pa). The dried samples were bonded to the scanning electron microscope (SEM) sample stage with conductive glue, and the cell morphology was observed in a scanning electron microscope after gold spraying.

[0030] Figure 7 (a) shows the cell morphology of wild-type Lactobacillus plantarum ZY-1 under a scanning electron microscope. Figure 7 (b) shows the cell morphology of Lactobacillus plantarum ZY-1-0 under a scanning electron microscope. Figure 7 (c) is Lactobacillus plantarum ZY-1- ttdB Cell morphology under scanning electron microscopy. Compared with the wild-type Lactobacillus plantarum ZY-1, ZY-1-0 and ZY-1- ttdB The cell diameter has increased. This change in cell diameter may be related to the transformation process of the exogenous plasmid. ttdB The gene may not be directly involved in cell proliferation or the synthesis of major membrane components, so its effect on cell morphology is not significant.

[0031] Example 5, genetically engineered bacteria ZY-1- ttdB Determination of bacteriocin activity.

[0032] The strains ZY-1-0 and ZY-1-ttdB , single colonies were activated for 16 h, and OD 600 The seed liquid with the same value was inoculated in MRS broth at the same ratio and cultured at 37℃ for 24 h. The fermentation supernatant was filtered through a sterile 0.22 μm filter membrane to remove bacteria and impurities, freeze-dried, reconstituted with sterile water and concentrated 15 times. The pH was adjusted to 6.5-7.0 with 5 M NaOH solution and then filtered through a sterile 0.22 μm filter membrane to remove bacteria and impurities. Then, the filtered and sterilized catalase solution was added to the fermentation supernatant to a concentration of 1 mg / mL and water bathed at 37℃ for 2 h. Take the antibacterial plate, place a sterile Oxford cup in it, take 200 μL of the supernatant after acid and hydrogen peroxide removal and add it to the Oxford cup, and measure the diameter of the inhibition zone after culture at 37℃ for 10 h. At the same time, MRS broth adjusted to pH 6.5-7.0 was used as a blank group.

[0033] Figure 8 For the genetically engineered bacteria ZY-1- ttdB and ZY-1-0 bacteriocin antibacterial activity changes. Under three different indicator bacteria, ZY-1- ttdB All of them showed good antibacterial effects, among which the inhibitory activity against Staphylococcus aureus (abbreviated as Golden Staphylococcus) and Staphylococcus hominis (abbreviated as Human Staphylococcus) increased by 18% and 10% respectively.

[0034] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.

Claims

1. A method for overexpressing a bacteriocin synthesis regulatory gene, characterized in that: The gene is from the gene encoding L(+)-tartaric acid dehydratase of Lactobacillus plantarum ZY-1, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. A method for constructing a recombinant Lactobacillus plantarum overexpressing a bacteriocin synthesis regulatory gene according to claim 1, characterized in that The specific steps are as follows: (1) Recombinant expression vector pMG- ttdB Construction Using the genomic DNA of Lactobacillus plantarum ZY-1 as a template, we designed ttdB Upstream and downstream amplification primers, amplification ttdB The expression vector pMG36e was double-digested with restriction endonucleases Sac I and Hind III, and then subjected to agarose gel electrophoresis. After gel cutting and recovery, the recombinase ligation method was used to ttdB The gene fragment was connected to the linear vector pMG36e to construct the recombinant plasmid pMG36e- ttdB ; (2) Construction of recombinant Lactobacillus plantarum The recombinant plasmid pMG36e- ttdB The cells were electrotransformed into Lactobacillus plantarum ZY-1, revived at 35-40°C for 1-5 hours, coated with erythromycin-resistant plates, and then cultured at 35-40°C for 36-48 hours to screen transformants. The transformants were verified by PCR to obtain recombinant Lactobacillus plantarum ZY-1 overexpressing the bacteriocin synthesis regulatory gene. ttdB .

3. The method for constructing a recombinant Lactobacillus plantarum that overexpresses a bacteriocin synthesis regulatory gene according to claim 2, characterized in that Step (1) ttdB The nucleotide sequence of the upstream amplification primer of the gene is shown in SEQ ID NO.2: aaaaattcgtaattcgagctcATGAAAACTTACCACTTAACCACCC; ttdB The nucleotide sequence of the downstream amplification primer of the gene is shown in SEQ ID NO.3: gttttcagactttgcaagcttTTATTTAATGAATTTAACTTGTTCGTTGA.

4. The method for constructing a recombinant Lactobacillus plantarum that overexpresses a bacteriocin synthesis regulatory gene according to claim 3, characterized in that The PCR amplification procedure in step (1) is as follows: (1) 95°C for 3 min; (2) 95°C for 15 s, 60°C for 15 s, and 72°C for 60 s; repeat for 35 cycles; (3) 72°C for 5 min; the PCR reaction system is as follows: template DNA 50-400 ng, 2× Phanta Max Master Mix 25 μL, ttdB 2 μL of upstream gene amplification primer, ttdB 2 μL of primers for downstream gene amplification, supplemented with ddH2O to 50 μL.

5. The method for constructing a recombinant Lactobacillus plantarum that overexpresses a bacteriocin synthesis regulatory gene according to claim 2, characterized in that The specific steps of the electroporation are as follows: (1) Preparation of competent cells of Lactobacillus plantarum: Inoculate 50 mL competent culture medium with 1% volume ratio of overnight activated Lactobacillus plantarum ZY-1, place in a 37°C incubator to expand and culture to the logarithmic phase, place the cultured bacterial solution in ice water to cool the cells, centrifuge at 4°C to collect the cells, add pre-cooled washing buffer to resuspend the cells, centrifuge at low speed, repeat washing twice, and finally add the pre-cooled washing buffer with the same volume as the bacterial suspension to resuspend the cells to obtain a competent cell solution of Lactobacillus plantarum ZY-1; (2) Electroporation of Lactobacillus plantarum: Take 1 μg of recombinant plasmid pMG- ttdB Gently mix with 100 μL of Lactobacillus plantarum ZY-1 competent cell solution, let stand on ice for 10 min, transfer the recombinant plasmid and competent cell mixture to a pre-cooled electroporation cup, let stand on ice for 10 min and then perform electroporation. Immediately after the electroporation, add 900 μL of pre-cooled resuscitation medium and mix evenly. Use a 1 mL sterile syringe to transfer the mixture to a centrifuge tube, shake at 37 °C at 200 rpm for 3 h, centrifuge at low speed and discard the supernatant, add 1 mL of sterile MRS broth medium again and resuspend with a pipette. Spread each 100 μL of culture solution on an MRS plate containing 5 μg / mL erythromycin, culture at 37 °C for 36-48 h, pick a milky white single colony and culture it in 1 mL of MRS broth containing 5 μg / mL erythromycin for 12-16 h, take 1 μL of the turbid bacterial solution for bacterial solution PCR verification to obtain recombinant Lactobacillus plantarum ZY-1-overexpressing bacteriocin synthesis regulatory genes. ttdB.

6. The method for constructing a recombinant Lactobacillus plantarum overexpressing a bacteriocin synthesis regulatory gene according to claim 5, characterized in that The formula of the competent medium is as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol and 10 g / L glycine; the formula of the washing buffer is as follows: 326 g / L sucrose, hexahydrate and 0.72 g / L magnesium chloride; the formula of the resurrection medium is as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol and 1.12 g / L calcium chloride.

7. Use of the recombinant Lactobacillus plantarum overexpressing a bacteriocin synthesis regulatory gene according to any one of claims 2 to 6 in preparing bacteriocin.

Images