Overexpression of bacteriocin synthesis regulatory gene and its construction method and application of recombinant Lactobacillus plantarum

By constructing the recombinant Lactobacillus plantarum ZY-1-ttdB that overexpresses the L(+)-tartrate dehydrase gene, the problem of low lactic acid bacterial bacterium was solved, and a significant increase in bacterium yield was achieved, and the application and development of bacterium was promoted.

CN119876203BActive Publication Date: 2025-08-12NINGBO UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510352460.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-25
Publication Date
2025-08-12
Estimated Expiration
2045-03-25

AI Technical Summary

Technical Problem

The lactic acid bacterial bacterial yield is low, the molecular weight is small, it is difficult to separate and purify, and there is a lack of a universal bacteriological control system, which affects its application and development.

Method used

Recombinant Lactobacillus phytosaccharide dehydrase gene (ttdB) was constructed and introduced into Lactobacillus phytosaccharide by electrotransformation. Recombinant strains were obtained by erythromycin resistance screening, which significantly increased bacterin yield.

Benefits of technology

The yield of recombinant Phytobacterium Lactobacillus ZY-1-ttdB bacterium phytocin increased by 18%, providing an important basis for the research and application of bacterium.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876203B_ABST
    Figure CN119876203B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for constructing and applying a recombinant Lactobacillus plantarum overexpressing a bacteriocin synthesis regulatory gene and a recombinant Lactobacillus plantarum. The gene is derived from a gene encoding L(+)-tartrate dehydratase of Lactobacillus plantarum ZY-1, and the nucleotide sequence thereof is shown in SEQ ID NO.1. The specific steps are as follows: 1) using Lactobacillus plantarum genomic DNA as a template, amplifying ttdb gene, after double enzyme digestion and gel extraction of the expression vector pMG36e, the PCR amplification product was inserted into the expression vector pMG36e to construct a recombinant expression vector; 2) the overexpression plasmid was extracted and electrotransformed into Lactobacillus plantarum, and after recovery, erythromycin-resistant plates were coated, and the transformants were screened and verified by PCR to obtain the recombinant Lactobacillus plantarum ZY-1- overexpressing the L(+)-tartrate dehydratase gene. ttdb The advantage is that it can significantly increase the bacteriocin production of plant lactobacillus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering and microbial fermentation technology, and specifically relates to overexpression of bacteriocin synthesis regulatory genes ( ttdB ) and the construction method and application of its recombinant plant lactobacillus. Background Art

[0002] Bacteriocins are peptides or proteins with antibacterial properties synthesized by the ribosomes of certain bacteria during their growth and metabolism. Bacteriocins produced by lactic acid bacteria have shown great potential as a new type of biopreservative in the food industry due to their wide availability, high safety, good stability, broad antibacterial spectrum, and pollution-free nature. However, the low yield and small molecular weight of lactic acid bacteria bacteriocins make their isolation and purification difficult. Furthermore, the quorum sensing genes of bacteriocin-producing lactic acid bacteria are diverse, and a universal bacteriocin regulatory system is currently lacking, hindering their application and development.

[0003] At present, the main methods for increasing the synthesis of bacteriocin by lactic acid bacteria include screening for high-yield strains, optimization of fermentation conditions, mutation breeding, protoplast fusion, genetic engineering, regulation using quorum sensing systems, and co-cultivation. Among them, co-cultivation is more common in multi-bacteria fermentation, and its advantages in increasing the synthesis of bacteriocin are short time, high equipment utilization, easy operation, and relatively low cost. The synthesis of bacteriocin requires the environment to provide additional metabolic energy, which increases the "cost" of bacterial growth to a certain extent. Many bacteria will "selectively" synthesize bacteriocins according to environmental changes to promote their own growth and save energy. The interactions between microorganisms during co-cultivation, such as synergistic metabolism, nutrient provision, competition for substrates, and changes in pH, all have a certain impact on the yield of target products and the production of new substances in the co-cultivation system.

[0004] While there are numerous reports on inducing bacteriocin biosynthesis in lactic acid bacteria by adding specific exogenous microorganisms to co-cultures as environmental stimulation, there are few reports on identifying key differentially expressed genes under co-culture conditions. Therefore, identifying differentially expressed genes that influence bacteriocin biosynthesis under co-culture conditions through transcriptomics and then enhancing bacteriocin production in Lactobacillus plantarum through molecular biological engineering has significant economic and social implications. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a method for constructing an overexpressed bacteriocin synthesis regulatory gene and a recombinant Lactobacillus plantarum, which can significantly increase the yield of bacteriocin.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: an overexpression of a bacteriocin synthesis regulatory gene, the gene is derived from the gene encoding L(+)-tartrate dehydratase of Lactobacillus plantarum ZY-1 (abbreviated asttdB gene), the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides a method for constructing a recombinant Lactobacillus plantarum that overexpresses a bacteriocin synthesis regulatory gene, and the specific steps are as follows:

[0008] (1) Recombinant expression vector pMG- ttdB Construction

[0009] Using the genomic DNA of Lactobacillus plantarum ZY-1 as a template, we designed ttdB Upstream and downstream amplification primers, amplification ttdB The expression vector pMG36e was double-digested with restriction endonucleases Sac I and Hind III, and then subjected to agarose gel electrophoresis. After gel recovery, the recombinase ligation method was used to ttdB The gene fragment was connected with the linear vector pMG36e to construct the recombinant plasmid pMG36e- ttdB ;

[0010] (2) Construction of recombinant Lactobacillus plantarum

[0011] The recombinant plasmid pMG36e- ttdB The cells were electroporated and introduced into Lactobacillus plantarum ZY-1, and after recovery at 35-40°C for 1-5 hours, the cells were coated on erythromycin-resistant plates and cultured at 35-40°C for 36-48 hours to screen transformants. The transformants were verified by PCR to obtain recombinant Lactobacillus plantarum ZY-1 overexpressing the bacteriocin synthesis regulatory gene. ttdB .

[0012] Furthermore, step (1) ttdB The nucleotide sequence of the upstream amplification primer of the gene is shown in SEQ ID NO.2: aaaaattcgtaattcgagctcATGAAAACTTACCACTTAACCACCC; ttdB The nucleotide sequence of the primer for downstream gene amplification is shown in SEQ ID NO.3: gttttcagactttgcaagcttTTATTTAATGAATTTAACTTGTTCGTTGA.

[0013] Furthermore, the PCR amplification procedure in step (1) is as follows: (1) 95°C for 3 min; (2) 95°C for 15 s, 60°C for 15 s, 72°C for 60 s; repeat 35 cycles; (3) 72°C for 5 min; the PCR reaction system is as follows: template DNA 50-400 ng, 2 × Phanta Max Master Mix 25 μL, ttdB2 μL of upstream gene amplification primers, ttdB 2 μL of the downstream gene amplification primer was added, and ddH2O was added to make up to 50 μL.

[0014] Furthermore, the specific steps of the electroporation are as follows:

[0015] (1) Preparation of competent cells of Lactobacillus plantarum

[0016] Inoculate 50 mL of competent culture medium with 1% volume ratio of overnight activated Lactobacillus plantarum ZY-1, place in a 37°C incubator to expand culture to the logarithmic phase, place the cultured bacterial solution in ice water to cool the cells, collect the cells by low-speed centrifugation at 4°C, add pre-cooled washing buffer to resuspend the cells, repeat washing twice after low-speed centrifugation, and finally add pre-cooled washing buffer equal to the volume of the bacterial suspension to resuspend the cells to obtain a Lactobacillus plantarum ZY-1 competent cell solution;

[0017] (2) Electrotransformation of Lactobacillus plantarum

[0018] Take 1 μg of recombinant plasmid pMG- ttdB Gently mix with 100 μL of Lactobacillus plantarum ZY-1 competent cell solution, let it stand on ice for 10 min, transfer the recombinant plasmid and competent cell mixture to a pre-cooled electroporation cup, let it stand on ice for 10 min and then perform electroporation. Immediately after the electroporation, add 900 μL of pre-cooled resuscitation medium and mix evenly. Use a 1 mL sterile syringe to transfer the mixture to a centrifuge tube, shake it at 37 ° C at 200 rpm for 3 h, centrifuge it at low speed and discard the supernatant, add 1 mL of sterile MRS broth medium and resuspend it with a pipette. Spread each 100 μL of culture medium on an MRS plate containing 5 μg / mL erythromycin and culture it at 37 ° C for 36-48 h. Pick a milky white single colony and culture it in 1 mL of MRS broth containing 5 μg / mL erythromycin for 12-16 h. Take 1 μL of the turbid bacterial solution for bacterial solution PCR verification to obtain recombinant Lactobacillus plantarum ZY-1-overexpressing bacteriocin synthesis regulatory genes. ttdB.

[0019] Furthermore, the formula of the competent medium is as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol and 10 g / L glycine; the formula of the wash buffer is as follows: 326 g / L sucrose, hexahydrate and 0.72 g / L magnesium chloride; the formula of the resurrection medium is as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol and 1.12 g / L calcium chloride.

[0020] The present invention also provides the use of the recombinant Lactobacillus plantarum that overexpresses the bacteriocin synthesis regulatory gene in the preparation of bacteriocins.

[0021] Compared with the prior art, the advantages of the present invention are: the present invention discloses for the first time a strain of L(+)-tartrate dehydratase gene that can significantly increase the production of bacteriocin and the construction method and application of its recombinant Lactobacillus plantarum ZY-1-ttdB. Lactiplantibacillus plantarum )L(+)-Tartrate Dehydratase Gene of ZY-1( ttdB ) fragment was connected to the pMG36e expression vector and introduced into Lactobacillus plantarum by electroporation. Recombinant bacteria carrying the target gene were obtained through erythromycin resistance screening and identification, namely, the recombinant bacteria overexpressing the L(+)-tartrate dehydratase gene ( ttdB ) recombinant Lactobacillus plantarum ZY-1- ttdB The recombinant Lactobacillus plantarum strain increased bacteriocin production by 18% compared to the empty control ZY-1-0 strain. This is the first time a recombinant Lactobacillus plantarum strain ZY-1 overexpressing the L(+)-tartrate dehydratase gene has been constructed that can significantly increase bacteriocin production, providing an important basis for further research and application of bacteriocins.

[0022] The above-mentioned Lactobacillus plantarum ( Lactiplantibacillus plantarum ) ZY-1 strain, with the deposit number CGMCC NO. 29542, was deposited on January 8, 2024 at the General Microbiology Center of China Culture Collection Administration, with the deposit address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 To overexpress bacteriocin synthesis regulatory genes ( ttdB The results of agarose gel electrophoresis of PCR products of genes) are shown in Figure 1, where 1 represents Lane 1, and Lane 1 represents the gene ttdB Amplified product, Lane is the swimming lane, M refers to Marker, which is the molecular weight standard reference;

[0024] Figure 2 For the recombinant plasmid pMG36e- ttdB Graph construction process;

[0025] Figure 3 For pMG36e- ttdB Electrophoresis results of colony PCR products of positive clones, where 1 represents Lane 1, 2 represents Lane 2, and 3 represents Lane 3. Lanes (1-3) are pMG36e- ttdB Colony PCR products of positive clones, Lane refers to the swimming lane, M refers to Marker, which is the molecular weight standard reference;

[0026] Figure 4 For the recombinant plasmid pMG36e- ttdB and double enzyme digestion verification results of plasmid pMG36e, where 1 represents Lane 1, 2 represents Lane 2, 3 represents Lane 3, and 4 represents Lane 4. Lane 1 is pMG36e- ttdB Double enzyme digestion product, Lane 2 is pMG36e- ttdB Lane 3 represents the pMG36e double-digested product, Lane 4 represents the pMG36e undigested product, Lane represents the lane, and M represents the marker, which is a molecular weight standard reference.

[0027] Figure 5 The results of electroporation PCR verification are shown in Figure 2. (a) is the electrophoresis diagram of the PCR product of the bacterial solution of pMG36e electroporated into Lactobacillus plantarum ZY-1. M refers to Marker, which is a molecular weight standard reference. 1-4 refers to the PCR product of the bacterial solution. (b) is the electrophoresis diagram of pMG36e- ttdB Electrophoresis of PCR products electroporated into Lactobacillus plantarum ZY-1. M refers to Marker, which is a molecular weight standard reference. 1-4 refers to PCR products in the culture medium.

[0028] Figure 6 It is a genetically engineered strain of Lactobacillus plantarum ZY-1- ttdB qPCR relative quantitative results of ZY-1-0, where **** indicates P < 0.0001, and the dotted line indicates that the relative expression level of the control ZY-1-0 is 1;

[0029] Figure 7 The cell morphology under scanning electron microscope, where (a) is the wild type Lactobacillus plantarum ZY-1; (b) is Lactobacillus plantarum ZY-1-0; (c) is Lactobacillus plantarum ZY-1- ttdB ;

[0030] Figure 8 It is a genetically engineered strain of Lactobacillus plantarum ZY-1- ttdB The graph shows the changes in the antibacterial activity of bacteriocins produced by ZY-1-0 and ZY-1-0, where ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, Escherichia coli, Staphylococcus aureus, and Staphylococcus aureus. DETAILED DESCRIPTION

[0031] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments.

[0032] Example 1, recombinant expression vector pMG- ttdB The construction method is as follows:

[0033] Step 1: Design PCR primers for amplifying the overexpressed L(+)-tartrate dehydratase ( ttdB ) gene fragments, and the sequences of the PCR primers are as follows: ttdB The nucleotide sequence of the upstream amplification primer of the gene is shown in SEQ ID NO. 2: aaaaattcgtaattcgagctcATGAAAACTTACCACTTAACCACCC; ttdB The nucleotide sequence of the primer for downstream gene amplification is shown in SEQ ID NO.3: gttttcagactttgcaagcttTTATTTAATGAATTTAACTTGTTCGTTGA.

[0034] Step 2: Lactobacillus plantarum ( Lactiplantibacillus plantarum ) ZY-1 (this Lactobacillus plantarum has been deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration, and the registration number of the collection center is CGMCC NO. 29542) genomic DNA was used as a template, and the following PCR program was performed: (1) 95℃ for 3 min; (2) 95℃ for 15 s, 60℃ for 15 s, and 72℃ for 60 s; repeated for 35 cycles; (3) 72℃ for 5 min. The PCR reaction system is as follows: 2 × PhantaMax Master Mix 25μL, 10μM ttdB 2 μL of upstream gene amplification primer, 10 μM ttdB 2 μL of downstream gene amplification primers, 50-400 ng of template DNA, and ddH2O were added to a total volume of 50 μL. Figure 1 The agarose gel electrophoresis test results of the target gene PCR amplification products, Lane 1 is the gene ttdB After PCR amplification, the molecular weight of the product can be seen to be roughly correct from the position of the product band. Then the gel is cut and recovered and sequenced. ttdBThe nucleotide sequence of the gene is shown in SEQ ID NO.1:.

[0035] Step 3: Double digest the expression vector pMG36e with restriction enzymes Sac I and Hind III, then perform agarose gel electrophoresis and gel recovery. ttdB ) PCR amplification products were connected with linear vector (pMG36e) and incubated at 37°C for 30 min and 4°C for 10 min to construct recombinant plasmid pMG36e- ttdB . Figure 2 For the recombinant plasmid pMG36e- ttdB Graph construction process.

[0036] Figure 3 For pMG36e- ttdB Electrophoresis results of colony PCR products of positive clones. Lane (1-3) is pMG36e- ttdBColony PCR products of positive clones. The colony PCR products are single and about 1000 bp in size, which is consistent with the recombinant plasmid sequence.

[0037] Figure 4 For the recombinant plasmid pMG36e- ttdB The double enzyme digestion verification results of the plasmid pMG36e showed that Lane 1 was pMG36e- ttdB Double enzyme digestion product; Lane 2 is pMG36e- ttdB Lane 3 is the product of pMG36e double enzyme digestion; Lane 4 is the product of pMG36e not digested; the results show the linear plasmid band and the target gene band. ttdB Build successful.

[0038] Example 2, Lactobacillus plantarum genetically engineered bacteria ZY-1- ttdB 、Construction of ZY-1-0

[0039] The pMG- ttdB The overexpression plasmid was extracted using a plasmid extraction kit and then electroporated into Lactobacillus plantarum ZY-1. After recovery at 37°C for 3 hours, the plasmid was spread on an erythromycin-resistant plate and then cultured at 37°C for 36-48 hours. Transformants were screened and verified by PCR to obtain the overexpression of the L(+)-tartrate dehydratase gene. ttdB Recombinant Lactobacillus plantarum ZY-1- ttdB .

[0040] At the same time, the untreated expression vector pMG36e was extracted using a plasmid large-scale extraction kit, and then transformed into Lactobacillus plantarum ZY-1 by electroporation. After recovery at 37°C for 3 hours, it was spread on erythromycin-resistant plates and cultured at 37°C for 36-48 hours. Transformants were screened and verified by PCR to obtain empty-loaded Lactobacillus plantarum ZY-1-0.

[0041] The specific steps of the above-mentioned electroporation are as follows:

[0042] (1) Preparation of competent cells of Lactobacillus plantarum

[0043] The overnight activated Lactobacillus plantarum ZY-1 was inoculated into 50 mL competent culture medium at a volume ratio of 1%, and cultured in a 37°C incubator until the logarithmic phase (OD 600The culture was placed in ice water to cool the cells for 30 minutes. The cells were then centrifuged at 6000 g for 5 minutes at 4°C to collect the cells. The cells were resuspended in pre-chilled wash buffer and centrifuged at 3000 rpm for 5 minutes at 4°C. The wash was repeated twice. Finally, an equal volume of pre-chilled wash buffer was added to resuspend the cells. 100 μL of the aliquots were dispensed into 1.5 mL centrifuge tubes, quickly frozen in liquid nitrogen for 15 minutes, and stored in a -80°C freezer. The competent medium was formulated as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol, and 10 g / L glycine. The wash buffer was formulated as follows: 326 g / L sucrose, hexahydrate, and 0.72 g / L magnesium chloride. The reactivation medium was formulated as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol, and 1.12 g / L calcium chloride.

[0044] (2) Electrotransformation of Lactobacillus plantarum

[0045] Take out the frozen competent cells and plasmids of Lactobacillus plantarum and place them on ice to thaw. ttdB Gently mix with 100 µL of Lactobacillus plantarum ZY-1 competent cell solution and let stand on ice for 10 minutes. Transfer the recombinant plasmid and competent cell mixture to a pre-chilled electroporation cuvette and let stand on ice for 10 minutes before electroporating at 1.2 kV for 4 ms. Immediately after electroporation, add 900 µL of pre-chilled resuscitation medium and mix thoroughly. Transfer the mixture to a 1.5 mL centrifuge tube using a sterile 1 mL syringe. Resuscitate the tube at 37°C at 200 rpm for 3 hours. Centrifuge at 3000 rpm for 2 minutes, discard the supernatant, and resuspend in 1 mL of sterile MRS broth using a pipette. Spread 100 µL of the culture onto MRS plates containing 5 µg / mL erythromycin and incubate at 37°C for 36-48 hours. A single milky white colony was picked and cultured in 1 mL of MRS broth containing 5 μg / mL erythromycin for 12-16 h. 1 μL of the turbid bacterial solution was taken for bacterial solution PCR verification. The PCR products were sequenced and compared. The nucleotide sequence of the forward identification primer pMG36e-F was shown in SEQ ID NO.4: CAATCTGCCTCCTCATCCT, and the reverse identification primer pMG36e- ttdB The nucleotide sequence of -R is shown in SEQ ID NO. 5: TCCACTGGGCATCAACAAT. 5 μL of the colony PCR product was subjected to agarose gel electrophoresis (2% agarose concentration). PCR products showing the target band were sent for analysis.

[0046] Figure 5(a) is the electrophoresis diagram of the PCR product of the bacterial liquid transformed with pMG36e into Lactobacillus plantarum ZY-1. The verification primers pMG36e-F / R of pMG36e are located at both ends of the cloning site. The product length is 350 bp, and the position of the electrophoresis band of the product is consistent with the theoretical size of the product. The nucleotide sequence of the reverse identification primer pMG36e-R is shown in SEQ ID NO. 6: GCCACCTTCGTTTTCAGACT; Figure 5 Middle (b) is pMG36e- ttdB Electrophoresis of PCR products electrotransformed into Lactobacillus plantarum ZY-1, pMG36e- ttdB Designed primers pMG36e-F, pMG36e- ttdB -R, the upstream primer is located on the plasmid, the downstream primer is located on the inserted target gene, the product length is 716 bp, and the position of the product electrophoresis band is consistent with the theoretical size of the product.

[0047] Example 3, genetically engineered bacteria ZY-1- ttdB Validation at the genetic level.

[0048] The overexpression strain ZY-1 obtained in Example 2 was ttdB After RNA extraction, reverse transcription was performed to obtain cDNA products. ttdB RT-qPCR primers for genes, ttdB The nucleotide sequence of the forward primer for real-time quantitative PCR of the gene is shown in SEQ ID NO. 7: 5′-CGCCTTACACCTCGTCTACC-3′; ttdB The nucleotide sequence of the reverse primer for real-time quantitative PCR of the gene is shown in SEQ ID NO.8: 5'-CAAGTTGTCGCCATTCGTATCG-3', and the nucleotide sequence of the forward primer for real-time quantitative PCR of the internal reference gene is shown in SEQ ID NO.9: GGCGTGCTATTCATACCAGTC; the nucleotide sequence of the reverse primer for real-time quantitative PCR of the internal reference gene is shown in SEQ ID NO.10: CAGGTGTTATCCCGTGCTTC. The real-time quantitative PCR system is as follows: 1.5 μL of cDNA template, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 10 μL of 2 × Taq Pro Universal SYBR qPCR Master Mix, and dd H2O to 20 μL. The amplification program is set as follows: (1) pre-denaturation (95℃, 30 s); (2) denaturation (95℃, 10 s), annealing and extension (60℃, 30 s), 40 cycles; (3) cooling (37℃, 10 min). Use 2 -△△CTThe relative expression levels of target genes were calculated.

[0049] Figure 6 for ttdB The RT-qPCR relative quantitative results showed that ZY-1-0 was used as the control strain, and its relative expression level was always 1. The results showed that compared with ZY-1-0, the overexpression strain ZY-1- ttdB of ttdB The expression level increased significantly by more than 6.54 times, proving that ttdB Overexpression at the gene level.

[0050] Example 4: Scanning electron microscope observation of ZY-1, ZY-1-0 and ZY-1- ttdB Morphological changes

[0051] The strain ZY-1-0 obtained in Example 2 was mixed with ZY-1- ttdB After overnight culture of wild-type ZY-1 in MRS broth, ZY-1, ZY-1-0 and ZY-1- ttdB The cells were pelleted, washed, and resuspended in 2.5% glutaraldehyde and fixed at 4°C for 3 hours. The cells were then washed three times with 0.1 M phosphate-buffered saline (PBS, pH 7.2) and dehydrated in graded ethanol (30, 50, 70, 80, 90, and 100%) for 15 minutes each. Finally, the cells were resuspended in 1 mL of anhydrous tert-butanol and vacuum freeze-dried (-49°C, 24 hours, and 9 Pa). The dried samples were bonded to the scanning electron microscope (SEM) stage with conductive adhesive and gold-sprayed for observation of cell morphology under a scanning electron microscope.

[0052] Figure 7 (a) shows the cell morphology of wild-type Lactobacillus plantarum ZY-1 under a scanning electron microscope. Figure 7 Middle (b) shows the cell morphology of Lactobacillus plantarum ZY-1-0 under a scanning electron microscope. Figure 7 (c) is Lactobacillus plantarum ZY-1- ttdB Cell morphology under scanning electron microscopy. Compared with the wild type Lactobacillus plantarum ZY-1, ZY-1-0 and ZY-1- ttdB The cell diameter has increased. This change in cell diameter may be related to the transformation process of the exogenous plasmid. ttdB The gene may not be directly involved in cell proliferation or the synthesis of major membrane components, so its effect on cell morphology is not significant.

[0053] Example 5, genetically engineered bacteria ZY-1- ttdB Determination of bacteriocin activity.

[0054] The strains ZY-1-0 and ZY-1- ttdB , single colonies were activated for 16 h, and OD 600 Seed liquids with the same pH value were inoculated at the same ratio into MRS broth and cultured at 37°C for 24 hours. The fermentation supernatant was sterilized and removed of impurities by filtration through a sterile 0.22 μm filter, freeze-dried, reconstituted with sterile water, and concentrated 15-fold. The pH was adjusted to 6.5-7.0 with 5 M NaOH solution and then sterilized and removed of impurities by filtration through a sterile 0.22 μm filter. Filter-sterilized catalase solution was then added to the fermentation supernatant to a concentration of 1 mg / mL and incubated in a 37°C water bath for 2 hours. A sterile Oxford cup was placed on the antibacterial plate, and 200 μL of the supernatant, after deacidification and hydrogen peroxide removal, was added to each cup. After incubation at 37°C for 10 hours, the diameter of the inhibition zone was measured. A blank control was also prepared by adding MRS broth adjusted to a pH of 6.5-7.0.

[0055] Figure 8 For genetically engineered bacteria ZY-1- ttdB and ZY-1-0 bacteriocin antibacterial activity changes. Under three different indicator bacteria, ZY-1- ttdB All showed good antibacterial effects, with the inhibitory activity against Staphylococcus aureus (abbreviated as S. aureus) and Staphylococcus hominis (abbreviated as S. hominis) increasing by 18% and 10%, respectively.

[0056] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by those skilled in the art within the spirit and scope of the present invention shall also fall within the scope of protection of the present invention.

Claims

1. A bacteriocin synthesis regulatory gene, characterized in that: The gene is derived from Lactobacillus plantarum ( Lactiplantibacillus plantarum )ZY-1 gene encoding L(+)-tartaric acid dehydratase ttdB , whose nucleotide sequence is shown in SEQ ID NO.

1.

2. A method for constructing a recombinant Lactobacillus plantarum that overexpresses the bacteriocin synthesis regulatory gene according to claim 1, characterized in that The specific steps are as follows: (1) Recombinant expression vector pMG36e- ttdB Construction The deposit number is CGMCC NO. 29542 of plant lactobacillus ( Lactiplantibacillus plantarum ) ZY-1 genomic DNA was used as a template to design the L(+)-tartaric acid dehydratase gene of claim 1 ttdB Upstream and downstream PCR amplification primers, amplification ttdB The expression vector pMG36e was double-digested with restriction endonucleases Sac I and Hind III, and then subjected to agarose gel electrophoresis. After gel recovery, the recombinase ligation method was used to ttdB The gene fragment was connected with the linear vector pMG36e to construct the recombinant plasmid pMG36e- ttdB ; (2) Construction of recombinant Lactobacillus plantarum The recombinant plasmid pMG36e- ttdB The cells were electroporated and introduced into Lactobacillus plantarum ZY-1, and after recovery at 35-40°C for 1-5 hours, the cells were coated on erythromycin-resistant plates and cultured at 35-40°C for 36-48 hours to screen transformants. The transformants were verified by PCR to obtain recombinant Lactobacillus plantarum ZY-1 overexpressing the bacteriocin synthesis regulatory gene. ttdB .

3. The construction method according to claim 2, characterized in that Step (1) ttdB The nucleotide sequence of the upstream amplification primer of the gene is shown in SEQ ID NO.2: aaaaattcgtaattcgagctcATGAAAACTTACCACTTAACCACCC; ttdB The nucleotide sequence of the primer for downstream gene amplification is shown in SEQ ID NO.3: gttttcagactttgcaagcttTTATTTAATGAATTTAACTTGTTCGTTGA.

4. The construction method according to claim 3, characterized in that The PCR amplification procedure in step (1) is as follows: (1) 95°C for 3 min; (2) 95°C for 15 s, 60°C for 15 s, 72°C for 60 s; repeat 35 cycles; (3) 72°C for 5 min; the PCR reaction system is as follows: template DNA 50-400 ng, 2 × Phanta Max Master Mix 25 μL, ttdB 2 μL of upstream gene amplification primers, ttdB 2 μL of the downstream gene amplification primer was added, and ddH2O was added to make up to 50 μL.

5. The construction method according to claim 2, characterized in that The specific steps of the electroporation are as follows: (1) Preparation of competent Lactobacillus plantarum: Inoculate 50 mL competent culture medium with 1% volume ratio of overnight activated Lactobacillus plantarum ZY-1, place in a 37°C incubator to expand and culture to the logarithmic phase, place the cultured bacterial solution in ice water to cool the cells, collect the cells by low-speed centrifugation at 4°C, add pre-cooled washing buffer to resuspend the cells, repeat the washing twice after low-speed centrifugation, and finally add pre-cooled washing buffer with the same volume as the bacterial suspension to resuspend the cells to obtain Lactobacillus plantarum ZY-1 competent cell solution; (2) Electrotransformation of Lactobacillus plantarum: Take 1 μg of recombinant plasmid pMG36e- ttdB Gently mix with 100 μL of Lactobacillus plantarum ZY-1 competent cell solution and let it stand on ice for 10 min. Transfer the recombinant plasmid and competent cell mixture to a pre-cooled electroporation cup and let it stand in an ice bath for 10 min before electroporation. Immediately after the electroporation, add 900 μL of pre-cooled resuscitation medium and mix evenly. Use a 1 mL sterile syringe to transfer the mixture to a centrifuge tube. After shaking at 37 ° C and 200 rpm for 3 h, centrifuge at low speed and discard the supernatant. Add 1 mL of sterile MRS broth medium and resuspend it with a pipette. Spread each 100 μL of culture solution on an MRS plate containing 5 μg / mL erythromycin and culture at 37 ° C for 36-48 h. Pick a milky white single colony and culture it in 1 mL of MRS broth containing 5 μg / mL erythromycin for 12-16 h. Take 1 μL of the turbid bacterial solution for bacterial solution PCR verification to obtain recombinant Lactobacillus plantarum ZY-1-overexpressing bacteriocin synthesis regulatory genes. ttdB.

6. The construction method according to claim 5, characterized in that The formula of the competent medium is as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol, and 10 g / L glycine; the formula of the wash buffer is as follows: 326 g / L sucrose, hexahydrate, and 0.72 g / L magnesium chloride; the formula of the resurrection medium is as follows: 52.24 g / L MRS broth, 136.64 g / L sorbitol, and 1.12 g / L calcium chloride.

7. Use of a recombinant Lactobacillus plantarum overexpressing a bacteriocin synthesis regulatory gene constructed by the method according to any one of claims 2 to 6 in the preparation of bacteriocins.

Citation Information

Patent Citations

  • Bacterial co-culture metabolite for improving yield of bacteriocin and application of bacterial co-culture metabolite

    CN119842567A