Wild vibrio genome traceless editing method

Abstract

The invention belongs to the technical field of gene editing, discloses a wild vibrio genome traceless editing method, and provides a vibrio traceless editing system composed of a double-plasmid CRISPR / Cas9 system, and the vibrio traceless editing system comprises a Cas9 expression plasmid and a homologous targeting plasmid. The traceless editing system can successfully realize gene editing work such as knockout, knock-in and replacement of vibrio genes, an efficient and stable vibrio traceless gene editing method can be established, the gene editing efficiency in vibrio can reach up to 50-83.3%, and a good foundation is laid for gene function research and genetic breeding of vibrio. And after the vibrio gene is edited by the traceless editing system, the problem of residue of any exogenous gene does not exist, traceless editing of the vibrio genome is realized, and the traceless editing system can be safely used for industrial production.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and in particular relates to a method for seamlessly editing a wild Vibrio genome. Background Art

[0002] Vibrio is one of the core pathogenic strains in aquaculture, and the study of its genome or related genes is conducive to the development of related antibacterial technologies or products. However, due to its complex genetic background, wild Vibrio has poor stability of exogenous DNA or plasmids in its cells, and its own plasmids may carry drug-resistant genes, mobile elements or virulence genes, which greatly increases the complexity of gene transfer, which makes it difficult to introduce exogenous plasmids. Among them, traditional DNA delivery technologies such as electroporation and chemical transformation have extremely low conversion efficiency in wild Vibrio, and the potential toxicity of Cas9 protein to wild Vibrio have hindered the development of wild Vibrio gene editing tools, and ultimately failed to successfully establish an effective Vibrio (especially pathogenic Vibrio parahaemolyticus vp) CRISPR-Cas9 gene editing system. Daniel Stukenberg established an effective NT-CRISPR gene editing system in Vibrio natriuresis. It overexpressed the Tfox gene in Vibrio cholerae, which made Vibrio natriuresis naturally competent and able to absorb exogenous target DNA fragments, tDNA. After tDNA enters the cell, it has a certain probability of homologous recombination with the target gene on the genome, thereby achieving target gene deletion. By inducing the expression of Cas9-gRNA complexes and targeting the target gene, wild individuals that did not undergo homologous recombination had double-strand breaks and died, while individuals that knocked out the target gene by homologous recombination survived, thereby achieving the separation and purification of mutants and achieving the goal of scarless editing ( Figure 1 ).

[0003] The existing technology is to establish CRISPR gene editing technology in Vibrio parahaemolyticus, but there is no relevant report in Vibrio parahaemolyticus. The main disadvantages of the existing technology are: 1. The replicons of conventional plasmids such as E. coli, pMB1, pSC101, p15, etc. are extremely unstable in wild Vibrio parahaemolyticus, easy to lose, and difficult to establish an editing system; 2. The efficiency of linear homologous targeting fragments in transforming wild Vibrio parahaemolyticus is low, and even if transformed into the cell, it is easily degraded by intracellular nucleases, thereby reducing the efficiency of gene editing; 3. The gene editing system established based on the natural competence induced by TfoX lacks versatility.

[0004] Therefore, there is an urgent need to develop a CRISPR gene editing system for scarless editing of wild Vibrio genomes. Summary of the invention

[0005] The purpose of the first aspect of the present invention is to provide a traceless editing system for Vibrio.

[0006] The purpose of the second aspect of the present invention is to provide the application of the scarless editing system of the first aspect of the present invention in Vibrio genome editing.

[0007] The third aspect of the present invention is to provide a Vibrio genome engineered strain.

[0008] The purpose of the fourth aspect of the present invention is to provide a method for constructing the Vibrio genome engineered strain of the third aspect of the present invention.

[0009] The purpose of the fifth aspect of the present invention is to provide a method for scarless editing of the Vibrio genome.

[0010] In order to achieve the above object, the technical solution adopted by the present invention is:

[0011] The first aspect of the present invention provides a scarless editing system for Vibrio, which is composed of a dual-plasmid CRISPR / Cas9 system, including a Cas9 expression plasmid and a homologous targeting plasmid.

[0012] In some embodiments of the present invention, the Cas9 expression plasmid comprises the following elements: Cas9 and gRNA expression cassettes, sacB suicide gene, replicon, resistance gene and Mob element.

[0013] In some embodiments of the present invention, the expression of the Cas9 and gRNA expression cassettes is controlled by the tet regulatory system, and anhydrotetracycline aTC can induce Cas9 protein expression and gRNA transcription. The sacB suicide gene is a counter-screening marker. In LB or TSB medium containing 5% sucrose, the host containing the sacB gene will die. This gene is mainly used to ablate the plasmid after successful gene editing. The function of the Mob element is mainly used to assist the conjugation transformation of the plasmid, which is used to solve the problem of low efficiency of conventional transformation and electroporation in wild Vibrio.

[0014] In some embodiments of the invention, the replicon is Vpori.

[0015] The replicons of conventional plasmids such as E.coli, pMB1, pSC101, p15, etc. have extremely poor stability in wild Vibrio parahaemolyticus, are easily lost, and the editing system is difficult to establish. The present invention obtains the Vpori replicon that is relatively stable in Vibrio through screening, and there is almost no loss in Vibrio parahaemolyticus Vp32.

[0016] In some embodiments of the present invention, the resistance gene is the kanamycin resistance gene Kan.

[0017] In some embodiments of the present invention, the Cas9 expression plasmid further comprises an acrIIA4 gene resistant to CRISPR protein.

[0018] The leakage expression of Cas9 protein is toxic to the host. In order to minimize the damage to the host, the detoxification protein acrIIA4 gene is introduced into the system to minimize the damage caused by the background expression of Cas9. When aTC is induced, the overexpression of Cas9 can resist the detoxification activity of acrIIA4 and achieve gene editing.

[0019] In some embodiments of the present invention, the nucleotide sequence of the Cas9 expression plasmid is shown in SEQ ID NO:4 or SEQ ID NO:44.

[0020] In some embodiments of the present invention, the homologous targeting plasmid comprises the following elements: a replicon, a resistance gene, a Mob element, and a DNA fragment for homologous recombination.

[0021] In some embodiments of the present invention, the replicon in the homologous targeting plasmid is compatible with the replicon in the Cas9 expression plasmid.

[0022] In some embodiments of the present invention, the replicon in the homologous targeting plasmid is selected from R6k or P15.

[0023] In some embodiments of the present invention, the resistance gene in the homologous targeting plasmid is the spectinomycin resistance gene aadA.

[0024] In some embodiments of the present invention, the homologous recombination DNA fragment is upstream homology arm-insertion fragment-downstream homology arm when used for knock-in / replacement, and the homologous recombination DNA fragment is upstream homology arm-downstream homology arm when used for knock-out.

[0025] In some embodiments of the present invention, the homologous targeting plasmid also includes a target site recognized by the Cas9-gRNA complex. The target sites of the target gene recognized by Cas9 are introduced at both ends of the DNA fragment of homologous recombination. The Cas9-gRNA complex expresses and recognizes the target gene target site, and simultaneously recognizes and cuts the upstream and downstream target sites of the homologous arm on the plasmid, which will provide linearized homologous arm fragments to improve the efficiency of homologous replacement knockout of the target fragment.

[0026] In some embodiments of the present invention, when the endA gene of Vibrio parahaemolyticus Vp32 (accession number BNCC333072) is knocked out, the nucleotide sequence of the homologous targeting plasmid is as shown in SEQ ID NO:21; when the nuclease gene dns in Vibrio natriureticus (Vn, accession number CICC 10908) is replaced with DE3, the nucleotide sequence of the homologous targeting plasmid is as shown in SEQ ID NO:46.

[0027] In some embodiments of the present invention, the scarless editing includes scarless knockout, scarless complementation, scarless replacement and scarless insertion.

[0028] The present invention screens replicons that are relatively stable in Vibrio for constructing Cas9 expression plasmids, which are compatible with other replicons such as R6K or P15; homologous targeting fragments are placed on the plasmid to increase stability, and Cas9-gRNA target sites can be set at both ends of the targeting fragment. When gene editing is required, Cas9-gRNA is induced to target the gene to be knocked out, and at the same time, both ends of the homologous targeting fragment on the plasmid are cut to form linearized homologous targeting fragments, thereby improving homologous recombination efficiency and gene editing efficiency.

[0029] The second aspect of the present invention provides the application of the scarless editing system of the first aspect of the present invention in Vibrio genome editing.

[0030] In some embodiments of the present invention, the scarless editing includes scarless knockout, scarless complementation, scarless replacement and scarless insertion.

[0031] The third aspect of the present invention provides a Vibrio genome editing engineered strain containing the scarless editing system of the first aspect of the present invention.

[0032] The fourth aspect of the present invention provides a method for constructing the Vibrio genome editing engineered strain of the third aspect of the present invention, comprising the step of transforming the Cas9 expression plasmid and the homologous targeting plasmid described in the first aspect of the present invention into the host Vibrio cell by bacterial conjugation.

[0033] In some embodiments of the present invention, the bacterial conjugation method comprises the following steps:

[0034] (1) The Cas9 expression plasmid and the homologous targeting plasmid are cloned into the Escherichia coli host, respectively, to obtain donor bacteria containing the Cas9 expression plasmid and donor bacteria containing the homologous targeting plasmid; (2) The donor bacteria containing the Cas9 expression plasmid are mixed with Vibrio, and conjugation transformation is performed on a solid culture medium containing DAP, and the bacteria are collected and cultured on a TCBS plate coated with kanamycin to obtain a first engineering strain; (3) The donor bacteria containing the homologous targeting plasmid are mixed with the first engineering strain, and conjugation transformation is performed on a solid culture medium containing DAP, and the bacteria are collected and cultured on a TCBS plate coated with spectinomycin to obtain a Vibrio genome editing engineering strain.

[0035] In some embodiments of the present invention, the OD of the bacterial solution of the donor bacteria and Vibrio containing the Cas9 expression plasmid in (2) 600 The ratio of the two is (1-9):1. Furthermore, the OD of the bacterial solution of the donor bacteria and Vibrio containing the Cas9 expression plasmid in (2) is 600Both are 0.8~1.0, and the ratio between the two is (1~5):1.

[0036] In some embodiments of the present invention, the culture medium in (2) comprises LB or TSB medium.

[0037] In some embodiments of the present invention, the culture medium in (2) contains 0.1-0.5 M DAP.

[0038] In some embodiments of the present invention, the culture conditions in (2) are 35-38° C. for 10-15 hours.

[0039] In some embodiments of the present invention, the OD of the bacterial solution of the donor bacteria containing the homologous targeting plasmid and the first engineering strain in (3) 600 Both are 0.2~1.0, and the ratio between the two is (1~9):1.

[0040] In some embodiments of the present invention, the OD of the bacterial solution of the donor bacteria and Vibrio containing the Cas9 expression plasmid in (3) 600 Both are 0.8~1.0, and the ratio between the two is (1~5):1.

[0041] In some embodiments of the present invention, the culture medium in (3) contains 0.1-0.5 M DAP.

[0042] In some embodiments of the present invention, the culture conditions in (3) are culturing at 35-38° C. for 10-15 hours.

[0043] Due to the complex genetic background of wild strains, the transformation efficiency of conventional genetic transformation methods varies greatly in different bacterial hosts. The present invention innovatively uses bacterial conjugation to transform the Cas9 expression plasmid and the homologous targeting plasmid into the host cell. This method, as a key way of gene exchange and transmission in nature, can effectively solve the problem of low genetic transformation efficiency of Vibrio and also improve versatility.

[0044] The fifth aspect of the present invention provides a method for seamlessly editing the Vibrio genome, comprising the following steps: activating the Vibrio genome editing engineering strain of the fourth aspect of the present invention, coating it on a TCBS solid plate containing kanamycin and anhydrotetracycline for culture, thereby obtaining the gene-edited Vibrio.

[0045] In some embodiments of the present invention, the activation comprises inoculating the Vibrio genome-edited engineered strain into a TSB liquid culture medium containing anhydrotetracycline to activate and induce homologous recombination.

[0046] In some embodiments of the present invention, the TCBS solid plate contains 130-160 μg / mL kanamycin and 180-220 ng / mL anhydrotetracycline.

[0047] In some embodiments of the present invention, the culture conditions are 36-38 °C for 10-15 hours.

[0048] In some embodiments of the present invention, the Vibrio genome scarless editing method also includes a plasmid removal step.

[0049] The Cas9 plasmid carries the sacB suicide gene, and the plasmid loss can be achieved by subculturing in TSB medium containing 4w / t% to 6w / t% sucrose. The homologous arm targeting plasmids of R6K or p15 replicon engineering are unstable in wild Vibrio, and the plasmid loss can be achieved by subculturing in antibiotic-free medium.

[0050] In some embodiments of the present invention, the plasmid removal step includes: subculturing the cultured Vibrio in a culture medium containing sucrose, picking strains, and inoculating them into a culture medium containing kanamycin and spectinomycin for cultivation; if the strains do not grow in the culture medium containing kanamycin and spectinomycin, it indicates that the plasmids in the Vibrio have been completely removed.

[0051] In some embodiments of the present invention, the concentration of sucrose is 4 w / t% to 6 w / t%.

[0052] The beneficial effects of the present invention are:

[0053] The present invention provides a scarless editing system of Vibrio consisting of a dual-plasmid CRISPR / Cas9 system, including a Cas9 expression plasmid and a homologous targeting plasmid. Experiments have shown that the scarless editing system can successfully achieve gene editing such as knockout and knock-in replacement of Vibrio genes, and can establish an efficient and stable scarless gene editing method for Vibrio. The gene editing efficiency in Vibrio can be as high as 50% to 83.3%, laying a good foundation for the gene function research and genetic breeding of Vibrio. And through the scarless editing system, there is no residual problem of any exogenous gene after Vibrio gene editing, and the scarless editing of the Vibrio genome is achieved, which can be safely used in industrial production.

[0054] The present invention screens a replicon (Vpori) that is relatively stable in Vibrio, and is used to construct a cas9 expression plasmid, and further imparts a mobile element Mob on the plasmid, so that the Cas9 expression plasmid can be efficiently transmitted by bacterial conjugation; in order to achieve traceless knockout, a suicide gene sacB is also introduced on the plasmid, so that subsequent plasmid elimination is convenient. Screening replicons (r6k, P15) that are compatible with Vpori, for the construction of homologous targeting plasmids, homologous targeting fragments are placed on the plasmid, and are more stable than directly linearized targeting fragments, and gRNA target sites can be set at both ends of the targeting fragments, and only when gene editing is needed, while inducing Cas9-gRNA targeting to knock out genes, the homologous targeting fragments on the plasmid are cut at both ends, forming linearized homologous targeting fragments, improving homologous recombination efficiency and gene editing efficiency, and when gene editing is not needed, the Cas9 plasmid and the homologous targeting plasmid can coexist.

[0055] Due to the complex genetic background of wild strains, the transformation efficiency of conventional genetic transformation methods varies greatly in different bacterial hosts. Based on the problem of transformation efficiency, the present invention further selects the CRISPR / CAS9 editing scheme of bacterial conjugation and optimizes the conditions in the bacterial conjugation process (wherein, experiments have shown that when the proportion of donor bacteria is greater than or equal to that of recipient bacteria, it is beneficial to improve the conjugation efficiency, and the bacterial concentration is at OD 600 The conjugation efficiency is relatively good when the conjugation efficiency is between 0.8 and 1.0), which effectively solves the problem of low genetic transformation efficiency of Vibrio and improves the versatility of its transformation. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 This is the principle of the CRISPR editing system based on natural competence.

[0057] Figure 2 This is the reporter plasmid map used to screen replicons in Example 1.

[0058] Figure 3 The plasmid map (left) and bacterial binding result diagram (right) used for testing the genetic transformation efficiency of Vibrio in Example 2.

[0059] Figure 4 The plasmid maps of pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob and pTETsacB-cas9-Vpori-kan.

[0060] Figure 5 The plasmid map of Vp32-up-endA-down-aadA-mob-R6K is shown.

[0061] Figure 6 This is the endA gene knockout cloning plate of wild Vibrio Vp32.

[0062] Figure 7 Schematic diagram of endA knockout region and primer design (top) and PCR identification electrophoresis diagram (bottom).

[0063] Figure 8 The plasmid maps are pTETsacB-cas9-VP32endA-sgRNA-acrIIA4-Vpori-Kan-mob and Vp32-up-endA-down-TS2-aadA-mob-R6K.

[0064] Fig. 9 This is the conjugation transformation cloning plate for the engineered strain VP32#2 in Example 7.

[0065] Fig.10 This is the PCR identification result of the endA gene knockout clone of wild Vibrio Vp32 in Example 7.

[0066] Fig.11 The plasmid maps of pTETsacB-cas9-Vndns-sgRNA-Vpori-Kan-mob and Vn-LdnsR-T7RNAP-LacIQ-mob-aadA-P15 are shown.

[0067] Fig.12 Schematic diagram of primer design for replacing the dns of the nuclease gene of Vibrio natriuresis with DE3 (T7 RNAP).

[0068] Fig.13 The dns gene knockout clone of Vibrio natriuresis (left) and the PCR electrophoresis identification results (right).

[0069] Fig.14 This is the plasmid map of pTac-LacO-VcTfox-p15-mob-cm. DETAILED DESCRIPTION

[0070] The present invention is further described in detail below through specific examples.

[0071] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0072] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0073] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0074] Example 1 Screening of Stable Replicons in Vibrio

[0075] GFP is used as the reporter gene, and the strong promoter J23119 is constitutively expressed. Different replicons (Vpori, p15 replicon, pSC101 replicon, pMB1 replicon and R6K replicon) are assigned and GFP reporter plasmids containing different replicons are constructed (named as plasmid J23119-sfGFP-kan-specific replicon). The GFP reporter plasmids of different replicons are only different in the replicons. Those skilled in the art can construct GFP reporter plasmids carrying different replicons through the most basic molecular biological methods. Among them, the GFP reporter plasmid constructed by the Vpori replicon is recorded as plasmid J23119-sfGFP-kan-Vpori. The spectrum of this plasmid is shown in FIG. Figure 2 Its complete nucleotide sequence is shown in SEQ ID NO:1.

[0076] The GFP reporter plasmids carrying different replicons were electroporated into wild Vibrio Vp32 (accession number BNCC333072) and Vp44 (accession number BNCC138541) to obtain the wild Vibrio engineered strain VP32 / vp44-GFP producing green fluorescent protein. The specific steps are as follows:

[0077] (1) Wild Vibrio parahaemolyticus Vp32 and Vp44 were inoculated into TSB (1.5% sodium chloride) liquid medium and cultured at 37°C and 200 rpm until OD 600is about 0.8; (2) pre-cool the bacterial solution in ice water for 30 minutes, centrifuge at 5000rpm, 4℃ for 4 minutes to collect the bacteria; (3) resuspend the bacteria in sterile and pre-cooled 1mM pH7.4 phosphate buffer (containing 400mM sucrose), collect the bacteria by centrifugation at 5000rpm, 4℃, and then wash once with the same buffer; (4) resuspend the bacteria in one-tenth volume of buffer and place on ice for later use; (5) take 50μL of the resuspended bacteria and put it in a new centrifuge tube, add 100ng GFP reporter plasmid (such as plasmid J23119-sfGFP-kan-Vpori), mix gently, and transfer the mixture to an ice-precooled 1cm electroporation cup and let it stand on ice for 5 minutes; (6) wipe the water outside the electroporation cup clean, place it in the electroporation equipment slot, adjust the parameters to 10Kv / cm, 25uF, 200Ω for electroporation transformation; (7) the electroporated bacterial solution is placed in 1mL The cells were resuspended in TSB (1.5% sodium chloride) and revived at 37°C for 1 h; (8) an appropriate amount of the revived bacterial liquid was spread on a solid TSB (1.5% sodium chloride) plate containing 150 μg / mL kanamycin and inverted in a 37°C incubator overnight; (9) a green single clone was cultured and sent for sequencing, and the clones with correct sequencing were used for the next subculture; (10) GFP Vibrio Vp32 and Vp44 strains carrying different replicons were subcultured in TSB (1.5% sodium chloride) liquid culture medium, inoculated and subcultured once every 24 h, and diluted appropriately to spread on antibiotic-free plates and antibiotic plates (150 μg / mL kanamycin), three times in parallel, counted every other day, and the plasmid loss rate was the ratio of the number of green clones on the antibiotic plate to the total number of clones on the antibiotic-free plate.

[0078] Table 1 shows the proportion of wild Vibrio parahaemolyticus (Vp32, Vp44) carrying different replicons that did not lose plasmids after 7 days of passage. The results showed that in the two wild Vibrio parahaemolyticus Vp32 and Vp44, most of the plasmids of conventional Escherichia coli replicons were lost during passage within 7 days without the addition of antibiotics, and only the Vpori replicon was more stable during the passage of Vibrio, especially in Vp32, with almost no loss. Therefore, the subsequent Cas9 expression plasmid preferentially uses the replicon Vpori.

[0079] Table 1 Stability of non-resistant replicon (proportion not lost)

[0080] P15 replicon pSC101 replicon pMB1 replicon Vpori Replicon R6K replicon Vp32-GFP 1％ 0.2％ 5％ 98％ 32％ Vp44-GFP 3.5％ 0.35％ 2.4％ 45％ N

[0081] Note: N in Table 1 means that the R6K replicon has no function in this Vp44.

[0082] Example 2 Optimization of wild Vibrio genetic transformation system

[0083] Genetic transformation of conventional bacteria is more common by electroporation and chemical transformation. According to literature reports, different transformation conditions were tested. The electroporation steps were the same as the Vp32 / Vp44 electroporation steps in Example 1. The only difference between the different methods was the washing buffer and electroporation parameters. For details, see the electroporation system in Table 2. The preparation of chemical transformation competent cells was carried out with reference to the instructions of the competent cell preparation kit of Takara Company, Catalog No. 9139.

[0084] Table 2 Optimization of Vibrio genetic transformation methods and efficiency statistics

[0085]

[0086] The test results showed that the transformation efficiency of both electroporation and chemical transformation was low in wild Vibrio (Table 2). The extremely low transformation efficiency would seriously hinder the establishment of CRISPR gene editing technology in wild Vibrio parahaemolyticus.

[0087] In addition to electroporation and chemical transformation, bacterial conjugation transformation is also a common means of transferring genetic material. Therefore, in order to solve the problem of low efficiency of genetic transformation and improve versatility, the inventors further adopted a method of optimizing bacterial conjugation transformation. In bacterial conjugation transformation, the donor bacteria are tightly bound to the recipient bacteria through the pili, and the plasmid is transferred from the donor bacteria to the recipient bacteria, giving the recipient bacteria new resistance or other traits. The transfer of plasmids requires the assistance of transfer operons and inducing genes (mob). The specific conjugation steps are as follows:

[0088] (1) E. coli MFD pir or E. coli S17 pir was selected as the donor bacteria. Both of them carry the RP4 transfer operon element integrated into the genome. The donor bacteria contain the target plasmid to be transferred, including the inducing gene mob. The MFDpir host is a nutritionally deficient strain and requires an additional 0.3 mM DAP for normal growth. The mcherry reporter plasmid (i.e., Pλ-mcherry-mob-Vpori-CM, see the spectrum) was used to generate the target plasmid. Figure 3 The donor bacteria (nucleotide sequence of which is shown in SEQ ID NO: 2) were cultured in LB medium (containing 0.3 M DAP and 25 μg / mL chloramphenicol) at 37°C and 200 rpm until the logarithmic phase (OD 600 1.0, 0.8, 0.6, 0.4 or 0.2). (2) Wild Vibrio parahaemolyticus Vp32 or wild Vibrio parahaemolyticus Vp44 was used as the recipient bacteria and inoculated into TSB (1.5% sodium chloride) medium and cultured at 37°C and 200 rpm until the logarithmic phase (OD 6001.0, 0.8, 0.6, 0.4 or 0.2). (3) Wash the donor bacteria and the recipient bacteria twice with an equal volume of culture medium without antibiotics and resuspend them. Mix 500 μL of each in a 1:1 ratio (or a donor-receiver ratio of 9:1, 5:1, 1:5, 1:9), centrifuge at 5000 rpm for 3 min at room temperature, and remove the supernatant to collect the mixed bacteria. (4) Resuspend the bacteria in 100 μL of fresh culture medium (without antibiotics). (5) Add the above 100 μL of mixed bacteria to a solid plate containing 0.3 M DAP in TSB (1.5% sodium chloride) in multiple times (10 μL each time), blow dry the droplets in a clean bench (approximately 30 minutes), and place the plate in a 30°C incubator for 1 to 2 hours. (6) Scrape the cells after conjugation in step (5) with 2 mL of fresh TSB liquid medium, collect the cells by centrifugation, wash twice with TSB liquid medium to remove residual DAP, etc., and finally resuspend the cells with 1 mL of TSB medium and spread them on a TCBS solid plate (containing 5 μg / mL chloramphenicol).

[0089] Only when the recipient bacteria, i.e., wild Vibrio, accept the plasmid of the donor bacteria, can they grow on the plate containing the corresponding antibiotics. Since DAP and TCBS are not added to inhibit the growth of non-Vibrio, the donor strains are eliminated on the plate and no false positive phenomenon will occur.

[0090] By optimizing the ratio of donor to recipient bacteria and bacterial concentration, the results showed that the ratio of donor bacteria greater than or equal to recipient bacteria was beneficial to improving the conjugation efficiency. 600 The bonding efficiency is relatively good when the value is between 0.8 and 1.0 (Table 3 and Figure 3 ), so the subsequent conjugation conditions were set at a donor-to-recipient ratio of 1:1 and donor and recipient bacterial concentrations of OD 600 1.0.

[0091] Table 3 Optimization of Vibrio conjugation conditions and efficiency statistics

[0092]

[0093]

[0094] Example 3 Construction of CT-CRISPR gene editing system expression vector

[0095] 1. Construction of Cas9 expression plasmid pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob

[0096] In this example, the wild Vibrio parahaemolyticus Vp32 nuclease endA gene is used as an example to construct the Cas9 expression plasmid pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob of the wild Vibrio CT-CRISPR editing system. Figure 4 As shown, its nucleotide sequence is shown in SEQ ID NO:3. The Cas9 expression plasmid comprises a Cas9 and gRNA expression cassette, whose expression is controlled by the tet regulatory system, and anhydrotetracycline aTC can induce Cas9 protein expression and gRNA transcription; it comprises a sacB suicide gene constitutive expression cassette, which is a counter-screening marker. In an LB or TSB medium containing 5% sucrose, a host containing the sacB gene will die. The gene is mainly used to ablate the plasmid after successful gene editing; it also comprises a Mob element, whose function is mainly used to assist the conjugation transformation of the plasmid, and is used to solve the problem of low efficiency of conventional transformation and electroporation in wild Vibrio; other elements also include replicon Vpori and Kan resistance markers.

[0097] The construction process of Cas9 expression plasmid pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob is as follows:

[0098] (1) Plasmid pEcCas9 (addgene plasmid number #73227) was used as a template, and primers srRNA-F (73-mer) (SEQ ID NO: 4) and sgRNA-R (89-mer) (SEQ ID NO: 5) were used to amplify the gRNA fragment, primers sacB-R (89-mer) (SEQ ID NO: 6) and gSacB-F (47-mer) (SEQ ID NO: 7) were used to amplify the suicide gene sacB fragment, primers TETR-R (89-mer) (SEQ ID NO: 8) and TETR-F (24-mer) (SEQ ID NO: 9) were used to amplify the TETR gene fragment, and primers cas9-F (81-mer) (SEQ ID NO: 10) and cas9-R (50-mer) (SEQ ID NO: 11) were used to amplify the cas9 gene fragment; plasmid J23119-GFP-kan-Vpori (SEQ ID NO: NO:1) as a template, using primers rrnb1-kan-R (89-mer) (SEQ ID NO:12) and vpori-F (49-mer) (SEQ ID NO:13) to amplify the Vpori-Kan DNA fragment. The above fragments were mixed, connected with gibson recombinase and transformed into Escherichia coli to obtain the intermediate plasmid pTETsacB-cas9-Vpori-kan-dna ( Figure 4(2) Using the intermediate plasmid pTETsacB-cas9-Vpori-kan-dna as a template, primers VP32-endA-sgRNA-F (SEQ ID NO: 14) and 329-R (SEQ ID NO: 15) were used to amplify the kan-vp32endA-gRNA fragment, and primers Vpori-F2 (SEQ ID NO: 16) and sacB-R (SEQ ID NO: 6) were used to amplify the sacB-TETR-CAS9-Vpori large fragment; using the mcherry reporter plasmid (Example 2, SEQ ID NO: 2) as a template, primers 329MOB-F (55-mer) (SEQ ID NO: 17) and 329MOB-R (45-mer) (SEQ ID NO:18) amplify the mob mobile element DNA fragment; connect the above three fragments with Gibson recombinase and transform Escherichia coli. If the sequencing is correct, the plasmid pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob ( Figure 4 ).

[0099] 2. Construction of homologous targeting plasmid Vp32-up-endA-down-aadA-mob-R6K

[0100] In this example, in the wild Vibrio parahaemolyticus Vp32 host, the gene to be knocked out is the endonuclease gene endA, which will degrade exogenous DNA or plasmids entering the Vp32 cell. Knocking out this gene can improve the stability of the plasmid and the success rate of subsequent gene editing.

[0101] According to the nucleic acid sequence of endA (SEQ ID NO: 19), the Cas9 target site TTTACACAACCTGACCCCAGcgg (PAM) (SEQ ID NO: 20) was designed, the knockout fragment was about 500 bp, and the homology arm sequence of about 3000 bp, endA up and endA down sequences were amplified according to the sequences on both sides of the knockout fragment, and then connected with the R6K-mob-aadA fragment by the Gibson homologous recombination method to construct a homologous targeting plasmid Vp32-up-endA-down-aadA-mob-R6K (SEQ ID NO: 21). The plasmid contains the replicon R6k, the spectinomycin resistance gene aadA, the mobile element mob, and the homology arm fragments about 3 kb upstream and downstream of the endA fragment to be knocked out.

[0102] The specific construction process of the homologous targeting plasmid Vp32-up-endA-down-aadA-mob-R6K is as follows: (1) Extract the genomic DNA of wild-type Vp32 Vibrio parahaemolyticus as a template, use primers VP32-endA-F1 (SEQ ID NO: 22) and vp32DOWN-R1 (SEQ ID NO: 23) to amplify the upstream homologous arm fragment endAup of the endA gene, and use primers VP32UP-F (SEQ ID NO: 24) and VP32-endA-R (SEQ ID NO: 25) to amplify the downstream homologous arm fragment endA down; (2) Use the synthesized plasmid PUC-GW-kan-R6K-mob (SEQ ID NO: 26) as a template, use primers endA-R6K-F (SEQ ID NO: 27) and endA-MOB-R (SEQ ID NO: 28) to amplify the downstream homologous arm fragment endA down. NO:28) amplify the mob-R6K fragment; (3) using plasmid pTAC-LACO-GFP-P15-aadA (SEQ ID NO:29) as a template, using primers gCAT-F (SEQ ID NO:30) and gaadA-R (SEQ ID NO:31) to amplify the aadA resistance gene fragment; (4) assembling and connecting the above four fragments by conventional homologous recombination method to transform Escherichia coli, and cloning and sequencing were successful to obtain the homologous targeting plasmid Vp32-up-endA-down-aadA-mob-R6K for endA gene knockout (see spectrum Figure 5 ).

[0103] Example 4 Construction of wild Vibrio parahaemolyticus Vp32 gene editing engineered strain

[0104] In this implementation, gene editing was performed on the host wild Vibrio parahaemolyticus Vp32.

[0105] To edit the gene of the host wild Vibrio Vp32, the plasmid pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob (Example 3) and the homologous targeting donor plasmid Vp32-up-endA-down-aadA-mob-R6K (Example 3) must first be transformed into the Vp32 host. Due to the low efficiency of conventional electrotransformation and chemical transformation of wild Vibrio (Example 2), bacterial conjugation is used to transform the plasmid into the wild Vibrio cell. The specific process is as follows:

[0106] pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob and the homologous targeting donor plasmid Vp32-up-endA-down-aadA-mob-R6K were cloned into the MFDλ commercial Escherichia coli host (DAP-assisted growth was required) to obtain the donor bacteria MFD-pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob and MFD-Vp32-endA-aadA.

[0107] The donor strain (MFD-pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob) was inoculated into LB medium containing 0.3 M DAP and cultured at 37 °C and 200 rpm until OD 600 The recipient strain (i.e., wild-type Vibrio parahaemolyticus Vp32) was inoculated into TSB medium containing 1.5% sodium chloride and cultured at 37°C and 200 rpm until OD 600 About 1.0. Wash the recipient bacteria and donor strains twice with LB or TSB medium without antibiotics, and resuspend them with the same volume of medium for later use. Take 500μL of the resuspended recipient bacteria and donor bacteria and mix them evenly (i.e., 1:1 mixing of donor and recipient bacteria), centrifuge at 5000rpm for 3min, remove the supernatant, resuspend the precipitate with 100μL TSB medium and mix them evenly. Add 10μL of the mixed bacterial suspension to TSB solid medium containing 0.3M DAP for conjugation and transformation. After the liquid is completely absorbed, the culture medium is placed in a 37℃ incubator and cultured for 1 to 2 hours, then the bacteria on the plate are scraped off with 2mL TSB liquid culture medium, centrifuged at 12000rpm for 1min to collect the bacteria, washed twice with TSB medium, resuspended with 1000μL medium, and 200μL is spread on a TCBS plate containing the corresponding plasmid resistance, and cultured at 37℃ overnight. Pick clones the next day ( Figure 6 ) for molecular identification, and the engineered strain Vp32-Cas9-endA-sgRNA was obtained if the sequencing was correct. The homologous targeting plasmid was joined into the strain Vp32-Cas9-endA-sgRNA by the same method, and the strain containing the cas9 expression plasmid and the targeting plasmid was obtained if the sequencing was correct, and was named VP32#1.

[0108] Example 5 Wild Vibrio CT-CRISPR seamlessly knocks out Vp32 gene endA

[0109] This example is used to verify whether the wild Vibrio parahaemolyticus Vp32 gene editing engineering strain VP32#1 constructed in Example 4 can knock out the Vp32 gene endA without leaving any mark, as follows:

[0110] The engineered strain VP32#1 was inoculated into TSB medium and activated overnight at 37℃200rpm. The next day, the activated bacterial solution was transferred to a new TSB medium (containing 150μg / mL kanamycin and 150μg / mL spe) at a ratio of 1:100. During this period, the homology arm fragments on the targeting plasmid had a probability of recombining with the endA fragment on the Vp32 genome, thereby achieving the knockout of the endA gene fragment. 600 The concentration of Cas9 protein is about 0.6. 200 ng / mL aTC is added for induction overnight. The expression of Cas9 protein and the gRNA transcription complex product targeting the endA gene will target the endA gene and produce double-strand breaks, causing bacterial death. Individuals that have undergone homologous recombination and lost the endA fragment will not be targeted by the Cas9 protein complex and cause death. The bacterial suspension after overnight induction was diluted to an appropriate multiple and coated on a TSB plate containing 200 ng / mL aTC. The clones that can grow normally are theoretically mutants that have successfully knocked out the endA gene. The clones were selected for further PCR molecular identification. The endA-F / R (SEQ ID NO: 32-33) primers of the positive clones could not amplify the bands, and the endAV-F / R (SEQ ID NO: 34-35) outer primers amplified the bands of 350 bp; on the contrary, the false positive or negative amplified bands were fragments of 500 bp and 850 bp, respectively.

[0111] Six clones were selected for PCR identification. The results showed that the endA-F / R primers of clones 3 and 4 amplified a 500bp band, and the endAV-F / R primers amplified a 850bp band, which were false positives; the endA-F / R primers of clones 1, 2, and 5 did not amplify a band, and the endAV-F / R primers amplified a 350bp band, which were positive ( Figure 7 ). The overall endA gene knockout success rate was greater than 50%.

[0112] Example 6 Optimization of the Wild Vibrio CT-CRISPR Scarless Editing System

[0113] As can be seen from Example 5, although the endA gene of wild Vibrio parahaemolyticus Vp32 has been successfully knocked out, the knockout success rate is about 50%, and there is room for further improvement. Linearized homology arm fragments are more prone to homologous recombination than plasmid forms, so the inventors further introduced target sites recognized by the cas9 complex on both sides of the homology arms; secondly, the leakage expression of cas9 protein has certain toxicity to the host. In order to minimize the damage to the host, the detoxification protein acrIIA4 gene is introduced into the system to minimize the damage of cas9 background expression. When aTC is induced, overexpression of cas9 can resist the detoxification activity of acrIIA4 and achieve gene editing.

[0114] On the basis of the original cas9 expression plasmid (pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob), the anti-CRISPR protein acrIIA4 gene was introduced for constitutive expression, and the promoter was J23106. The specific construction process is as follows: (1) The J23106-acrIIA4-BioT gene sequence (SEQ ID NO: 36) was synthesized by GENEWISE, and primers J23106-F (SEQ ID NO: 37) and CAS9-BioT-R (SEQ ID NO: 38) were used to amplify the DNA fragment J23106-acrIIA4-BioT; (2) The plasmid pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob constructed in Example 3 was used as a template, and the large fragment was amplified using primers Vpori-F1 (SEQ ID NO: 39) and CAS9-R (SEQ ID NO: 11); (3) The two fragments were connected and transformed into Escherichia coli by homologous recombination, and the plasmid pTETsacB-cas9-VP32endA-sgRNA-acrIIA4-Vpori-Kan-mob ( Figure 8 ).

[0115] The target sites of the endA gene for cas9 recognition are additionally introduced on both sides of the homology arms of the homology targeting plasmid. The Cas9-gRNA complex expresses and recognizes the target site of the endA gene, and simultaneously recognizes and cuts the upstream and downstream target sites of the homology arms on the plasmid, which will provide linearized homology arm fragments to improve the efficiency of homologous replacement and knockout of the endA fragment. The construction process of the new homology targeting plasmid is as follows: (1) Using the homology targeting plasmid Vp32-up-endA-down-aadA-mob-R6K in Example 3 as a template, the DNA fragment TS-R6K-mob-aadA-TS is amplified with primers endA-R6K-TF (SEQ ID NO: 40) and primers gaadA-TR (SEQ ID NO: 41), and the homology arm fragment vp32-up-down is amplified with primers vp32UP-F (SEQ ID NO: 24) and primers vp32DOWN-R1 (SEQ ID NO: 23). (2) The two fragments were connected by Gibson homologous recombination using conventional molecular biological methods and transformed into Escherichia coli. The cloned fragment with correct sequencing was the optimized homologous targeting plasmid Vp32-up-endA-down-TS2-aadA-mob-R6K for endA gene knockout.

[0116] Example 7 CT-CRISPR gene editing system test

[0117] This example is used to verify the efficiency of the wild Vibrio CT-CRISPR scarless editing system optimized in Example 6 in knocking out endA of the Vp32 gene.

[0118] As in Example 4, pTETsacB-cas9-VP32endA-sgRNA-acrIIA4-Vpori-Kan-mob and the homologous targeting donor plasmid Vp32-up-endA-down-TS2-aadA-mob-R6K were respectively cloned in the MFDλ commercial Escherichia coli host (DAP-assisted growth is required) to obtain the donor bacteria MFD-pTETsacB-cas9-VP32endA-sgRNA-acrIIA4-Vpori-Kan-mob and MFD-Vp32-up-endA-down-TS2-aadA-mob-R6K. The donor bacteria pTETsacB-cas9-VP32endA-sgRNA-acrIIA4-Vpori-Kan-mob was combined with the recipient bacteria Vp32 to obtain the engineered strain Vp32-pTETsacB-cas9-VP32endA-sgRNA-acrIIA4-Vpori-Kan-mob. The donor strain MFD-Vp32-up-endA-down-TS2-aadA-mob-R6K was then conjugated with the recipient strain Vp32-pTETsacB-cas9-VP32endA-sgRNA-acrIIA4-Vpori-Kan-mob to obtain the test engineered strain Vp32-pTETsacB-cas9-VP32endA-sgRNA-acrIIA4-Vpori-Kan-mob / Vp32-up-endA-down-TS2-aadA-mob-R6K, which was named Vp32#2 after sequencing was correct ( Fig. 9 ).

[0119] Vp32#2 monoclonal was inoculated into TSB medium and cultured until OD 600 0.6, add 200ng / mL of anhydrotetracycline to induce the expression of Cas9 protein complex overnight. Dilute the appropriate multiples and apply to TCBS solid plate containing 150μg / mL kanamycin and 200ng / mL anhydrotetracycline, incubate overnight at 37℃, and pick 12 clones for PCR identification the next day. EndA-F / R primers all amplified bands, and endAV-F / R primers obtained expected bands except for clones 3 and 8, which did not amplify 350bp bands. The overall positive rate was 83.3% ( Fig.10 ), which is greater than the initial 50% knockout rate. That is, after optimization, the knockout success rate of the CT-CRISPR system in wild Vibrio parahaemolyticus reached 83.3%.

[0120] Example 8 CT-CRISPR gene editing system replaces the Vibrio natriuretic nuclease gene dns with DE3 (T7 RNAP)

[0121] In Vibrio natriuresis (Vn, deposit number CICC 10908), the product nuclease expressed by the nuclease gene dns degrades the stability of exogenous DNA and plasmids, so knocking out the dns gene (SEQ ID NO: 42) can improve its stability and applicability as a chassis cell. According to the dns nucleic acid sequence, the cas9 target site CAGCTGCAATGCTGGCAAAG (SEQ ID NO: 43) was designed.

[0122] According to the designed target site, the gRNA site on the vector pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob only needs to be changed to the target site CAGCTGCAATGCTGGCAAAG of the Vn dns gene to obtain the cas9 expression vector pTETsacB-cas9-Vndns-sgRNA-Vpori-Kan-mob (SEQ ID NO: 44) for knocking out the Vn dns gene. The detailed process is as follows: using the plasmid pTETsacB-cas9-VP32endA-sgRNA-Vpori-Kan-mob in Example 3 as a template, using primers vn-dns-sgRNA-F (SEQ ID NO: 45) and sacB-R (SEQ ID NO: 6) to amplify the full length to obtain a linearized DNA fragment introducing the dns target site; the purified fragment is connected to transform the host MFD-λ by conventional homologous recombination cloning, and the Cas9 expression vector for knocking out the dns gene and the donor strain MFD-pTETsacB-cas9-Vndns-sgRNA-Vpori-Kan-mob are obtained if the clone is sequenced correctly.

[0123] The dns gene fragment was proposed to be replaced with the DE3 fragment T7RNAP polymerase expression cassette to construct the targeting plasmid Vn-LdnsR-T7RNAP-LacIQ-mob-aadA-P15 (SEQ ID NO: 46), which contains the replicon P15, the T7RNAP expression cassette (DE3 sequence), about 2000 bp of flanking homologous recombination sequences on both sides of the dns knockout fragment, the junction mobile element mob, and the resistance gene aadA ( Fig.11The detailed construction process is as follows: (1) Using the plasmid pTAC-LACO-GFP-P15-aadA in Example 3 as a template, the p15 replicon DNA fragment was amplified using primers p15-dns-F (SEQ ID NO: 47) and primer p15-dns-R (SEQ ID NO: 48); (2) Using the plasmid Vp32-up-endA-down-aadA-mob-R6K constructed in Example 3 as a template, the mob-aadA fragment was amplified using primers 101-dns-F (SEQ ID NO: 49) and aadA-dns-R (SEQ ID NO: 50); (3) Using Vn genomic DNA as a template, the homology arm fragment dns-down was amplified using primers dns-aL-F1 (SEQ ID NO: 51) and dns-aL-R (SEQ ID NO: 52), and the homology arm fragment dns-down was amplified using primers T7-dns-aR-FT (SEQ ID NO: 53). NO:53) and 101-dns-R (SEQ ID NO:54) were used to amplify the homology arm fragment dns-up; (4) BL21 (DE3) Escherichia coli genomic DNA was used as a template and primers T7BOX-F (SEQ ID NO:55) and T7BOX-R (SEQ ID NO:56) were used to amplify the DE3 fragment (LacI-LacUV5-LacO-T7RNAP); (5) the above fragments were purified and connected to transform the host MFD-λ by homologous recombination method. If the clones were correctly sequenced, the targeting plasmid and the donor strain MFD-Vn-LdnsR-T7RNAP-LacIQ-mob-aadA-P15 were obtained.

[0124] Both plasmid vectors were constructed according to conventional molecular biology techniques and cloned into the host MFDλ strain, thus obtaining strains MFD-pTETsacB-cas9-Vndns-sgRNA-Vpori-Kan-mob and MFD-Vn-LdnsR-T7RNAP-LacIQ-mob-aadA-P15.

[0125] The donor strain MFD-pTETsacB-cas9-Vndns-sgRNA-Vpori-Kan-mob and the recipient strain Vn were cultured to the logarithmic phase, and the OD 6001.0, and both were washed twice with culture medium to eliminate residual antibiotic interference; then the ligation experiment was performed according to the optimized ligation steps in Example 2, and the Vn-pTETsacB-cas9-Vndns-sgRNA-Vpori-Kan-mob strain clone was obtained the next day. After the sequencing was correct, Vn-pTETsacB-cas9-Vndns-sgRNA-Vpori-Kan-mob was used as the recipient bacteria to ligate with the donor bacteria MFD-Vn-LdnsR-T7RNAP-LacIQ-mob-aadA-P15 again. The ligation steps were referenced to the optimized steps and ligation ratios in Example 2 to obtain the engineered strain Vn-pTETsacB-cas9-Vndns-sgRNA-Vpori-Kan-mob / LdnsR-T7RNAP-LacIQ-mob-aadA-P15, named Vn#1.

[0126] The engineered strain Vn#1 was inoculated into TSB liquid medium and cultured until OD 600 0.6, add 200ng / mL anhydrotetracycline to induce overnight. Dilute the appropriate multiples and apply to TCBS solid plates containing 150μg / mL kanamycin and 200ng / mL anhydrotetracycline, incubate at 37℃ overnight, pick 6 clones for PCR identification the next day, use primers dns-aR-R (SEQ ID NO: 57) and T7R-S (SEQ ID NO: 58) ( Fig.12 ) PCR molecular identification was performed and the expected amplified band size was about 3200bp.

[0127] The control group and samples 4, 5, and 6 did not amplify the expected band at 3200 bp, while samples 1, 2, and 3 obtained the expected band ( Fig.13 ), the band was purified and sent for sequencing. The results showed that the T7RNAP box (DE3 sequence) indeed replaced the original site of the dns gene, achieving site-specific insertion of the T7RNAP box (DE3 sequence), with an overall positive rate of about 50%. The successful integration of the T7RNAP box into the Vn genome can lay the foundation for the subsequent use of pet series vectors or T7 promoters.

[0128] Example 9 Plasmid Ablation

[0129] After successful knockout of the Vp32 endA gene in Example 8 and successful replacement of the Vndns gene with DE3 in Example 9 have been confirmed by PCR and sequencing, the cas9 plasmid and the plasmid providing homologous targeting still remain in the cell. The residual plasmids in the cell need to be cleaned up to achieve true traceless and repeated use.

[0130] The Cas9 plasmid carries the sacB suicide gene, which can be lost by subculturing in TSB medium containing 5% sucrose. The homology arm targeting plasmids of R6K or p15 replicon engineering are unstable in wild Vibrio, and can be lost by subculturing in an antibiotic-free medium. The specific process is as follows:

[0131] The plasmid-carrying Vp32△endA (i.e., the strain after endA knockout in Example 8) and Vn(DE3)△dns strain (i.e., the strain after DE3 replacement in Example 9) were inoculated into TSB liquid culture medium containing 5% sucrose, and the culture was shaken at 37°C and 200 rpm overnight and passaged 2 to 4 times. Finally, the bacterial solution was gradiently diluted to an appropriate multiple, and spread on TSB antibiotic-free solid plates containing 5% sucrose, respectively, and incubated in a 37°C incubator overnight. The plate clones were numbered every other day and each clone was transferred to TSB liquid culture medium containing 150 μg / mL of kanamycin and 150 μg / mL of spectinomycin, and shaken at 37°C and 200 rpm overnight. When the clones could not grow in the TSB culture medium containing both antibiotics, it indicated that the plasmid was completely removed, and Vp32△endA and Vn(DE3)△dns strains without exogenous plasmids were obtained, which can be used for subsequent further gene editing.

[0132] Example 10

[0133] The inventors of the present invention have attempted to construct a TfoX autoinduction system in wild Vibrio parahaemolyticus to achieve efficient transformation of DNA or plasmids. However, due to the large differences in the genetic background of individual hosts, the successful case in Vibrio natrii did not succeed in Vibrio parahaemolyticus. The specific scheme is as follows: (1) First, the present invention constructs a TfoX gene expression plasmid pTac-LacO-VcTfox-p15-mob-cm by conventional molecular biological means, and the spectrum is shown in FIG. Fig.14 , TfoX is derived from Vibrio cholerae, driven by the pTac promoter and regulated by IPTG induction; (2) the plasmid pTac-LacO-VcTfox-p15-mob-cm is then transformed into the host MFDλ Escherichia coli host by conventional heat shock method to obtain the donor strain MFD-pTac-LacO-VcTfox-p15-mob-cm; (3) the donor bacteria MFD-pTac-LacO-VcTfox-p15-mob-cm is conjugated with the recipient bacteria Vp32 and Vp44 through the bacterial conjugation step of Example 2, and the conjugated mixed bacteria are spread on a plate containing 5 μg / mL TCBS and cultured in a 37°C incubator overnight; (4) the clones are selected and cultured every other day and sent to Genewise for sequencing.

[0134] The results showed that all cloned TfoX genes were lost, indicating that the TfoX protein was toxic to wild Vibrio hosts Vp32 and Vp44. Therefore, TfoX from Vibrio cholerae is not suitable for the preparation and transformation of wild Vibrio parahaemolyticus autoinduction competent cells.

[0135] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A traceless editing system for Vibrio, characterized in that: The scarless editing system consists of a dual-plasmid CRISPR / Cas9 system, including a Cas9 expression plasmid and a homologous targeting plasmid.

2. The traceless editing system according to claim 1, characterized in that: The Cas9 expression plasmid includes the following elements: Cas9 and gRNA expression cassettes, sacB suicide gene, replicon, resistance gene and Mob element; Preferably, the replicon is Vpori; Preferably, the resistance gene is the kanamycin resistance gene Kan.

3. The seamless editing system according to claim 1, characterized in that: The homologous targeting plasmid comprises the following elements: a replicon, a resistance gene, a Mob element and a DNA fragment for homologous recombination; Preferably, the replicon in the homologous targeting plasmid is compatible with the replicon in the Cas9 expression plasmid; Preferably, the resistance gene of the homologous targeting plasmid is the spectinomycin resistance gene aadA; Preferably, when the DNA fragment of homologous recombination is used for knock-in / replacement, it is upstream homology arm-insertion fragment-downstream homology arm, and when the DNA fragment of homologous recombination is used for knock-out, it is upstream homology arm-downstream homology arm.

4. The seamless editing system according to claim 2, characterized in that: The Cas9 expression plasmid also includes the acrIIA4 gene that is resistant to CRISPR protein.

5. The seamless editing system according to claim 3, characterized in that: The N-terminus of the upstream homology arm and the C-terminus of the downstream homology arm of the homology targeting plasmid also contain target sites recognized by the Cas9-gRNA complex, and linearized homology targeting fragments will be provided after the target sites are cut.

6. Use of the scarless editing system according to any one of claims 1 to 5 in Vibrio genome editing.

7. A Vibrio genome editing engineered strain, comprising the scarless editing system according to any one of claims 1 to 5.

8. The method for constructing the Vibrio genome editing engineered strain according to claim 7, comprising the step of transforming the Cas9 expression plasmid and the homologous targeting plasmid described in any one of claims 1 to 5 into a host Vibrio cell by bacterial conjugation; Preferably, the bacterial conjugation method comprises the following steps: (1) cloning the Cas9 expression plasmid and the homologous targeting plasmid into the Escherichia coli host, respectively, to obtain donor bacteria containing the Cas9 expression plasmid and donor bacteria containing the homologous targeting plasmid; (2) mixing the donor bacteria containing the Cas9 expression plasmid with Vibrio, performing conjugation transformation on a solid medium containing DAP, collecting the bacteria, coating them on a TCBS plate containing kanamycin, and culturing them to obtain the first engineered strain; (3) mixing the donor bacteria containing the homologous targeting plasmid with the first engineering strain, performing conjugation transformation on a solid medium containing DAP, collecting the bacteria, coating them on a TCBS plate containing spectinomycin, and culturing them to obtain a Vibrio genome editing engineering strain; Preferably, the OD of the donor bacteria and Vibrio containing the Cas9 expression plasmid in (2) is 600 Both are 0.2 to 1.0, and the ratio between the two is (1 to 9):1; Preferably, the OD of the bacterial solution of the donor bacteria containing the homologous targeting plasmid and the first engineering strain in (3) is 600 Both are 0.2~1.0, and the ratio between the two is (1~9):

1.

9. A method for scarless editing of Vibrio genome, comprising the following steps: Activating the genome-edited strain of Vibrio according to claim 7 or 8, and applying it on a TCBS solid plate containing kanamycin and anhydrotetracycline for culture, thereby obtaining the gene-edited Vibrio; Preferably, the activation comprises inoculating the Vibrio genome editing engineered strain into a TSB liquid culture medium containing anhydrotetracycline to activate and induce homologous recombination.

10. The method for seamlessly editing the Vibrio genome according to claim 9, characterized in that: The Vibrio genome scarless editing method also includes a plasmid removal step; Preferably, the plasmid removal step comprises: subculturing the cultured Vibrio in a culture medium containing sucrose, spreading the bacterial solution on an antibiotic-free TCBS plate, picking a strain clone, and inoculating it into a culture medium containing kanamycin and spectinomycin for cultivation; if the strain does not grow in the culture medium containing kanamycin and spectinomycin, it indicates that the exogenous plasmid in the Vibrio has been completely removed.

Images