Yeast whole genome integration kit and application thereof

Abstract

The invention discloses a yeast whole genome integration kit and application thereof. The yeast whole genome integration kit comprises mixed yeast competent cells, CRISPR (clustered regularly interspaced short palindromic repeats) editing plasmids and a linear donor plasmid vector, the mixed saccharomycetes competent cells are competent cell materials formed by independently culturing and mixing various genotype strains of a yeast single-gene knockout library; the CRISPR editing plasmid has a double-site cutting function in a yeast single-gene knockout library KanMX region or other general sequences; the linearized donor plasmid vector comprises a double cleavage site and a homologous arm sequence. According to the yeast whole genome integration toolkit disclosed by the invention, heterologous genes or heterologous pathways can be respectively integrated to each gene locus position in a whole genome range of saccharomyces cerevisiae only by using two plasmid materials, and the current single integration flux of the yeast can be improved to thousands from dozens of yeast; and the flux and convenience of genetic modification of the saccharomyces cerevisiae are greatly improved.

Description

Technical Field

[0001] The present application relates to the field of synthetic biotechnology, and mainly to a yeast whole genome integration toolkit and its application. Background Art

[0002] Genetic engineering, metabolic engineering or synthetic biology, by heterologously integrating and expressing a single functional gene of interest or a synthetic metabolic pathway composed of multiple genes into a base bacterium (Escherichia coli, yeast, etc.), can use cell factories to synthesize products of interest such as proteins, drugs and chemicals with economic value. Selecting appropriate regulatory sequences (promoters, terminators, 5' translation regulatory sequences, 3' translation regulatory sequences and enhancers, etc.) for the gene sequence to be expressed and the integration position in the genome, as well as optimizing the appropriate genotype background (knockout of certain genes) or metabolic background are common problems faced by all related fields, and have also become an important bottleneck restricting the optimization efficiency of cell factories. Although there are methods for testing and optimizing the expression of heterologous genes or pathways by replacing promoters, terminators and regulatory sequences of different strengths, the elements tested are only a few types in the genome, and the effect is relatively limited, and the production potential of cells cannot be fully tapped. Despite decades of research, in the field of biomanufacturing, the potential of metabolic engineering still has a lot of room for improvement, and production capacity and efficiency are still not high.

[0003] Existing integration tools for the whole genome have their own limitations. For example, although MAGE technology can perform integration tests on about 100 sites in the whole genome, it can only achieve the integration or deletion of heterologous sequences less than 30 bp, which is far from enough for the integration needs of heterologous genes of 1000 bp or heterologous pathways of tens of k bp. At present, people still lack the ability to integrate a heterologous gene (or pathway) of interest into various locations of the genome to test the effects of regulatory sequences, position effects, genotype background and other factors at various locations of the genome on the function of the heterologous gene (or pathway) and thus screen the best expression conditions that are most suitable for the heterologous gene (or pathway). Similar problems also exist for the whole genome integration editing of the eukaryotic organism Saccharomyces cerevisiae. Taking MAGIC technology as an example, it can only achieve sequence deletion of tens of bp, and it is also necessary to design and synthesize expensive targeted primer libraries. Taking the most common CRISPR method as an example, it can only be done by individually designing and synthesizing the corresponding gRNA (at least 6,000 kinds), and at the same time designing and constructing the upstream and downstream homologous arms of the gene position to be integrated for the heterologous gene (at least 6,000 kinds), and then using a high-throughput mechanical operation platform for batch operations. This method is almost impossible to implement in reality, requiring huge synthesis and time costs (more than 2 months of construction time), as well as a lot of manpower and material resources, and expensive high-throughput batch operation machinery and equipment as hardware support. These bottlenecks greatly limit the integration work in yeast across the entire genome, limiting its application in scientific research and industry.

[0004] Therefore, it is of great significance to develop efficient genome-wide high-throughput integrated genetic toolkits to achieve the above goals. Summary of the invention

[0005] In view of the technical problem in the prior art that it is difficult to integrate heterologous genes (or pathways) into different loci of the yeast genome to test and screen the best expression regulatory elements, the present application proposes a yeast genome integration toolkit and its application.

[0006] According to one aspect of the present invention, a yeast whole genome integration toolkit is proposed, comprising: mixed yeast competent cells, CRISPR editing plasmids and linearized donor plasmid vectors; the mixed yeast competent cells are competent cell materials prepared by culturing each genotype strain of a yeast single gene knockout library separately and then mixing them; the CRISPR editing plasmid has a double-site cutting function in the KanMX region of the yeast single gene knockout library or other universal sequences; the linearized donor plasmid vector contains double cutting sites and homology arm sequences.

[0007] Different from the operation of transforming each strain of the yeast knockout set (YKO) separately, the present invention cultivates strains of each genotype of the YKO library separately and then mixes them in a certain proportion to prepare competent cell materials with high transformation efficiency, so as to overcome the growth differences between different strains and improve the coverage of the integrated library (capable of covering 90% of the yeast genome).

[0008] Different from the traditional single-cut editing method, the present invention uses a CRISPR editing strategy with a double-cut scheme to perform targeted double-cutting on the common position of the genome to be integrated, which can increase the integration success rate from about 50% to nearly 100%.

[0009] In addition, the present invention uses a dual-plasmid transformation editing strategy of high-quality donor plasmid and CRISPR editing plasmid, which can improve the efficiency of library transformation, thereby improving the editing efficiency and coverage of the library.

[0010] Preferably, a KanMX expression frame is integrated into the gene knockout position of each strain in the yeast single gene knockout library. As an effective screening marker, the KanMX expression frame can improve the efficiency and accuracy of gene knockout, thereby achieving high-throughput analysis of gene function and facilitating subsequent experimental research.

[0011] Preferably, the CRISPR editing plasmid comprises a yeast multi-copy plasmid backbone 1, a CRISPR editing protein expression frame and a dual-site gRNA expression frame targeting the KanMX region of the yeast single gene knockout library or other universal sequences.

[0012] Further preferably, the yeast multi-copy plasmid backbone 1 comprises 2μori and a selection marker.

[0013] Preferably, the sequence of the CRISPR editing plasmid is shown as SEQ ID NO.1.

[0014] Preferably, the linearized donor plasmid vector further comprises a yeast multi-copy plasmid backbone 2; the number of homology arm sequences is 2, and the length of the homology arm sequence is 20-60 bp; the double cleavage site is located between the homology arm sequence and the yeast multi-copy plasmid backbone. The 20-60 bp homology arm can minimize the effect of residual sequences on the function of heterologous expression genes while ensuring the efficiency of homologous recombination.

[0015] Further preferably, the double cleavage site sequence is consistent with the targeted cleavage sequence; the homology arm sequence is consistent with the sequences on both sides of the universal sequence of the integration position. This design is conducive to integrating the sequence to be integrated into the corresponding genomic position through homologous recombination.

[0016] Further preferably, the yeast multicopy plasmid backbone 2 includes 2μori and a screening marker. By using a plasmid containing 2μori and a screening marker, efficient replication and stable delivery of the plasmid in the recipient cell can be ensured, and the successfully transfected cells can be quickly screened out by the screening marker, thereby improving the experimental efficiency and accuracy.

[0017] Further preferably, the sequence of the yeast multi-copy plasmid backbone 2 is as shown in SEQ ID NO.2.

[0018] According to the second aspect of the present invention, an application of a yeast whole genome integration toolkit is proposed, including the fields of expression optimization of heterologous genes or metabolic synthesis pathways, metabolic engineering, fermentation engineering and specific functional chassis construction optimization.

[0019] Compared with the prior art, the beneficial effects of this application are as follows:

[0020] (1) The present application develops an efficient yeast whole genome integration toolkit, which enables the integration of heterologous genes or heterologous pathways into various loci within the whole genome of Saccharomyces cerevisiae using only two plasmid materials, thereby obtaining a yeast library containing genes individually integrated into different loci for subsequent screening tests;

[0021] (2) This application can shorten the time for the construction of the entire integrated library to within 1 week by optimizing the construction and transformation process, and does not require any special, complex high-throughput mechanical operation platform, and can achieve the above purpose only through conventional molecular cloning hardware conditions;

[0022] (3) In terms of technical indicators, the technical solution of the present application can increase the current single integration throughput of yeast from a dozen to several thousand, achieving a leap of 2 orders of magnitude. It can greatly improve the throughput and convenience of genetic modification of brewer's yeast, and is conducive to the subsequent whole-genome screening of heterologous gene integration. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings are included to provide a further understanding of the embodiments and are incorporated into and constitute a part of this specification. The accompanying drawings illustrate the embodiments and are used together with the description to explain the principles of the present invention. It will be easy to recognize other embodiments and many expected advantages of the embodiments because they become better understood by reference to the following detailed description. The elements of the drawings are not necessarily to scale with each other. The same reference numerals refer to corresponding similar parts.

[0024] Figure 1 A sequence structure map of the positions of the knockout genes in a yeast single gene knockout library according to a specific embodiment of the present invention is shown;

[0025] Figure 2A CRISPR editing plasmid map according to a specific embodiment of the present invention is shown;

[0026] Figure 3 A linearized donor plasmid vector map according to a specific embodiment of the present invention is shown;

[0027] Figure 4 A schematic diagram showing the editing process of integrating the whole genome integration toolkit into the KanMX region of the YKO library according to a specific embodiment of the present invention. DETAILED DESCRIPTION

[0028] The present application will be further described in detail below in conjunction with the accompanying drawings and embodiments. It is to be understood that the specific embodiments described herein are only used to explain the relevant invention, rather than to limit the invention. It should also be noted that, for ease of description, only the parts related to the relevant invention are shown in the accompanying drawings.

[0029] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present application will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0030] In a specific embodiment, a yeast whole genome integration kit includes mixed yeast competent cells, CRISPR editing plasmids and linearized donor plasmid vectors. Figure 1 It is the sequence structure map of the knockout gene position of the yeast single gene knockout library, such as Figure 1 As shown, a KanMX expression cassette was integrated into the gene knockout position of each strain. For detailed CRISPR editing plasmid map, see Figure 2 , CRISPR editing plasmid includes: 1) yeast multi-copy plasmid backbone 1 (containing 2μori and selection marker); 2) CRISPR editing cutting protein expression frame (taking Cas9 protein as an example); 3) dual-site gRNA expression frame targeting the KanMX region of the YKO library or other universal sequences. For details of the linearized donor plasmid vector map, see Figure 3 The linearized donor plasmid vector includes: 1) a yeast multicopy plasmid backbone 2 (containing 2μori and a selection marker); 2) two homology arm sequences (HR1 and HR2) with a length of 20-60bp; 3) two cutting sites between the homology arm sequence and the plasmid backbone.

[0031] Figure 4 The whole genome integration toolkit of the present invention is integrated into the YKO library KanMX region editing process schematic diagram. In another specific embodiment, the specific steps of using a yeast whole genome integration toolkit in yeast whole genome editing are as follows:

[0032] 1. Construction of linearized donor plasmid

[0033] (1) Preparation of EGFP gene CDS insert fragment. The EGFP gene CDS sequence was amplified with primer pair F1 and R1, and the EGFP gene CDS insert fragment was prepared after gel excision and purification. F1: ATCCCCGGGTTAATGCTGGCATGAGCAAGGGCGAGGAGCT, R1: CGTTTTCGACACTGGATGGCGGCCTAaccatgatgatgatgatgatg.

[0034] (2) Construction of EGFP linear donor plasmid: The prepared EGFP gene CDS insert fragment and the linear vector fragment were used together to construct a plasmid using a homologous recombination kit, and then transformed into E. coli to construct an EGFP linear donor plasmid.

[0035] 2. Yeast transformation

[0036] (1) Shake and incubate. a. Take a 250 mL conical flask and add 50 mL of YPD+G418+Kana medium. b. Take a tube of YKO mix from -80°C (the amount of bacteria in each tube of YKO mix is ​​10 OD), inoculate all of it into the YPD+G418+Kana medium, and rinse the EP tube with the medium to ensure that the YKO mix is ​​inoculated into the medium as much as possible. c. Place the conical flask in a constant temperature shaker at 30°C and incubate at 220 rpm for 6 h.

[0037] (2) After incubation for 6 hours, take 800uL of the bacterial solution to measure the OD (diluted by half) and record the OD value of the bacterial solution (0.8-1).

[0038] (3) ssDNA pretreatment: Take the homemade 2 mg / mL ssDNA and heat denature it in a 100°C metal bath for 5 min. Vortex mix and quickly place it in an ice box for 5 min. Repeat the treatment 3 times and place it on ice for later use.

[0039] (4) Collect the bacteria. Transfer the bacterial solution to a 50 mL centrifuge tube, balance it, and centrifuge it in a floor centrifuge at 4200 rpm for 1 min. After centrifugation, pour out the supernatant and gently resuspend it with 1 mL of 0.1 M LiOAc by pipetting. Transfer the resuspended bacterial solution to a labeled 1.5 mL EP tube, centrifuge it at 4200 rpm for 1 min, and discard the supernatant.

[0040] (5) Washing: Resuspend the cells in 1 mL of 0.1 M LiOAc. After sufficient resuspending, centrifuge at 4200 rpm for 1 min. After centrifugation, aspirate the supernatant.

[0041] (6) Resuspend in 0.1M LiOAc. Calculate the volume of 0.1M LiAc added based on the total bacterial volume a (total bacterial volume × bacterial OD) = 10a (so that the concentration of the resuspended bacterial solution = 100 OD / mL, and each transformation system can achieve 2 OD transformation) and set aside.

[0042] (7) Premix the DNA to be transformed. Generally, a complete YKO library transformation requires five transformation reactions, with 2OD cells used for each transformation reaction.

[0043] (8) Take 20uL of competent cells and place them in a PCR tube containing pre-mixed DNA to be transformed. Mix by gently pipetting.

[0044] (9) Prepare the transformation mix. For each transformation sample, prepare the MIX as follows:

[0045]

[0046] (10) Take 75.6uL of the transformation mix and add it to the premixed competent medium. Vortex thoroughly to mix. Centrifuge after mixing (open the lid immediately after closing it). Centrifuge the transformation mix on the PCR tube lid and vortex carefully again.

[0047] (11) Incubate in a PCR instrument for heat shock according to the procedure in the table below.

[0048] program temperature time Incubation 30℃ 35min Heat shock 42℃ 15min save 25℃ ∞

[0049] (12) Set a timer for 50 minutes.

[0050] (13) Prepare a plate, pour 8 to 10 glass beads into it, and mark it for later use.

[0051] (14) After the transformation is completed, mix the transformation mix and apply it evenly on each large plate.

[0052] (15) Place the coated plate in a plastic bag and incubate it at 30 °C for 72 h. Then, harvest the plate to complete the transformation.

[0053] The above describes the specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any technician familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed in the present application, which should be included in the protection scope of the present application. Therefore, the protection scope of the present application should be based on the protection scope of the claims.

[0054] In the description of the present application, the word 'comprising' does not exclude the presence of elements or steps not listed in the claims. The word 'a' or 'an' preceding an element does not exclude the presence of a plurality of such elements. The mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage. Any reference signs in the claims should not be construed as limiting the scope.

Claims

1. A yeast whole genome integration toolkit, characterized in that: include: Mix competent yeast cells, CRISPR editing plasmid, and linearized donor plasmid vector; The mixed yeast competent cells are competent cell materials prepared by culturing each genotype strain of the yeast single gene knockout library separately and then mixing them; The CRISPR editing plasmid has a dual-site cutting function in the KanMX region or other universal sequences of the yeast single gene knockout library; The linearized donor plasmid vector comprises a double cleavage site and homology arm sequences.

2. The yeast whole genome integration toolkit according to claim 1, characterized in that A KanMX expression frame is integrated into the gene knockout position of each strain in the yeast single gene knockout library.

3. The yeast whole genome integration toolkit according to claim 1, characterized in that The CRISPR editing plasmid includes a yeast multi-copy plasmid backbone 1, a CRISPR editing protein expression frame and a dual-site gRNA expression frame of the yeast single gene knockout library KanMX region or other universal sequences.

4. The yeast whole genome integration toolkit according to claim 3, characterized in that The yeast multi-copy plasmid backbone 1 includes 2μori and a selection marker.

5. The yeast whole genome integration toolkit according to claim 1, characterized in that The sequence of the CRISPR editing plasmid is shown in SEQ ID NO.

1.

6. The yeast whole genome integration toolkit according to claim 1, characterized in that The linearized donor plasmid vector also includes a yeast multi-copy plasmid backbone 2; the number of the homology arm sequences is 2, and the length of the homology arm sequences is 20-60 bp; and the double cleavage site is located between the homology arm sequences and the yeast multi-copy plasmid backbone 2.

7. The yeast whole genome integration toolkit according to claim 6, characterized in that The double cleavage site sequence is consistent with the targeted cleavage sequence; the homology arm sequence is consistent with the sequences on both sides of the universal sequence of the integration position.

8. The yeast whole genome integration toolkit according to claim 6, characterized in that: The yeast multi-copy plasmid backbone 2 includes 2μori and a selection marker.

9. The yeast whole genome integration toolkit according to claim 6, characterized in that: The sequence of the yeast multi-copy plasmid backbone 2 is shown in SEQ ID NO.

2.

10. A use of the yeast whole genome integration toolkit according to any one of claims 1 to 9, characterized in that: It includes the fields of expression optimization of heterologous genes or metabolic synthesis pathways, metabolic engineering, fermentation engineering and optimization of specific functional chassis construction.

Images