Method for increasing tanshinone content in salvia miltiorrhiza plant, gene editing vector and gene editing transformant

Abstract

The invention belongs to the technical field of gene engineering, and relates to a method for improving the content of tanshinone in a salvia miltiorrhiza plant, a gene editing vector and a gene editing transformant. The target knockout of the salvia miltiorrhiza GPPS gene exon based on the CRISPR / Cas9 system can be used for reducing secondary metabolites, such as monoterpene and some diterpenoid compounds except tanshinone, which are shunted from metabolic flow of a synthesis pathway of the tanshinone, positively regulating the expression of key enzyme genes for synthesizing the tanshinone, and improving the biosynthesis of the tanshinone in salvia miltiorrhiza plants; and no harm is caused to the growth and development of plants. The salvia miltiorrhiza plant material with high tanshinone content obtained by the technical scheme has important significance on gene editing breeding of salvia miltiorrhiza and production of rare natural secondary metabolites, and provides thoughts for breeding improvement of salvia miltiorrhiza.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and relates to a method for increasing the content of tanshinone in salvia miltiorrhiza plants, a gene editing vector and a gene editing transformant. Background Art

[0002] Salvia miltiorrhiza Bunge is a well-known and precious traditional Chinese medicine that has been shown to be effective in the treatment of cardiovascular diseases. This plant has also been developed into various preparations, such as the famous compound Danshen dripping pills, which are now widely used in many countries. There are two main types of bioactive compounds in Salvia miltiorrhiza, namely tanshinones and phenolic acids. As a type of diterpenoid compound, tanshinones mainly include cryptotanshinone (CPT), tanshinone IIA (Tan IIA), dihydrotanshinone (DHT) and tanshinone I (TanI), which are derived from the common five-carbon precursor isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP). These two substances are synthesized in two independent pathways, one is the 2-C-methyl-erythritol 4-phosphate (MEP) pathway located in the chloroplast, and the other is the mevalonate (MVA) pathway located in the cytoplasm. In the cytoplasm, IPP and DMAPP are sequentially catalyzed by GPPS and FPPS to produce FPP, which then further produces sterols, sesquiterpenes and other triterpenoids; GPPS synthase in Salvia miltiorrhiza plays an important role in the synthesis of terpenoids. In the plastid, IPP and DMAPP produce GPP under the catalysis of GPPS, which further synthesizes monoterpenes and some diterpenoids. The study of SmGPPS and its regulatory mechanism can provide theoretical basis and technical support for increasing tanshinone production and breeding high-yield Salvia miltiorrhiza varieties.

[0003] Due to the strong market demand, the biosynthesis of tanshinone faces many challenges, and the scarcity of salvia miltiorrhiza resources makes the tanshinone content in natural wild salvia miltiorrhiza not high. Therefore, it is urgent to develop a salvia miltiorrhiza plant with high tanshinone content, which will be an important attempt to cultivate high-yield and high-quality salvia miltiorrhiza varieties. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the shortcomings of existing plant genetic engineering technology and to further study the synthesis and regulation of plant secondary metabolites in Salvia miltiorrhiza. The present invention provides a method for increasing the content of tanshinone in Salvia miltiorrhiza plants by gene-targeted knockout of the GPPS gene of Salvia miltiorrhiza.

[0005] The present invention adopts the following technical solution:

[0006] A method for increasing the tanshinone content in salvia miltiorrhiza plants, inhibiting or destroying the expression of GPPS gene in salvia miltiorrhiza.

[0007] The synthesis of tanshinone in Salvia miltiorrhiza plants is an intricate multi-step process. Multiple metabolic pathways share the same precursors, metabolic intermediates participate in the synthesis of multiple end products, and some functions are unknown, which leads to the limited production of the target metabolite tanshinone. The present invention uses gene editing technology, especially knocking out the key gene SmGPPS in the competitive metabolic pathway, to reduce the dispersion of resources and find that the production of tanshinone can be greatly increased.

[0008] Preferably, all or part of the core sequence of the Salvia miltiorrhiza GPPS gene is knocked out by CRISPR / Cas9 technology.

[0009] Preferably, the target site for knocking out the Salvia miltiorrhiza GPPS gene using the CRISPR / Cas9 technology is located within the 1-300bp region downstream of the start codon of the Salvia miltiorrhiza GPPS gene, and the nucleotide sequence of the region where the target site is located is shown in SEQ ID NO.1.

[0010] Preferably, the target sites for knocking out the GPPS gene of Salvia miltiorrhiza using the CRISPR / Cas9 technology are: 5'-TGTGTAAAAGATGTTCACGG-3' (shown in SEQ ID NO.2) and 5'-TGAAGATCCACGAATCCATG-3' (shown in SEQ ID NO.3).

[0011] Preferably, the exon sequence of the GPPS gene of Salvia miltiorrhiza is first analyzed, and two sgRNAs are designed near the start codon to the downstream 300bp region through the CRISPR-P v2.0 webpage (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and a CRISPR / Cas9 gene editing vector containing the target sequences of these two sgRNAs is constructed. Then, the vector is introduced into the leaves of Salvia miltiorrhiza to be edited by Agrobacterium, and differentiation is induced to regenerate plants. Cas9-positive plants are screened, and homozygous edited plants are further obtained by cloning and sequencing the genome near the target site.

[0012] After knocking out the core sequence of the Salvia miltiorrhiza GPPS gene by the above method, there was no obvious change in the growth phenotype of the Salvia miltiorrhiza plants. Liquid chromatography-high-throughput triple quadrupole mass spectrometry (TQ-Absolute) measurement found that the contents of cryptotanshinone (CPT) and tanshinone IIA (Tan IIA) were significantly increased.

[0013] Preferably, the starting vector for constructing the CRISPR / Cas9 gene editing vector is pCAMBIA-1300.

[0014] As a preference, the method specifically comprises the following steps:

[0015] S1. Cultivate sterile Salvia miltiorrhiza seedlings;

[0016] S2. Design two sgRNA molecules complementary to the target gene to guide the Cas9 protein to target a specific gene site;

[0017] S3. Construct the target sequence of sgRNA and the expression vector of Cas9 protein into a gene editing vector for genetic transformation of plant cells;

[0018] S4. Use Agrobacterium-mediated genetic transformation to introduce the constructed gene editing vector into plant cells to produce transgenic Salvia miltiorrhiza plants;

[0019] S5. Extracting genomic DNA from T0 generation plants at the seedling stage, performing positive detection by PCR, and screening out successfully transformed plants;

[0020] S6. Use high-fidelity DNA polymerase to perform PCR amplification on the target genomic region, which should contain the gene fragment of the editing region and be of moderate length; the PCR product needs to go through a purification step to recover and purify the target DNA fragment to ensure that the target DNA fragment is of the correct size and has a single band; the purified target DNA fragment is subjected to Sanger sequencing to determine the efficiency of nuclease cutting. The sequencing results can determine whether editing exists and the type of editing;

[0021] S7. Cultivate the edited positive Salvia miltiorrhiza plants for more than 6 months, and take the roots of Salvia miltiorrhiza to determine the content of tanshinone (tanshinone IIA, cryptotanshinone, dihydrotanshinone and tanshinone I).

[0022] By implementing the above technical solution, the present invention has the following advantages:

[0023] The present invention uses gene editing technology to knock out the GPPS gene of Salvia miltiorrhiza to obtain an edited Salvia miltiorrhiza plant with no significant difference in phenotype from the wild type, but with a significant increase in the tanshinone content, thereby further verifying the function of the target gene and producing metabolites for breeding applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0025] Figure 1 Edit the sequencing peak diagram for the GPPS gene editing of Salvia miltiorrhiza;

[0026] Figure 2 These are the results of determination of tanshinone contents (tanshinone IIA, cryptotanshinone, dihydrotanshinone and tanshinone I) in Salvia miltiorrhiza GPPS gene-edited positive seedlings. DETAILED DESCRIPTION

[0027] The technical solutions in the embodiments of the present invention are described clearly and completely below through the accompanying drawings. The described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The experimental methods in the following examples where specific conditions are not specified are usually carried out under conventional conditions, such as those described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer; the materials, reagents, instruments and equipment used, unless otherwise specified, are commercially available. For example, the Agrobacterium tumefaciens EHA105 involved in this example was purchased from Shanghai Weidi Biotechnology Co., Ltd. with a product number of AC1013, and the plasmid pCAMBIA-1300 can be obtained through publicly available commercial channels, such as from Addgene, with a product number of 44183.

[0029] This embodiment relates to obtaining positive plants of GPPS gene knockout of Salvia miltiorrhiza, which specifically comprises the following steps:

[0030] Step 1: Cultivate sterile seedlings of Salvia miltiorrhiza

[0031] The seeds of Salvia miltiorrhiza were soaked in 0.1% mercuric chloride solution for 10 minutes, rinsed with sterile water for 3 to 4 times, and the surface moisture was dried. The seeds were evenly distributed on 1 / 2MS solid culture medium, cultured at 22°C and 16h / 8h (light / dark) light, and sterile Salvia miltiorrhiza seedlings were obtained after 3 weeks.

[0032] Step 2: sgRNA design

[0033] Copy the Salvia miltiorrhiza GPPS gene sequence to the sgRNA design website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Enter the base sequence of the selected homologous region and select the correct species and Cas9 protein. The sgRNA sequence information generated by the website includes the sgRNA sequence, PAM, specificity score, cutting efficiency score, and potential off-target specific information. The sgRNA corresponding editing target sequences are selected as: sgRNA1, TGTGTAAAGATGTTCACGG and sgRNA2, TGAAGATCCACGAATCCATG.

[0034] Step 3: Construction of gene editing vector

[0035]

[0036] Step 4: Stable genetic transformation and regeneration of Salvia miltiorrhiza plants

[0037] The constructed vector is introduced into the EHA105 Agrobacterium strain and activated. The leaves of Salvia miltiorrhiza are microwounded and then infected with Agrobacterium to introduce the foreign gene into the plant cells. The infected plant tissues are co-cultured and then sterilized to remove the Agrobacterium. A culture medium containing a selection agent is used to screen the callus containing the foreign gene, and then these tissues are promoted to differentiate and regenerate into plants.

[0038] Step 5: Extract genomic DNA from the regenerated Salvia miltiorrhiza seedlings, amplify using KOD enzyme PCR, run gel to observe whether the band sizes are consistent, and further screen out successfully transformed Salvia miltiorrhiza plants.

[0039] Table 1 PCR primer design

[0040] Primer name Primer sequence (5'-3') F1 atcggcctggacatcggcaccaac R1 cgtagccgttcttgctctggtcgaagaaaatc

[0041] Table 2 KOD enzyme PCR amplification reaction system

[0042] dNTPs 5μL 10×buffer 5μL <![CDATA[Mg 2+ ]]> 2μL Forward Primer 1μL Reverse Primer1 1μL Salvia miltiorrhiza genomic DNA 1μL KOD plus 1μL <![CDATA[ddH2O]]> 34μL

[0043] Step 6. Identification of positive seedlings with GPPS gene editing knockout in Salvia miltiorrhiza.

[0044] Specific primers are designed 200 to 300 bp upstream and downstream of each target site, and high-fidelity polymerase is used to amplify the fragment with the target sequence. After gel recovery and purification of the PCR product, Sanger sequencing is performed, and the sequencing results are analyzed using software. The sequencing results of the PCR product are compared with the wild-type sequence to determine the specific type of gene mutation, including single or multiple base pair deletions, substitutions, and insertions.

[0045] Table 3 PCR primer design

[0046] Primer name Primer sequence (5'-3') F2 ATGAGCCTTCTTGTTAATCCAC R2 CGACATGGTGTGGATCATCTCCACC

[0047] Step 7: Identification of target traits of Salvia miltiorrhiza GPPS-positive edited Salvia miltiorrhiza plants

[0048] The GPPS gene-positive Salvia miltiorrhiza plants were transplanted into a culture pot with a nutrient soil and vermiculite ratio of 1:1, cultured at 22°C, 16h / 8h (light / dark) light, and fertilizers were applied regularly. After 8 months, the roots of wild-type and GPPS gene-knockout Salvia miltiorrhiza plants were taken, vacuum freeze-dried and crushed, and tanshinones were extracted with anhydrous methanol. The contents of tanshinones (tanshinone IIA, cryptotanshinone, dihydrotanshinone and tanshinone I) were measured by liquid chromatography-high-throughput triple quadrupole mass spectrometry (TQ-Absolute). Figure 2The results showed that the tanshinone content in the salvia miltiorrhiza plants with the salvia miltiorrhiza GPPS gene knocked out was significantly increased, indicating that the knockout of the salvia miltiorrhiza GPPS gene reduced the tanshinone synthesis and metabolism to the plant monoterpenes and some diterpenoid compounds other than tanshinone, thereby increasing the tanshinone content in the salvia miltiorrhiza plants. It can be seen that the knockout of the salvia miltiorrhiza GPPS gene in the present invention can be used to increase the tanshinone content in the salvia miltiorrhiza plants.

[0049] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A method for increasing the content of tanshinone in salvia miltiorrhiza plants, characterized in that: Inhibit or destroy the expression of GPPS gene in Salvia miltiorrhiza.

2. The method for increasing the tanshinone content in salvia miltiorrhiza plants according to claim 1, characterized in that: The entire or partial sequence of the core sequence of the Salvia miltiorrhiza GPPS gene is knocked out by CRISPR / Cas9 technology.

3. A method for increasing the content of tanshinone in salvia miltiorrhiza plants according to claim 2, characterized in that: The target site for knocking out the GPPS gene of Salvia miltiorrhiza using the CRISPR / Cas9 technology is located within the 1-300bp region downstream of the start codon of the GPPS gene of Salvia miltiorrhiza, and the nucleotide sequence of the region where the target site is located is shown in SEQ ID NO.

1.

4. The method for increasing the tanshinone content in salvia miltiorrhiza plants according to claim 3, characterized in that: First, the exon sequence of the Salvia miltiorrhiza GPPS gene was analyzed, the sgRNA target sequence was designed, and a CRISPR / Cas9 gene editing vector containing the target sequences of these two sgRNAs was constructed. Then the vector was introduced into the leaves of Salvia miltiorrhiza to be edited, and differentiation was induced to regenerate plants. The regenerated plants were screened to obtain Cas9-positive plants, and the homozygous edited plants were further obtained by cloning and sequencing the genome near the target site.

5. The method for increasing the tanshinone content in salvia miltiorrhiza plants according to claim 4, characterized in that: The target sequences for knocking out the GPPS gene of Salvia miltiorrhiza using the CRISPR / Cas9 technology are: the sequence shown in SEQ ID NO.2 and the sequence shown in SEQ ID NO.

3.

6. A method for increasing the content of tanshinone in salvia miltiorrhiza plants according to claim 4, characterized in that: The starting vector for constructing CRISPR / Cas9 gene editing vector is pCAMBIA-1300.

7. The method for increasing the tanshinone content in salvia miltiorrhiza plants according to claim 4, characterized in that The specific steps include: S1. Cultivate sterile Salvia miltiorrhiza seedlings; S2. Design two sgRNA molecules complementary to the target gene to guide the Cas9 protein to target a specific gene site; S3. Construct the target sequence of sgRNA and the expression vector of Cas9 protein into a gene editing vector for genetic transformation of plant cells; S4. Use Agrobacterium-mediated genetic transformation to introduce the constructed gene editing vector into plant cells to produce transgenic Salvia miltiorrhiza plants; S5. Extract genomic DNA from T0 generation plants at the seedling stage, perform positive detection by PCR method, and screen out successfully transformed plants.

8. A gene editing vector for increasing the content of tanshinone in Salvia miltiorrhiza plants, characterized in that: The gene editing vector includes a target sequence encoding Cas9 endonuclease and a Salvia miltiorrhiza GPPS gene.

9. A gene editing vector for increasing the tanshinone content in Salvia miltiorrhiza plants according to claim 8, characterized in that: The target sequence C is: the sequence shown in SEQ ID NO.2 and the sequence shown in SEQ ID NO.

3.

10. A gene-edited transformant for increasing the tanshinone content in a Salvia miltiorrhiza plant, characterized in that: The gene-edited transformant includes a gene-edited transformant encoding a target sequence of a Cas9 endonuclease and a Salvia miltiorrhiza GPPS gene.

Images