Application of GSK3 family gene in regulation and control of synthesis of tomato pericarp naringenin chalcone and fruit color formation

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a tomato GSK3 family gene in regulation and control of synthesis of tomato pericarp naringenin chalcone and fruit color formation. The invention provides application of a GSK3 family gene SlBIN2 in regulation and control of synthesis of tomato pericarp naringenin chalcone and formation of fruit color. The nucleotide sequence of the SlBIN2 gene is shown as SEQ ID No: 1. The SlBIN2 positively regulates and controls synthesis of tomato peel naringenin chalcone and the size of a hue angle.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the application of tomato GSK3 family genes in regulating the synthesis of naringenin chalcone and the formation of fruit color in tomato peel. Background Art

[0002] Tomato (Solanum lycopersicum) is not only one of the most important vegetable crops in the world, but also a model system for studying fruit development and ripening. Thousands of structurally diverse metabolites have been found in tomato fruit, many of which have made significant contributions to the human diet. Modern tomato breeding focuses mainly on yield and resistance to biotic and abiotic stresses, often overlooking fruit quality, which is therefore a major goal of tomato improvement. Fruit color is one of the most important appearance qualities of tomatoes, which can be used to assess maturity and postharvest longevity, and is also a major factor influencing consumer purchasing decisions. Tomato fruit color is determined by the levels and ratios of different pigments, mainly due to the accumulation of carotenoids in the pulp and flavonoids in the peel, as well as the degradation of chlorophyll during ripening.

[0003] Flavonoids are a class of polyphenolic compounds produced by plant secondary metabolism and are widely found in food crops such as fruits and vegetables. In plants, flavonoids are usually involved in the coloring of fruits and flowers and protect plants from biotic and abiotic stresses. For the human body, flavonoids are the main components of foods such as vegetables and fruits. Due to their antioxidant, antibacterial and anti-inflammatory biological activities, they are now considered to be indispensable ingredients in various nutraceuticals, pharmaceuticals, medicines and cosmetic applications. Flavonoids play a vital role in determining the color of the peel and have been shown to have important functions for human health as favorable hydrophilic antioxidants. Among them, naringenin chalcone (NarCh) is one of the most abundant flavonoids in tomatoes. Its accumulation in the peel makes it yellow, combined with the red flesh, forming a tomato fruit with a red appearance. Some tomatoes have a pink appearance, which is due to the lack of accumulation of naringenin chalcone, resulting in a transparent peel.

[0004] The biosynthetic pathway of flavonoids starts with 4-coumaroyl-CoA produced by the phenylalanine pathway. Chalcone synthase (CHS) is the first enzyme involved in the flavonoid pathway and converts 4-coumaroyl-CoA to naringenin chalcone. Most of the biosynthetic genes involved in the flavonoid pathway have been identified, such as chalcone isomerase (CHI), flavonoid 3-hydroxylase (F3H), flavonoid 3'-hydroxylase (F3'H) and flavonol synthase (FLS). The flavonoid biosynthetic pathway is mainly regulated by R2R3-MYB, bHLH and WD40 transcription factors alone or in combination. In tomatoes, SlMYB12 is a major regulator of flavonoid biosynthesis, which can regulate the accumulation of yellow naringenin chalcone in the tomato fruit epidermis by widely targeting and activating the transcription of flavonoid biosynthetic genes.

[0005] In addition to regulatory genes, the biosynthesis of flavonoids is also affected by signals such as plant hormones, including auxin, gibberellins, and ethylene. In recent years, there have been reports on the regulation of flavonoid biosynthesis by the sterol plant hormone brassinosteroid (BR), but the specific regulatory mechanism and the gene function of its signal transduction pathway have not been fully verified. The GSK3 family gene SlBIN2 (Solyc07g055200) is a negative regulatory protein kinase in the BR signal transduction process, which can phosphorylate BZR1 and BES1 to negatively regulate BR signals. Its nucleotide sequence reference has been published in the paper https: / / doi.org / 10.1111 / jipb.13491 in the Accession numbers SlBIN2 (Solyc07g055200).

[0006] The invention of CN113957086A "Application of SlBIN2 gene in regulating tomato fruit ripening and carotenoid synthesis" informs: SlBIN2 negatively regulates tomato fruit ripening and carotenoid synthesis; SlBIN2 gene knockout promotes the accumulation of carotenoids in tomato fruits.

[0007] It should be noted that tomato fruit ripening and carotenoid synthesis have no correlation with the synthesis of naringenin chalcone.

[0008] Currently known flavonoid structural genes include: chalcone synthase gene (CHS), chalcone isomerase gene (CHI), flavonoid 3-hydroxylase gene (F3H), flavonoid 3'-hydroxylase gene (F3'H) and flavonol synthase gene (FLS). The flavonoid biosynthesis pathway and flavonoid accumulation are mainly controlled by the transcriptional network regulated by SlMYB12.

[0009] The hue angle refers to the angle of the color on the color wheel, also called hue; pure red is at 0 degrees, pure green is at 120 degrees, and pure blue is at 240 degrees. Compared with WT, the hue angle increases, and the tomato color is orange; the hue angle decreases, and the tomato color is red. Summary of the invention

[0010] The technical problem to be solved by the present invention is to provide a new use of the SlBIN2 gene---regulating the synthesis of naringenin chalcone and the formation of fruit color in tomato peel.

[0011] In order to solve the above technical problems, the present invention provides an application of a GSK3 family gene SlBIN2 in regulating the synthesis of naringenin chalcone in tomato peel and the formation of fruit color. The nucleotide sequence of the SlBIN2 gene is shown in SEQ ID No: 1.

[0012] As an improvement of the application of the present invention: SlBIN2 regulates (positively regulates) the synthesis of naringenin chalcone and the size of the hue angle in tomato peel.

[0013] As a further improvement of the application of the present invention: overexpression of the SlBIN2 gene promotes the synthesis of naringenin chalcone in tomato peel, and the hue angle increases significantly.

[0014] As a further improvement of the application of the present invention:

[0015] SlBIN2 promoted the accumulation of naringenin chalcone by promoting the expression of flavonoid regulatory genes and structural genes;

[0016] The flavonoid regulatory gene is SlMYB12, and the flavonoid structural genes are SlCHS1, SlCHS2, and SlF3'H.

[0017] In the present invention: the protein encoded by gene S1BIN2 has the amino acid sequence shown in SEQ ID NO:2.

[0018] The transgenic tomatoes obtained by the method of the present invention can improve the content of naringenin chalcone in tomato peel and the color of the peel. By measuring the content of naringenin chalcone, it is found that the SlBIN2 gene plays a positive regulatory role in the accumulation of naringenin chalcone in tomato peel. Through color difference analysis, it is found that compared with the wild type WT, the hue angle of the SlBIN2 gene overexpression material is significantly increased, while the hue angle of the SlBIN2 gene knockout material is significantly reduced. By overexpressing the tomato SlBIN2 gene, tomato materials with higher naringenin chalcone content are cultivated, which has good application prospects in improving the sensory and nutritional quality of tomatoes.

[0019] It should be noted that the SlBIN2 (Solyc07g055200) gene belongs to the GSK3 family transcription factor, and the mechanism of GSK3 family transcription factors regulating tomato naringenin chalcone and fruit color formation is still unclear. CN113957086A only informs that SlBIN2 negatively regulates tomato fruit ripening and carotenoid synthesis, but tomato fruit ripening and carotenoid synthesis have no correlation with the synthesis of naringenin chalcone, and the relationship with fruit color has not been reported.

[0020] Therefore, ordinary technicians in this industry cannot know whether SlBIN2 (Solyc07g055200) is associated with naringenin chalcone and fruit color formation. Therefore, the role of SlBIN2 in regulating tomato naringenin chalcone synthesis and fruit color formation has not been reported so far. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0022] Figure 1 is the naringenin chalcone content in the peel of SlBIN2 gene overexpression and gene-edited strains and wild-type tomatoes.

[0023] Figure 2 It is the expression level of flavonoid regulatory gene SlMYB12 and structural genes SlCHS1, SlCHS2, and SlF3'H in the peel of SlBIN2 gene overexpression and gene-edited strains and wild-type tomato.

[0024] Figure 3 The hue angle of the fruit skin of SlBIN2 gene overexpression and gene-edited strains and wild-type tomatoes at the red ripening stage. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0026] 1. Obtaining the full-length sequence of the tomato SlBIN2 gene:

[0027] Refer to SlBIN2 (Solyc07g055200) in the Accession numbers in the published paper https: / / doi.org / 10.1111 / jipb.13491.

[0028] The nucleotide sequence of the gene S1BIN2 is shown in SEQ ID No: 1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID No: 2.

[0029] 2. Construction of tomato SlBIN2 gene overexpression vector:

[0030] The construction of SlBIN2 overexpression vector, using pGWB17 as the final vector, constructs the pGWB17-SlBIN2 vector with CaMV35S recombinant overexpression promoter. Please refer to the published patent: CN113957086A "Application of SlBIN2 gene in regulating tomato fruit ripening and carotenoid synthesis".

[0031] The details are as follows: Use LR reaction to transfer the target fragment (i.e., the sequence described in SEQ ID No: 1) from the pQB-V3 initial vector to the pGWB17 final vector. Enzyme mix (Thermo Fisher) kit, the method is referred to the instructions in the kit. After the reaction, the pGWB17-SlBIN2 plasmid was transferred into the competent E. coli DH5α. The pGWB17 recombinant plasmid with the target fragment was screened by the coating method, and the colony PCR was used to screen and sequenced. The sequencing results were analyzed by DNAMAN software. Thus, the pGWB17-SlBIN2 vector (pGWB17-35S::SlBIN2) with the CaMV35S recombinant overexpression promoter was obtained.

[0032] 3. Construction of CRISPR / Cas9 vector for tomato SlBIN2 gene knockout:

[0033] Refer to the published patent: CN113957086A "Application of SlBIN2 gene in regulating tomato fruit ripening and carotenoid synthesis".

[0034] Specifically, the target sgRNA sequence for CRISPR / Cas9 editing was designed in the coding sequence of the SlBIN2 gene (SEQ ID NO: 1) using online professional software (http: / / crispr.mit.edu / ): 5'-CTGGGACCTCAGCACCATAA-3'; and the corresponding target primer sequences were synthesized at a biotechnology company: 5'-ATTGTTATGGTGCTGAGGTCCCAG-3' and 5'-AAACCTGGG ACCTCAGCACCATAA-3'. The target primers were annealed and connected to the intermediate vector AtU6-26-sgRNA-SK, and the plasmids that were positive for PCR verification and sequenced correctly were extracted, double-digested with Nhe I and SpeI, and the fragment of about 642 bp was cut from the gel after electrophoresis. The recovered fragment was the sgRNA cassette. The sgRNA cassette was then connected to the pCAMBIA1300-pYAO:Cas9 plasmid after Spe I digestion, and colony PCR identification was performed using the primer sequence on the binary vector. The correctly identified single clone was picked and expanded, and the plasmid was extracted. Sal I and Kpn I were used for restriction digestion verification. The plasmid with a digestion fragment length of approximately 670 bp was the CRISPR / Cas9 gene editing vector of SlBIN2.

[0035] 4. Study on the content of naringenin chalcone in transgenic tomato peel

[0036] The Ailsa Craig (AC) variety was used as the wild-type tomato, denoted as WT;

[0037] The pGWB17-SlBIN2 vector plasmid was transformed into Agrobacterium tumefaciens LBA4404 strain, and tomato cotyledons were infected. Tissue culture seedlings were obtained through callus induction, resistance induction differentiation and rooting culture, and positive transgenic plants were verified by PCR and RT-PCR. T2 generation seeds were sown on a kanamycin (50 mg / L) medium for germination, thereby obtaining SlBIN2 transgenic material SlBIN2-OE;

[0038] The CRISPR / Cas9 vector plasmid with tomato SlBIN2 gene knockout was transformed into Agrobacterium LBA4404 strain, and tomato cotyledons were used as explants and co-cultured with the bacterial solution to obtain callus tissue. The callus tissue was subjected to differentiation medium and rooting medium to obtain transgenic positive seedlings. PCR and RT-PCR were used to verify the positive transgenic plants, thereby obtaining the SlBIN2 transgenic material bin2.

[0039] The wild-type and SlBIN2 transgenic materials were planted in the same greenhouse at the Huajiachi Vegetable Base of Zhejiang University. The fruits reached the green ripe stage (MG) 35 days after the flowering period was marked. The top of the fruit turned red 3 days after the green ripe stage, which was the color breaking stage (B), and 7 days after the color breaking stage was the red ripe stage (B+7). The whole fruit peel samples were taken from the SlBIN2 gene overexpressing transgenic line SlBIN2-OE and the gene-edited line bin2 and the wild-type tomato WT when the fruits grew to the red ripe stage.

[0040] After grinding the peel sample with liquid nitrogen, about 1g of powder was extracted with 3ml of 50% methanol, ultrasonically extracted for 30min (power supply voltage 220V, working frequency 53kHZ, power consumption 350W, temperature 4℃), centrifuged at 12000rpm for 15min, and the supernatant was taken. Filtered with a 0.22μm nylon membrane filter and analyzed by HPLC. Flavonoids were analyzed on a Shimadzu high-performance liquid chromatograph using a SPD-M20A diode array detector and a C18 column (5μm particle size, 4.6mm x 250mm, Elite analytical instruments Co., Ltd., Dalian, China). The mobile phase was (A) water and (B) acetonitrile, and gradient elution was used. The elution gradient was: solution B 80%-80% (5min), solution B 80%-55% (15min), solution B55%-55% (6min), solution B 55% to B 0% (4min), solution B 0%-0% (5min), solution B 0%-80% (1min), solution B 80%-80% (9min). The flow rate was 1.0mL / min, the column temperature was 25℃, and the detection wavelength was 370nm. The content was calculated by external standard method using naringenin chalcone standard (Sigma, St Louis, MO, USA). The results are expressed in μg g -1 It is expressed in units of FW (fresh weight).

[0041] Naringenin chalcone content in tomato peels of SlBIN2 gene overexpression and gene-edited lines compared with wild-type tomato Figure 1 The results obtained were as follows: the naringenin chalcone content of the SlBIN2 gene overexpression strain was significantly higher than that of the wild type, while the naringenin chalcone content of the bin2 gene edited strain was significantly lower than that of the wild type. This indicates that the overexpression of the SlBIN2 gene promotes the accumulation of naringenin chalcone in tomato peel.

[0042] 5. Study on the expression of flavonoid genes in transgenic tomato peel

[0043] The peels of WT, SlBIN2-OE, and bin2 fruits were sampled at the color breaking stage, RNA was extracted, reverse transcribed into cDNA, and real-time fluorescence quantitative PCR was used to detect gene expression.

[0044] The primers corresponding to the flavonoid regulatory gene SlMYB12 were F: AGCTTGTGATAGTGCCATGGAA, R: CTCGAGTCTTGGCCATTCGATA;

[0045] The primers corresponding to the flavonoid structural gene SlCHS1 were F: GGCTTACATTCCACTTACTC, R: GAGAGTTCCAGTCAGATATACC;

[0046] The primers corresponding to the flavonoid structural gene SlCHS2 were F:TTAGCTGAGAACAACAAGGG, R:CCAACCATACTATCCAAATGAG;

[0047] The primers corresponding to the flavonoid structural gene SlF3′H were F: GCTTTAGATGACTTCCGCC, R: GTTCCTTCGATTCTCCAACTC;

[0048] The primers corresponding to the internal reference gene Actin are F: CCTCAGCACATTCCAGCAG, R: CCACCAAACTTCTCCATCCC.

[0049] Real-time fluorescence quantitative PCR was performed using the SYBR Green PCR Master Mix kit, with Actin as the internal reference gene. –ΔΔCT The relative expression of genes was calculated by real-time fluorescence quantitative PCR. The reaction system of real-time fluorescence quantitative PCR was 20 μL, including 10 μL of SYBRGreen Master Mix, 1 μL of upper and lower primers, and 8 μL of a mixture of template DNA and sterile ultrapure water. The reaction program was 95°C, 5 min; 95°C, 10 sec, 60°C, 30 sec, 40 cycles.

[0050] The results are as follows Figure 2 described. Figure 2 The results showed that the expression levels of flavonoid regulatory gene SlMYB12 and structural genes SlCHS1, SlCHS2, and SlF3'H increased significantly in SlBIN2-OE and decreased significantly in bin2. Figure 2 The following conclusions can be drawn: SlBIN2 can inhibit the accumulation of naringenin chalcone by suppressing the expression of flavonoid regulatory genes and structural genes.

[0051] Description: SlMYB12 is a regulatory gene of the flavonoid pathway, and SlCHS1, SlCHS2, and SlF3'H are structural genes of the flavonoid pathway, which all play a positive regulatory role in the accumulation of flavonoids.

[0052] 6. Research on the fruit color of genetically modified tomatoes

[0053] Color difference analysis was performed on tomato fruits of WT, SlBIN2-OE, and bin2 at the red ripe stage. The L, a, and b values ​​of the fruits were measured using a 3nh spectrophotometer (SN: 41000735). Color changes were evaluated by changes in hue angle, indicating color saturation. The hue angle value was calculated using the following formula: Hue angle = tan -1 (b / a)(a>0)or 180+tan -1 (b / a)(a<0).

[0054] The results are as follows Figure 3 According to Figure 3 It can be seen that the hue angle of SlBIN2-OE increased significantly, and the final OE line showed an orange phenotype.

[0055] In summary, SlBIN2 can improve tomato fruit color and positively regulate the synthesis of naringenin chalcone.

[0056] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Application of the GSK3 family gene SlBIN2 in regulating the synthesis of naringenin chalcone and the formation of fruit color in tomato peel, characterized in that: The nucleotide sequence of the S1BIN2 gene is shown in SEQ ID No:

1.

2. The use according to claim 1, characterized in that: SlBIN2 regulates the synthesis of naringenin chalcone and the size of the hue angle in tomato peel.

3. The use according to claim 1 or 2, characterized in that: Overexpression of the SlBIN2 gene promoted the accumulation of naringenin chalcone in tomato peel and increased the hue angle.

4. The use according to claim 3, characterized in that: SlBIN2 promoted the accumulation of naringenin chalcone by promoting the expression of flavonoid regulatory genes and structural genes; The flavonoid regulatory gene is SlMYB12, and the flavonoid structural genes are SlCHS1, SlCHS2, and SlF3'H.

Images