Application of cotton GhCaLB42 gene in regulation and control of cotton fiber development

Abstract

The invention discloses an application of a cotton GhCaLB42 gene in regulation and control of cotton fiber development. The invention discloses a recombinant expression vector. The recombinant expression vector contains sgRNA (small guide ribonucleic acid) editing sites sgRNA1 and sgRNA2; the nucleotide sequence of the sgRNA1 is as shown in SEQ ID NO: 14; the nucleotide sequence of the sgRNA2 is as shown in SEQ ID NO: 15. According to the invention, sgRNA targets are designed, the GhCaLB42 gene in cotton is knocked out by using a CRISPR / Cas9 gene editing technology, and the results show that the number of ovule epidermal cell protrusions in each strain of the GhCaLB42 gene knockout cotton is significantly less than that of WT wild type, and the length of mature fibers in each strain of the GhCaLB42 gene knockout cotton is significantly shorter than that of the WT wild type.

Description

Technical Field

[0001] The present invention relates to the field of molecular breeding technology, and in particular to cotton GhCaLB42 Application of genes in regulating cotton fiber development. Background Art

[0002] Cotton is an important economic crop and natural fiber material, but the fiber quality of most cotton varieties is between 27 and 29 mm, the cotton fiber quality is relatively single, and there are relatively few high-quality fiber varieties. Especially in recent years, with the annual expansion of the area of ​​mechanical cotton harvesting, the fiber quality of cotton has been damaged during processing. The improvement of cotton fiber quality has become one of the main research goals of cotton breeding. Therefore, it is necessary to use bioinformatics methods, combined with genetic engineering technology and molecular biology methods to explore and identify relevant functional genes that affect fiber development, and analyze their molecular mechanisms, so as to provide effective gene resources and new breeding materials for high-quality cotton breeding.

[0003] Cotton fiber is differentiated from a single cell in the outer epidermis of the ovule, and its development process can be divided into four overlapping periods, including initial differentiation (-3~2 DPA, Days post anthesis), cell elongation (1~20 DPA), secondary wall thickening (15~45 DPA), and dehydration maturity (40~50 DPA). The three developmental stages from initial differentiation to secondary wall thickening determine the yield and quality of cotton fiber. Among them, the initial differentiation stage determines the number of fibers on each ovule, and the formation stage of the primary wall and secondary wall determines the fiber length and strength.

[0004] The calcium-dependent lipid-binding domain (CaLB) or C2 domain is the second most abundant calcium regulatory domain after the EF-hand domain. It has a highly conserved structure, an eight-stranded, antiparallel β sandwich consisting of four overlapping chains, including about 130 residues. The CaLB protein family is widely involved in the regulation of plant growth and development. GhCaLB42 The expression of the gene can be regulated in cotton, providing a new breeding strategy for improving cotton fiber quality. Summary of the invention

[0005] The purpose of the present invention is to overcome the above-mentioned shortcomings of the prior art and provide a cotton GhCaLB42 Application of genes in regulating cotton fiber development.

[0006] The first object of the present invention is to provide a recombinant expression vector.

[0007] The second object of the present invention is to provide a recombinant genetically engineered bacterium.

[0008] A third object of the present invention is to provide a method for reducing cotton GhCaLB42 Use of genetically expressed agents to reduce cotton fiber length.

[0009] A fourth object of the present invention is to provide a method for reducing the length of cotton fibers.

[0010] A fifth object of the present invention is to provide a method for cultivating short-fiber cotton.

[0011] In order to achieve the above object, the present invention is implemented by the following scheme: In a first aspect, the present invention provides a recombinant expression vector, wherein the recombinant expression vector contains sgRNA editing sites sgRNA1 and sgRNA2; The nucleotide sequence of the sgRNA1 is shown in SEQ ID NO: 14; The nucleotide sequence of the sgRNA2 is shown in SEQ ID NO: 15.

[0012] The sgRNA target site is conducive to knockout GhCaLB42 Gene, used for the subsequent construction of gene editing vectors and cotton genetic transformation.

[0013] Further, the recombinant expression vector contains a tRNA-sgRNA1 complex and a gRNA scaffold-tRNA-sgRNA2 complex; The tRNA-sgRNA1 complex is connected to the sgRNA editing site sgRNA1, and the nucleotide sequence of the tRNA-sgRNA1 complex is shown in SEQ ID NO: 26; The gRNA scaffold-tRNA-sgRNA2 complex is connected to the sgRNA editing site sgRNA2, and the nucleotide sequence of the gRNA scaffold-tRNA-sgRNA2 complex is shown in SEQ ID NO: 28.

[0014] Preferably, the 3' end of the tRNA-sgRNA1 complex is connected to the 5' end of the gRNA scaffold-tRNA-sgRNA2 complex.

[0015] Furthermore, the recombinant expression vector is pRGEB32 -GhU6.9-NPTII The carrier is a backbone carrier.

[0016] Furthermore, the tRNA-sgRNA1 complex and the gRNA scaffold-tRNA-sgRNA2 complex are connected to pRGEB32 -GhU6.9-NPTII between the BsaI sites of the vector.

[0017] In a specific embodiment of the present invention, the tRNA-sgRNA1 complex and the gRNA scaffold-tRNA-sgRNA2 complex are connected to pRGEB32 -GhU6.9-NPTII pRGEB32 -GhCaLB42 Knockout plasmid. GhCaLB42 The bases of the At or Dt subgroup of the gene are inserted or deleted to achieve GhCaLB42 Gene knockout reduces cotton GhCaLB42 Gene expression levels.

[0018] The present invention constructs three gene-edited cotton plants, whose mutation sites are m3, m15 and m23 respectively. Among them, the mutation of the m3 site mutant occurred in the Dt subgroup, and there was a 2 bp base insertion in the sgRNA1 target region, specifically, there was a 2 bp base insertion at the 28th to 29th positions of the sequence shown in SEQ ID NO: 1, and no base mutation occurred in the sgRNA2 target region; the mutation of the m153 site mutant occurred in both the At and Dt subgroups, no base mutation occurred in the sgRNA1 target region, and there was a 247 bp base deletion in the sgRNA2 target region, specifically, there was a 247 bp base deletion at the 229th to 475th positions of the sequence shown in SEQ ID NO: 1; the mutation of the m233 site mutant occurred in the Dt subgroup, and there was a 222 bp base deletion in the sgRNA1 target region, specifically, there was a 222 bp base deletion from -158 bp upstream (promoter region) to the 64th position of the sequence shown in SEQ ID NO: 1, and no base mutation occurred in the sgRNA2 target region. The number of epidermal cell protrusions in the ovules of each gene-edited cotton plant was significantly less than that in the WT wild type, and the length of mature fibers was significantly shorter than that in the WT wild type.

[0019] In a second aspect, the present invention provides a recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium expresses the recombinant expression vector.

[0020] In a specific embodiment of the present invention, the pRGEB32 -GhCaLB42 The knockout plasmids were transformed into E. coli and / or Agrobacterium.

[0021] Furthermore, the pRGEB32 -GhCaLB42 The knockout plasmid was transformed into E. coli or the pRGEB32 was frozen by liquid nitrogen. -GhCaLB42 The knockout plasmid was transformed into Agrobacterium.

[0022] In a specific embodiment of the present invention, the Escherichia coli is Escherichia coli DH5α, and the Agrobacterium is Agrobacterium GV3101.

[0023] In a third aspect, the present invention provides a method for reducing cotton GhCaLB42 Use of a gene-expressed agent in reducing cotton fiber length; the cotton GhCaLB42 The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2; the reagent contains the recombinant expression vector or the recombinant genetic engineering bacteria.

[0024] GhCaLB42 The number of protrusions of ovule epidermal fiber cells in gene knockout cotton lines was significantly less than that in WT wild type, and the fiber length was significantly shorter than that in WT wild type. GhCaLB42 The gene plays a positive regulatory role in the initiation of cotton fiber development.

[0025] In a fourth aspect, the present invention provides a method for reducing the length of cotton fibers, GhCaLB42 The expression level of the gene shortens the length of cotton fibers.

[0026] Furthermore, the recombinant expression vector or the recombinant genetically engineered bacteria is used to reduce GhCaLB42 Gene expression level.

[0027] The recombinant expression vector or the recombinant genetic engineering bacteria can be used to GhCaLB42 The bases of the At or Dt subgroup of the gene are inserted or deleted to achieve GhCaLB42 Gene knockout, reducing GhCaLB42 Gene expression levels.

[0028] Furthermore, the pRGEB32 -GhCaLB42 The knockout plasmid was transformed into Agrobacterium, and the positive Agrobacterium single bacterial liquid was transferred into cotton recipients through hypocotyl-mediated transformation to screen for GhCaLB42 Gene knockout in cotton, reducing cotton fiber length.

[0029] In a specific embodiment of the present invention, the Escherichia coli is Escherichia coli DH5α, the Agrobacterium is Agrobacterium GV3101, and the cotton receptor may be Jin668.

[0030] In a fifth aspect, the present invention provides a method for cultivating short-fiber cotton, which reduces GhCaLB42 The expression level of the gene shortens the length of cotton fibers.

[0031] In a specific embodiment of the present invention, the recombinant expression vector or the recombinant genetically engineered bacteria is used to reduce GhCaLB42 Gene expression level.

[0032] Furthermore, the pRGEB32 -GhCaLB42 The knockout plasmid was transformed into Agrobacterium, and the positive Agrobacterium single bacterial liquid was transferred into cotton recipients through hypocotyl-mediated transformation to screen for GhCaLB42 Gene knockout in cotton, reducing cotton fiber length.

[0033] In a specific embodiment of the present invention, the Escherichia coli is Escherichia coli DH5α, the Agrobacterium is Agrobacterium GV3101, and the cotton receptor may be Jin668.

[0034] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses CRISPR / Cas9 gene editing technology to knock out the GhCaLB42 Gene, constructed three gene-edited cotton plants, whose mutation sites were m3, m15 and m23, and found GhCaLB42 The number of epidermal cell protrusions in the ovules of the knockout cotton lines was significantly less than that in the WT wild type. GhCaLB42 The mature fiber length of each gene knockout cotton line was significantly shorter than that of the WT wild type. GhCaLB42 The gene plays a positive role in regulating cotton fiber development and reducing GhCaLB42 Gene expression is beneficial to the cultivation of short-fiber cotton and provides important genetic resources and new breeding materials for the cultivation of high-quality cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 for GhCaLB42 Analysis of gene expression in various tissues and organs and cotton fiber stages. a is the transcriptome expression pattern; b is the qRT-PCR identification result.

[0036] Figure 2 for GhCaLB42 Gene amplification electrophoresis detection, M: DL5000 DNA marker (DNA molecular weight marker).

[0037] Figure 3 For overexpression GhCaLB42 Arabidopsis thaliana transgenic lines GhCaLB42-OE RT-PCR and qRT-PCR analysis. GhCaLB42-OE RT-PCR detection of full-length cDNA (504 bp), M: D2000 DNA marker (DNA molecular weight marker); b is three T3 generations GhCaLB42-OE qRT-PCR analysis. Three biological replicates, data represent mean ± SD, **P < 0.01. WT: wild-type Col-o ecotype Arabidopsis; GhCaLB42-OE : Overexpression GhCaLB42 Transgenic Arabidopsis lines.

[0038] Figure 4 For overexpression GhCaLB42 Arabidopsis thaliana transgenic lines GhCaLB42-OE Observation and determination of the length and density of leaf epidermal hairs. GhCaLB42-OE Compared with the WT wild-type leaf and leaf epidermal hair phenotypes, the scale bar for leaves = 1 cm, the scale bar for leaf trichomes = 500 μm; b is GhCaLB42-OE Determination of leaf epidermal hair length compared with WT wild type; c is GhCaLB42-OE Determination of leaf epidermal hair density compared with the WT wild type. The significance of the difference was analyzed by two-tailed t-test. The data represent the mean ± SD, * P<0.05， **P<0.01. WT: wild-type Col-o ecotype Arabidopsis; GhCaLB42-OE : Overexpression GhCaLB42 Transgenic Arabidopsis lines.

[0039] Figure 5 For overexpression GhCaLB42 Arabidopsis thaliana transgenic lines GhCaLB42-OE Observation and identification of root length, root hair length and density. GhCaLB42-OE Compared with the root length of the WT wild type, scale bar = 1 cm; b is GhCaLB42- OE Root length determination with WT wild type; c is GhCaLB42-OE Observation of root hair phenotype compared with the wild type, scale bar = 50 μm; d is GhCaLB42-OE Compared with the root hair length of WT wild type; e is GhCaLB42-OE Root hair density was measured compared with that of WT wild type. The significance of the difference was analyzed by two-tailed t-test. Error bars represent mean ± SD. * P<0.05， **P<0.01. WT: wild-type Col-o ecotype Arabidopsis; GhCaLB42-OE : Overexpression GhCaLB42 Transgenic Arabidopsis lines.

[0040] Figure 6 For T0 generation GhCaLB42 Knockout cotton Cas9 Gene identification. M: D2000 DNA marker (DNA molecular weight marker), the numbers represent the numbers of each individual strain; CK: CRISPR / Cas9 gene editing empty plasmid (pRGEB32 -Cas9 ); WT: wild type Jin668 cotton.

[0041] Figure 7 for GhCaLB42 Gene knockout inhibits the initiation and elongation of cotton fiber development. GhCaLB42 Electron microscopic observation of initial fiber cells in the ovule epidermis of gene knockout cotton and wild-type Jin668 cotton at 0 DPA (upper row scale bar = 1 mm, lower row scale bar = 100 μm); b is GhCaLB42 Observation of mature fiber length of gene knockout cotton and wild-type Jin668 cotton (scale = 1 cm); c is GhCaLB42 Statistical analysis of the number of initiating fiber cells in the ovule epidermis of gene knockout cotton and wild-type Jin668 cotton at 0 DPA (at least 10 ovules were observed for each line); d is GhCaLB42 Statistical analysis of mature fiber length of knockout cotton and wild-type Jin668 cotton (at least 30 seed fibers were measured for each line). The t-test was used to analyze the significance of the difference. Data represent mean ± SD, * P<0.05， **P<0.01. DETAILED DESCRIPTION

[0042] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0043] Example 1 Cotton GhCaLB42 Analysis of gene expression patterns 1. Experimental Methods 1. Download RNA-seq (RNA transcriptome sequence) data of cotton tissues and fiber development stages from the website of the National Center for Biotechnology Information (NCBI) (https: / / www.ncbi.nlm.nih.gov / ), whose accession number is PRJNA248163. Extract cotton roots, stems, leaves, bracts, petals, stamens, pistils, calyx, and ovules at -3, -1, 0, 1, and 3 DPA (day post anthesis) and fiber data at 5, 10, 20, and 25 DPA. GhCaLB42 FPKM values ​​(fragments per kilobase of transcript per million mapped reads) of genes in each tissue, organ and fiber development stage.

[0044] GhCaLB42 The nucleotide sequence of the gene is shown in SEQ ID NO: 1, with a total length of 504 bp; GhCaLB42 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2, with a total length of 167 aa.

[0045] 2. (1) Using TM-1 cotton, a genetic standard line of upland cotton, as the material, the flowers of TM-1 cotton were marked on the day of flowering (0 DPA), and the ovules of TM-1 cotton at -3, -1, 0, 1, 3 and 5 DPA and the fibers at 7, 10, 15, 20 and 30 DPA were collected in sequence; tissue samples of TM-1 cotton at different developmental stages were also collected, including roots, stems and true leaves at the seedling stage (two leaves and one heart stage), and petals, stamens, pistils, calyx and bracts at the mature stage, as samples to be tested. All samples to be tested were immediately frozen in liquid nitrogen and stored in a -80℃ refrigerator for future use.

[0046] (2) Extract RNA from the above samples and convert them into cDNA for qRT-PCR analysis.

[0047] (3) QUR The internal reference gene was further identified by qRT-PCR. GhCaLB42 Changes in gene expression levels in different tissues and fiber development stages of TM-1 cotton.

[0048] The cDNA of each sample to be tested was diluted 5 times and used as a template for qRT-PCR detection on the Applied Biosystems QuantStudio5 Real-Time PCR System.

[0049] The primers used for qRT-PCR were GhCaLB42 qF, GhCaLB42 qR, QUR qF and QUR qR.

[0050] GhCaLB42 qF: 5'-AGGAAGGTTGTACCCGACACTGA-3' (SEQ ID NO: 3); GhCaLB42 qR: 5'-CGGACTCAACTGTGCAAAGCCT-3' (SEQ ID NO: 4); QUR qF: 5'-GACCTACACCAAGCCCAAGAAG-3' (SEQ ID NO: 5); QUR qR: 5'-TGAGCCCACACTTACCACAATAGT-3' (SEQ ID NO: 6); The total RT-PCR reaction system is 20 µL and consists of the following components: 10 µL TB Green ® Premix Ex TaqTM (Tli RNaseH Plus) (Brand: TaKaRa) (2×), primers (0.5 µL of each primer, 10 μM concentration), 0.4 µL of ROX Reference Dye II (50×) and 5 µL of cDNA (5-fold dilution), and the total reaction system was made up to 20 µL with sterile water.

[0051] The cDNA template should be added separately, and the rest of the qRT-PCR reaction system should be pre-mixed and added to the qPCR tube to reduce experimental errors.

[0052] The reaction procedure was: pre-denaturation at 95°C for 30 s; 95°C for 5 s, 60°C for 30 s, 40 cycles. Each sample was repeated three times biologically and three times technically. -ΔΔCT Methods Relative gene expression levels were calculated.

[0053] 2. Experimental Results 1. Transcriptome data results show GhCaLB42 The gene is highly expressed during the -3 to 1 DPA period of fiber development ( Figure 1 a) in the figure.

[0054] 2. GhCaLB42 In addition to being dominantly expressed in ovules at -1 to 1 DPA, the gene was also highly expressed in petals and stamens. Its expression pattern during fiber development was basically consistent with the transcriptome results ( Figure 1 b) in the above.

[0055] The above results show that GhCaLB42 The gene may play an important role in cotton fiber development.

[0056] Example 2 Cotton GhCaLB42 Gene amplification and construction GhCaLB42 Gene overexpression vector 1. Double digest the PRI101-AN overexpression vector (brand: Takara, catalog number: 3262) with nuclease endonucleases Sal I and EcoR I, recover and purify to obtain the linearized PRI101-AN expression vector for later use.

[0057] 2. Using the cDNA of 0 DPA ovules of TM-1 cotton as a template, specific primers were set, and PCR was performed using the GXL high-fidelity PCR enzyme system (brand: TaKaRa; item number: R051S) to amplify GhCaLB42 Gene, and obtain amplified product.

[0058] The heterosexual primers used were GhCaLB42-OE F1, GhCaLB42-OE R1 and GhCaLB42-OE R2.

[0059] GhCaLB42-OE F1: 5'-TTGATACATATGCCCGTCGACATGGGGGAGCTGTTGGGACTGCTA-3' (SEQ ID NO: 7); GhCaLB42-OE R1: 5'-GGATCCCTAATGATGATGATGATGATGCCTTGAAGGTCCATCGCGTGTCTC-3' (SEQ ID NO: 8); GhCaLB42-OE R2: 5'-GTTGATTCAGAATTCGGATCCCTAATGATGATGATGATGATG-3' (SEQ ID NO: 9).

[0060] The total PCR reaction system is 50 µL and consists of the following components: 1 µL cDNA template, primers (1.5 µL each, 10 μM concentration), 1 µL GXL High-Fidelity DNA Polymerase, 10 µL GXL High-Fidelity DNA Polymerase Buffer (5×) and 4 µL 2.5 mM deoxyribonucleoside triphosphates (dNTPs), add ddH2O to make up the total reaction system to 50 µL.

[0061] The reaction program was: 98°C, 5 min; 98°C, 10 s, 56°C, 15 s, 68°C, 30 s, 35 cycles; 68°C, 10 min; 4°C, constant temperature.

[0062] 3. After the amplified product fragment of step 2 meets the expected target size through electrophoresis detection ( Figure 2 ), all the amplified products were excised from the gel, recovered and purified, and the PRI101-AN expression vector linearized in step 1 was connected according to the operation method of ClonExpress MultiS One Step Cloning Kit (non-ligase-dependent multi-fragment one-step cloning technology) (manufacturer: Nanjing Novogene Biotechnology Co., Ltd., catalog number: C113) to obtain the overexpression GhCaLB42 PRI101 -GhCaLB42 Overexpression recombinant plasmid.

[0063] 4. PRI101 -GhCaLB42 The overexpression recombinant plasmid was heat-shock transformed into Escherichia coli DH5α to obtain transformation PRI101 -GhCaLB42Escherichia coli DH5α overexpressing the recombinant plasmid was spread on a 50 µg / mL kanamycin-resistant LB (Luria-Bertani) plate medium and inverted at 37°C for more than 10 h. The recombinant monoclonal strain was picked and amplified in a LB liquid medium containing 50 µg / mL kanamycin resistance at 37°C and 200 rpm for more than 12 h. The bacterial liquid was collected and used EasyTaq ® DNA Polymerase (DNA polymerase, manufacturer: Beijing Quanshijin Biotechnology Co., Ltd., catalog number: AP111-01) was used for PCR amplification of the bacterial solution, and the target band was detected by electrophoresis and then sequenced.

[0064] The primers used for PCR amplification of bacterial solution were PR101-35S F and PR101-35S R.

[0065] PR101-35S F: 5'-ACTGACGTAAGGGATGACGC-3' (SEQ ID NO: 10); PR101-35S R: 5'-AGCTCGGTAGCAATTCCCGA-3' (SEQ ID NO: 11).

[0066] The total bacterial PCR reaction system is 15 µL and consists of the following components: 1 μL bacterial solution, primers (each primer volume is 0.5 μL, the concentration is 10 μM), 0.3 μL EasyTaq ® DNA Polymerase, 1.5 μL EasyTaq ® DNA Polymerase Buffer (10×) and 0.3 μL of 2.5 mM deoxyribonucleoside triphosphates (dNTPs), and make up the total reaction volume to 15 μL with nuclease-free water.

[0067] The reaction program was: 94°C, 5 min; 94°C, 30 s, 55°C, 30 s, 72°C, 1 min, 35 cycles; 72°C, 10 min; 4°C, constant temperature.

[0068] 5. Select the bacterial solution with correct sequencing in step 4, expand and shake, extract the PRI101-GhCaLB42 overexpression recombinant plasmid, and further transfer the PRI101-GhCaLB42 overexpression recombinant plasmid into Agrobacterium GV3101 by liquid nitrogen freeze-thaw method to obtain Agrobacterium GV3101 containing the PRI101-GhCaLB42 overexpression recombinant plasmid for later use.

[0069] Example 3 GhCaLB42Identification of positive strains overexpressing Arabidopsis 1. Experimental Methods 1. Add PRI101 in Example 2 -GhCaLB42 Agrobacterium GV3101 overexpressing the recombinant plasmid was transformed into Arabidopsis thaliana (Col-o ecotype) by inflorescence infection method, and the T0 generation overexpressing GhCaLB42 Arabidopsis thaliana transgenic lines GhCaLB42-OE The seeds were harvested and planted, and positive seedlings were selected in 1 / 2 MS medium (Murashige & Skoog Medium) containing 50 µg / mL kanamycin resistance. After the positive seedlings were replanted, the T1 generation seeds were harvested, and the harvested T1 generation seeds were further selected in 1 / 2 MS medium containing 50 µg / mL kanamycin resistance. The T3 generation was cultured until homozygous overexpression GhCaLB42 Arabidopsis thaliana transgenic lines GhCaLB42-OE .

[0070] 2. Randomly select three T3 transgenic Arabidopsis lines GhCaLB42-OE RNA was extracted from leaves and reverse transcribed into cDNA for RT-PCR and qRT-PCR detection.

[0071] The primers used in RT-PCR were the GhCaLB42-OE F1 and GhCaLB42-OE R1, other reaction systems and reaction procedures are the same as those in step 4 of Example 2.

[0072] In qRT-PCR, GhCaLB42 The primers used for gene identification were GhCaLB42 qF and GhCaLB42 qR; the primers used for the Arabidopsis internal reference gene were Atactine2 qF and Atactine2 qR.

[0073] Atactine2 qF: 5'-TTGTGCTGGATTCTGGTGATGG-3' (SEQ ID NO: 12); Atactine2 qR: 5'-CCGCCTCTGCTGTTGTGGTG-3' (SEQ ID NO: 13).

[0074] The other reaction systems and reaction procedures were the same as those in Example 1. Each sample to be tested was repeated three times biologically and three times technically. -ΔΔCT Methods Relative gene expression levels were calculated.

[0075] 3. Use an optical stereo microscope (brand: OLYMPUS, model: SZX10) to further examine each T3 transgenic Arabidopsis line. GhCaLB42-OE The mature rosette leaves, seedling roots and root hairs of the plants were photographed, and the length and density of epidermal hairs of the mature rosette leaves, as well as the length and root hairs of the seedling roots were measured and statistically analyzed using ImageJ software.

[0076] 2. Experimental Results In each transgenic Arabidopsis line GhCaLB42-OE The expression of target genes can be detected in Figure 3 (a) qRT-PCR further detected the transgenic Arabidopsis lines GhCaLB42-OE middle GhCaLB42 The expression levels of the genes were significantly higher than those of the wild-type Col-o ecotype Arabidopsis thaliana ( Figure 3 b) in the above.

[0077] like Figure 4 The transgenic Arabidopsis thaliana strain is shown in a GhCaLB42-OE Compared with the WT wild-type leaves and leaf epidermal hairs, the three transgenic Arabidopsis lines GhCaLB42-OE The length of leaf epidermal hairs of (OE2, OE12 and OE25) were significantly longer than that of WT wild type ( Figure 4 b), and the leaf epidermal hair density was significantly or extremely significantly higher than that of the WT wild type ( Figure 4 c), the results show that overexpression GhCaLB42 The gene significantly increases the length and density of leaf epidermal hairs in Arabidopsis thaliana.

[0078] like Figure 5 a and Figure 5 As shown in b, three transgenic Arabidopsis lines GhCaLB42-OE The taproot lengths of OE2, OE12, and OE25 were significantly longer than those of the wild type. Figure 5 c and Figure 5 As shown in (d), three transgenic Arabidopsis lines GhCaLB42-OE The root hair length of the transgenic Arabidopsis thaliana line was significantly longer than that of the WT wild type. GhCaLB42-OE The root hair density of (OE2 and OE12) was also significantly higher than that of the WT wild type ( Figure 5 c and Figure 5 e in Figure 5). Indicates that overexpression GhCaLB42 The gene significantly increases root length as well as root hair length and density in Arabidopsis thaliana.

[0079] Will GhCaLB42 The phenotypic identification results of the gene overexpression Arabidopsis were combined with the qRT-PCR identification results of the gene in different tissues and organs and at various developmental stages of cotton fiber ( Figure 1 b), the analysis shows that GhCaLB42 The gene may play an important role in the initiation and elongation of cotton fiber development and play a positive regulatory role in cotton fiber development.

[0080] Example 4 Design GhCaLB42 Gene editing sgRNA targets and construction of CRISPR / Cas9 gene editing vectors For further research GhCaLB42 Function of genes in cotton fiber development, using CRISPR / Cas9 gene editing system GhCaLB42 Gene mutation to obtain GhCaLB42 Gene knockout mutant cotton plants.

[0081] 1. In GhCaLB42 Two sgRNA target sequences were designed in the exon region of the gene, among which sgRNA1 target is located at GhCaLB42 The sgRNA2 target site is located in the first exon of the gene. GhCaLB42 The third exon region of the gene is the reverse complementary sequence. Among them, the sgRNA1 target sequence is: 5'-GTTGGGACTGCTAAAAGTGG-3' (SEQ ID NO: 14); the sgRNA2 target sequence is: 5'-CTTGTCTCAGCTGCTAGATT-3' (SEQ ID NO: 15).

[0082] 2. The sgRNA target in step 1 is designed based on the publicly released genome sequence of TM-1 cotton, a standard line of upland cotton. Therefore, it is necessary to perform target sequence consistency detection of the target sgRNA in the upland cotton recipient material Jin668 cotton to be transformed.

[0083] (1) Using WT wild-type Jin668 cotton DNA as a template, specific primers were designed to amplify the partial gene fragment DNA including the target sequence of each sgRNA to obtain PCR amplification products. The PCR primers were sgCaLB42-PF1, sgCaLB42-PR1, sgCaLB42-PF2 and sgCaLB42-PR2.

[0084] sgCaLB42-PF1: 5'-ATGGATCTGTTTGGCTATTGCC-3' (SEQ ID NO: 16); sgCaLB42-PR1: 5'-GAAACATAGAATTGCCAATGC-3' (SEQ ID NO: 17); sgCaLB42-PF2: 5'-GAAGTATTCGACAAAGATCG-3' (SEQ ID NO: 18); sgCaLB42-PR2: 5'-CTACCTTGAAGGTCCATCG-3' (SEQ ID NO: 19).

[0085] The other reaction systems and reaction procedures are the same as those in step 2 of Example 2.

[0086] (2) After the PCR amplification product was detected by electrophoresis, the band was correctly detected, purified and recovered, connected to the TA cloning vector with pEASY-Blunt Cloning Vector (manufacturer: Beijing Quanshijin Biotechnology Co., Ltd., catalog number: CB101), and heat-shocked into Escherichia coli DH5α to obtain Escherichia coli DH5α transformed with the sgRNA target sequence. The product was spread on a 50 µg / mL kanamycin-resistant LB plate medium and inverted and cultured at 37°C overnight for more than 10 h. The recombinant monoclonal colony was picked and amplified in a LB liquid medium containing 50 µg / mL kanamycin resistance at 37°C at 200 rpm for more than 12 h. The bacterial solution was collected and PCR amplified. The PCR primers were sgCaLB42-PF1, sgCaLB42-PR1, sgCaLB42-PF2 and sgCaLB42-PR2. The other reaction systems and reaction procedures were the same as those in step 4 of Example 2. After detecting the target band, the bacterial solution was sent for sequencing.

[0087] The sequencing results were compared with the reference sequences, and the results showed that the target sgRNA sequence in Jin668 cotton was consistent with the target sequence designed based on the TM-1 cotton genome reference sequence, indicating that the sgRNA target sequence designed in the present invention is suitable for the subsequent construction of gene editing vectors and cotton genetic transformation.

[0088] 3. Based on the sequence consistency detected in step 2, PCR amplification of tRNA-sgRNA1 and gRNA scaffold-tRNA-sgRNA2 fragments was performed using the pGTR4 plasmid containing tRNA and gRNA Scaffold sequences as a template. The total PCR reaction system was 50 µL and consisted of the following components: 1 µL pGTR4 plasmid DNA, primers (1.5 µL each, 10 μM), 1 µL GXL High-Fidelity DNA Polymerase, 10 µL GXL High-Fidelity DNA Polymerase Buffer (5×) and 4 µL 2.5 mM deoxyribonucleoside triphosphates (dNTPs), add ddH2O to make up the total reaction system to 50 µL.

[0089] The reaction program was: 98°C, 5 min; 98°C, 10 s, 56°C, 15 s, 68°C, 30 s, 35 cycles; 68°C, 10 min; 4°C, constant temperature.

[0090] Among them, the primers used to amplify the tRNA-sgRNA1 fragment were pG32-9 F and PTG-CaLB42-1 R; the primers used to amplify the gRNAscaffold-tRNA-sgRNA2 fragment were PTG-CaLB42-1 F, PTG-CaLB42-2 R and inf CaLB42-2R.

[0091] pG32-9 F: 5'-CAGCACATAACTGGCAaacaaagcaccagtggtctag-3' (SEQ ID NO: 20); PTG-CaLB42-1 R: 5'-CCACTTTTAGCAGTCCCAACtgcaccagccgggaat-3' (SEQ ID NO: 21); PTG-CaLB42-1 F: 5'-GTTGGGACTGCTAAAAGTGGgttttagagctagaaata-3' (SEQ IDNO: 22); PTG-CaLB42-2 R: 5'-CTTGTCTCAGCTGCTAGATTtgcaccagccgggaat-3' (SEQ ID NO: 23); inf CaLB42-2 R: 5'-ttctagctctaaaacCTTGTCTCAGCTGCTAGATT-3' (SEQ ID NO: 24); The nucleotide sequence of the tRNA is: 5'-AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA-3' (SEQ ID NO: 25); The nucleotide sequence of the tRNA-sgRNA1 is: 5'-AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAGTTGGGACTGCTAAAAGTGG-3' (SEQ ID NO: 26); The nucleotide sequence of the gRNA scaffold is: 5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3' (SEQ ID NO: 27); The nucleotide sequence of the gRNA scaffold-tRNA-sgRNA2 is: 5′-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAAATCTAGCAGCTGAGACAAG-3′ (SEQ ID NO: 28).

[0092] Construction of dual-target CRISPR / Cas9 gene editing vector, using nuclease Bsa I to treat the empty plasmid pRGEB32 - GhU6.9-NPTII Double enzyme digestion linearization was performed, and then recovery and purification were performed to obtain linearized pRGEB32 -GhU6.9-NPTII Carrier, spare.

[0093] According to the ClonExpress MultiS One Step Cloning Kit (ligase-independent multi-fragment one-step cloning technology) (manufacturer: Nanjing Novogene Biotech Co., Ltd., catalog number: C113), the RNA-sgRNA1 fragment and the gRNA scaffold-tRNA-sgRNA2 fragment were concatenated (the 3' end of the tRNA-sgRNA1 fragment was connected to the 5' end of the gRNAscaffold-tRNA-sgRNA fragment) and inserted into the linearized pRGEB32 -GhU6.9-NPTII The BsaI restriction site of the vector was used to obtain pRGEB32 -GhCaLB42 Knockout plasmid.

[0094] 4. The constructed pRGEB32 -GhCaLB42 The knockout plasmid was heat activated and transformed into competent E. coli DH5α to obtain transformation pRGEB32 -GhCaLB42 Knock out the plasmid from Escherichia coli DH5α and spread it on LB plate culture medium containing 50 µg / mL kanamycin resistance, invert and culture at 37°C overnight for more than 10 hours, pick the recombinant monoclonal colony, and shake it at 200 rpm at 37°C in LB liquid culture medium containing 50 µg / mL kanamycin resistance for more than 12 hours, collect the bacterial liquid, perform PCR amplification on the bacterial liquid, and sequence after electrophoresis detection of the target band.

[0095] The primers used for PCR amplification of bacterial culture were pG32-U6-9 F and pG32-Ubi2 R.

[0096] pG32-U6-9 F: 5'-CTTCGGGGACATACTTCAGG-3' (SEQ ID NO: 29); pG32-Ubi2 R: 5'-TGTTGGTCCGCCGTTAGGACC-3' (SEQ ID NO: 30).

[0097] The other reaction systems and reaction procedures are the same as those in step 4 of Example 2.

[0098] After sequencing was correct, the plasmid was extracted and pRGEB32 -GhCaLB42 The knockout plasmid was transformed into Agrobacterium GV3101 by liquid nitrogen freezing method, and the positive Agrobacterium single bacterial liquid was transferred into cotton recipient material Jin668 by hypocotyl-mediated transformation method to screen and obtain GhCaLB42 Knockout cotton.

[0099] Example 5 Identification GhCaLB42 Types of target site mutations in gene knockout cotton plants 1. Experimental Methods 1. Extract 23 T0 generations obtained in Example 4 GhCaLB42 The DNA of the knockout cotton was detected by PCR. Cas9 Gene identification.

[0100] Identification Cas9 The primers used for the gene were Cas9-787 F and Cas9-1550 R.

[0101] Cas9-787 F: 5'-AATCTGATCGCCCAGCTGCCC-3' (SEQ ID NO: 31); Cas9-1550 R: 5'-GAAGTTTCCAGGGGGTGATGGT-3' (SEQ ID NO: 32).

[0102] The other reaction systems and reaction procedures are the same as those in step 4 of Example 2.

[0103] 2. For further identification GhCaLB42 To determine whether the target site in the gene-knockout transgenic cotton has been edited, PCR amplification and sequencing were used to detect changes in the nucleotide sequence including the target site.

[0104] choose Cas9 The gene-positive individual strains were further subjected to PCR amplification of the target gene mutation site region to obtain the amplified product.

[0105] The amplification primers are sgCaLB42-PF1, sgCaLB42-PR1, sgCaLB42-PF2 and sgCaLB42-PR2. The other reaction systems and reaction procedures are the same as those in step 2 of Example 2.

[0106] After the obtained amplification product was detected by electrophoresis and the band was correct, it was purified and recovered, connected to the TA cloning vector with pEASY-Blunt Cloning Vector (manufacturer: Beijing Quanshijin Biotechnology Co., Ltd., catalog number: CB101), and heat-activated and transformed into Escherichia coli DH5α, and it was coated on an LB plate medium containing 50 μg / mL kanamycin resistance, inverted and cultured at 37°C overnight for more than 10 hours, and the recombinant monoclonal colony was picked, and in an LB liquid medium containing 50 μg / mL kanamycin resistance, it was shaken at 37°C and 200 rpm for more than 12 hours, and the bacterial liquid was collected for bacterial liquid PCR amplification. The amplification primers were sgCaLB42-PF1, sgCaLB42-PR1, sgCaLB42-PF2 and sgCaLB42-PR2. The other reaction systems and reaction procedures are the same as those in step 4 of Example 2. After the electrophoresis detection contains the target band, the single colony is sequenced, and the sequencing results are compared and analyzed with the reference sequence to identify the mutation type of the target target site.

[0107] 2. Experimental Results like Figure 6 As shown in the figure, 11 strains containing Cas9 There were 3 positive strains containing gene editing mutation sites (m3, m15 and m23).

[0108] Among them, the mutation of the m3 site mutant occurred in GhCaLB42 In the D genome subgroup (Dt subgroup) of the gene, there is a 2 bp base insertion in the sgRNA1 target region, specifically, there is a 2 bp base insertion at positions 28-29 of the sequence shown in SEQ ID NO: 1, while no base mutation occurs in the sgRNA2 target site region.

[0109] The mutation of the m15 site mutant occurred in the A genome subgroup (At) subgroup and the Dt subgroup. No base mutation occurred in the sgRNA1 target site region, but there was a 247 bp base deletion in the sgRNA2 target site region. Specifically, there was a 247 bp base deletion at sites 229 to 475 of the sequence shown in SEQ ID NO: 1.

[0110] The mutation of the m23 site mutant strain also occurred in the Dt subgroup of the gene, and a 222 bp base deletion occurred in the sgRNA1 target region. Specifically, a 222 bp base deletion occurred from -158 bp upstream (promoter region) to the 64th site of the sequence shown in SEQ ID NO: 1, while no base mutation occurred in the sgRNA2 target site region.

[0111] The above materials were self-pollinated and planted continuously year by year, and the mutation sites of target genes were identified in each gene knockout strain generation by generation.

[0112] Example 6 Observation and identification of the phenotypes of transgenic cotton

[0113] 1. Experimental Methods Take the T3 generation of Example 5 GhCaLB42 The ovule samples of the knockout cotton at 0 DPA were fixed and dehydrated, and the ovules were observed by scanning electron microscopy. The number of ovule epidermal fiber cells per unit area was statistically analyzed by T-test. In addition, the mature fiber length of each cotton was further sampled, and the fiber length was measured and statistically analyzed.

[0114] 2. Experimental Results like Figure 7 a and Figure 7 As shown in c, GhCaLB42 The number of epidermal cell protrusions in the ovules of the knockout cotton lines was significantly less than that in the WT wild type. GhCaLB42 The number of epidermal cell protrusions in the ovules of gene knockout cotton (m3 and m23 site mutants) is reduced.

[0115] like Figure 7 b and Figure 7 As shown in d, GhCaLB42 The length of mature fibers in each knockout cotton line was significantly shorter than that of the WT wild type. GhCaLB42 The mature fiber length of gene knockout cotton (m3 and m23 site mutants) is shorter.

[0116] Based on the above research results, GhCaLB42 The gene plays a positive regulatory role in cotton fiber development, which is related to GhCaLB42 The results of gene overexpression identification in Arabidopsis complement each other and further confirm GhCaLB42 Genes have an important influence on cotton fiber development.

[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A recombinant expression vector, characterized in that: The recombinant expression vector contains sgRNA editing sites sgRNA1 and sgRNA2; The nucleotide sequence of the sgRNA1 is shown in SEQ ID NO: 14; The nucleotide sequence of the sgRNA2 is shown in SEQ ID NO:

15.

2. The recombinant expression vector according to claim 1, characterized in that The recombinant expression vector contains a tRNA-sgRNA1 complex and a gRNA scaffold-tRNA-sgRNA2 complex; The tRNA-sgRNA1 complex is connected to the sgRNA editing site sgRNA1, and the nucleotide sequence of the tRNA-sgRNA1 complex is shown in SEQ ID NO: 26; The gRNA scaffold-tRNA-sgRNA2 complex is connected to the sgRNA editing site sgRNA2, and the nucleotide sequence of the gRNA scaffold-tRNA-sgRNA2 complex is shown in SEQ ID NO:

28.

3. The recombinant expression vector according to claim 2, characterized in that The 3' end of the tRNA-sgRNA1 complex is connected to the 5' end of the gRNA scaffold-tRNA-sgRNA2 complex.

4. The recombinant expression vector according to claim 3, characterized in that The recombinant expression vector is pRGEB32 - GhU6.9-NPTII The carrier is a backbone carrier.

5. The recombinant expression vector according to claim 4, characterized in that: The tRNA-sgRNA1 complex and gRNAscaffold-tRNA-sgRNA2 complex were ligated into pRGEB32 -GhU6.9-NPTII between the BsaI sites of the vector.

6. A recombinant genetically engineered bacterium, characterized in that: The recombinant genetically engineered bacteria express the recombinant expression vector according to any one of claims 1 to 5.

7. Reduce cotton GhCaLB42 Use of a gene-expressed agent in reducing cotton fiber length; GhCaLB42 The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2; the reagent contains the recombinant expression vector according to any one of claims 1 to 5 or the recombinant genetically engineered bacteria according to claim 6.

8. A method for reducing the length of cotton fibers, characterized in that: Reduce cotton GhCaLB42 The expression level of the gene shortens the length of cotton fibers.

9. The method according to claim 8, characterized in that Use the recombinant expression vector according to any one of claims 1 to 5 or the recombinant genetically engineered bacteria according to claim 6 to reduce GhCaLB42 Gene expression level.

10. A method for cultivating short-fiber cotton, characterized in that: Reduce cotton GhCaLB42 The expression level of the gene shortens the length of cotton fibers.

Images