Eukaryotic expression plasmid of recombinant porcine macrophage colony stimulating factor as well as construction method and application of eukaryotic expression plasmid

Abstract

The invention discloses a eukaryotic expression plasmid of a recombinant porcine macrophage colony stimulating factor and a construction method and application thereof, and the construction method comprises the following steps: cloning a synthesized porcine macrophage colony stimulating factor gene into a PUC57 plasmid to obtain a PUC57-PM-CSF plasmid; a PUC57-PM-CSF plasmid is used as a template, a primer for homologous recombination design at the position where a transmembrane region sequence is removed is adopted for PCR amplification, an obtained target gene is subcloned to a corresponding site of an eukaryotic expression vector, an obtained connection product is converted into DH5alpha competent cells, and a PM-CSF eukaryotic expression plasmid which is correctly identified is obtained. According to the invention, the plasmid containing the porcine M-CSF gene is successfully constructed for the first time, efficient expression is realized in an eukaryotic expression system, the expressed recombinant protein shows higher biological activity after being purified, basic data is provided for further research on the structure and biological function of the porcine M-CSF and polarization and function of the porcine bone marrow-derived macrophage, and the method has a wide application prospect. And a tool is provided for establishing a pig immunity evaluation system.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a eukaryotic expression plasmid of a recombinant porcine macrophage colony stimulating factor and a construction method and application thereof. Background Art

[0002] Macrophage colony-stimulating factor (CSF-1) signals through its receptor (CSF-1R) to promote differentiation of bone marrow progenitor cells into a heterogeneous population of monocytes, macrophages, dendritic cells, and osteoclasts. In the periphery, CSF-1 regulates the migration, proliferation, function, and survival of macrophages, which function at multiple levels within the innate and adaptive immune systems. CSF-1-triggered macrophage populations are associated with and exacerbate a variety of pathologies, including cancer, inflammation, and bone disease.

[0003] In recent years, CSF-1 has been recognized as a major driver of differentiation of myeloid precursors into the monocytic lineage and macrophages. Macrophage differentiation requires the interaction between CSF-1 and its unique receptor, CSF-1 receptor (also known as CSF-1R, c-fms, or CD115). Under healthy conditions, CSF-1 and IL-34 act in the same way through their co-receptor CSF-1R, promoting macrophage differentiation and survival. In human monocytes, CSF-1 and IL-34 activate similar signaling pathways (STAT, AKT, ERK1 / 2), triggering the proliferation of circulating monocytes and their differentiation into macrophages.

[0004] However, there are no reports on the recombinant expression of porcine macrophage colony stimulating factor in vitro. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a eukaryotic expression system of recombinant porcine macrophage colony stimulating factor and its construction method and application. The present invention aims to express porcine macrophage colony stimulating factor, determine its biological activity, provide a homologous stimulator for the polarization of porcine bone marrow-derived macrophages, and provide a tool for the establishment of a porcine immune evaluation system.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] In a first aspect, the present invention provides a method for constructing a eukaryotic expression plasmid of a recombinant porcine macrophage colony stimulating factor, comprising the following steps:

[0008] A. Synthesis of PUC57-PM-CSF plasmid: According to the published porcine macrophage colony stimulating factor gene sequence, the porcine macrophage colony stimulating factor gene was synthesized, and then the synthesized porcine macrophage colony stimulating factor gene was cloned into the PUC57 plasmid to obtain the PUC57-PM-CSF plasmid;

[0009] B. Construction of PM-CSF eukaryotic expression plasmid: The transmembrane domain of porcine macrophage colony stimulating factor was predicted, and primers for homologous recombination were designed at the position where the transmembrane region sequence was removed; then, the synthesized PUC57-PM-CSF plasmid was used as a template and PCR amplification was performed using the designed primers. The amplified target gene was purified and subcloned into the corresponding site of the eukaryotic expression vector. The resulting ligation product was transformed into Escherichia coli DH5α competent cells to obtain the correctly identified PM-CSF eukaryotic expression plasmid.

[0010] As a preferred embodiment, in step B, the sequences of the primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2.

[0011] As a preferred embodiment, in step B, the nucleotide sequence of the target gene is shown as SEQ ID NO.3.

[0012] As a preferred embodiment, in step B, the eukaryotic expression vector is pCDNA TM 3.1(+).

[0013] As a preferred embodiment, in step B, the reaction system of PCR amplification is: 2 μL of PUC57-PM-CSF plasmid DNA, 1 μL of each of 25 pmol / μL PM-CSF F1 and 25 pmol / μL PM-CSF R1 primers, 25 μL of Premix Taq (LA Taq Version 2.0 plus dye), and H2O is added to make up the total volume to 50 μL;

[0014] As a preferred embodiment, in step B, the reaction conditions for PCR amplification are: pre-denaturation at 98°C for 4 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, for a total of 30 cycles; extension at 72°C for 10 min.

[0015] In a second aspect, the present invention provides a eukaryotic expression plasmid of recombinant porcine macrophage colony stimulating factor constructed according to the aforementioned method.

[0016] In a third aspect, the present invention provides a recombinant protein, which is obtained by the following steps: transfecting the aforementioned eukaryotic expression plasmid of the recombinant porcine macrophage colony stimulating factor into CHO cells with a viability of more than 90%, and purifying the cell supernatant collected after culture.

[0017] As a preferred solution, the specific steps of the purification are: chelating the cell supernatant with an affinity chromatography column, then eluting with an elution buffer containing 20 to 100 mmol / L imidazole, and collecting the elution peak to obtain the purified recombinant protein.

[0018] In a fourth aspect, the present invention provides a method for using the aforementioned recombinant protein as a stimulator in promoting the differentiation of porcine bone marrow-derived macrophages.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention successfully constructed a plasmid containing the porcine M-CSF gene for the first time and achieved efficient expression in a eukaryotic expression system. The expressed recombinant protein showed high biological activity after purification, providing basic data for further research on the structure and biological function of porcine M-CSF, as well as the polarization and function of porcine bone marrow-derived macrophages, and providing a tool for the establishment of a porcine immune evaluation system. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0022] Figure 1 The results of predicting the transmembrane domain of PM-CSF gene using TMHMM online software;

[0023] Figure 2 PM-CSF gene for eukaryotic expression and eukaryotic vector pCDNA TM 3.1(+) PCR amplification results; among them, Figure 2 A is the PCR amplification result of PM-CSF gene; Figure 2 B is the eukaryotic vector pCDNA TM 3.1(+) PCR amplification results; Figure 2 In A and 2B, M: protein relative molecular weight standard; 1 and 2: both are PCR amplification products;

[0024] Figure 3 pCDNA TM 3.1-PM-CSF enzyme digestion identification results; M: protein relative molecular weight standard; 1, 2: both recombinant plasmid pCDNA TM 3.1-PM-CSF;

[0025] Figure 4 pcDNA TM 3.1-Western blot detection results of PM-CSF-induced expression products; M: protein relative molecular weight standard; 1: untransfected CHO cells; 2: transfected pCDNATM 3.1-PM-CSF CHO cell supernatant; 3: transfection with pCDNA TM 3.1-PM-CSF CHO cell lysate;

[0026] Figure 5 The results of predicting the signal peptide of PM-CSF gene using SignalP-5.0 online software;

[0027] Figure 6 The PCR amplification results of the prokaryotic expression of PM-CSF gene; M: protein relative molecular weight standard; 1, 2: both are PCR amplification products;

[0028] Figure 7 The results of enzyme digestion identification of the recombinant plasmid pET-32a-PM-CSF; M: protein relative molecular weight standard; 1, 2: both are recombinant plasmid pET-32a-PM-CSF;

[0029] Figure 8 The expression results of pET-32a-PM-CSF in Escherichia coli BL21 (DE3); M: protein relative molecular weight standard; 1: uninduced pET-32a-empty vector bacteria; 2: induced pET-32a-empty vector bacteria; 3: uninduced pET-32a-PM-CSF recombinant bacteria; 2: induced pET-32a-PM-CSF recombinant bacteria;

[0030] Fig. 9 The Western blot test results of the pET-32a-PM-CSF induced expression product; M: protein relative molecular weight standard; 1: uninduced pET-32a-empty vector bacteria; 2: induced pET-32a-empty vector bacteria; 3: uninduced pET-32a-PM-CSF recombinant bacteria; 2: induced pET-32a-PM-CSF recombinant bacteria;

[0031] Fig.10 The results of SDS-PAGE analysis of recombinant protein purification: M: protein relative molecular weight standard; 1: untransfected CHO cells; 2: transfected pCDNA TM 3.1-PM-CSF CHO cell supernatant; 3: transfection with pCDNA TM 3.1-PM-CSF CHO cell lysate; 4: flow-through; 5: 25 ml of eluent containing 20 mmol / L imidazole; 6: 50 ml of eluent containing 20 mmol / L imidazole; 7: 25 ml of eluent containing 50 mmol / L imidazole; 8: 50 ml of eluent containing 50 mmol / L imidazole; 9: 25 ml of eluent containing 100 mmol / L imidazole;

[0032] Fig.11 The biological activity results of different concentrations of recombinant protein (20ng / mL, 100ng / mL, 200ng / mL) on mouse bone marrow-derived macrophages;

[0033] Fig.12 The biological activity results of 20ng / mL recombinant protein on porcine bone marrow-derived macrophages;

[0034] Fig.13 This is the result of verifying the phagocytic ability of porcine M0 macrophages;

[0035] Fig.14 The results of the effects of M-CSF from different species on reactive oxygen species in mouse macrophages;

[0036] Fig.15 The effects of M-CSF from different species on the mRNA of mouse macrophage subtypes (iNOS, Arg-1). DETAILED DESCRIPTION

[0037] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several variations and improvements may be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0038] Bone marrow-derived macrophages (BMDM) are primary macrophages obtained by in vitro differentiation of bone marrow cells in the presence of macrophage colony-stimulating factor (M-CSF or CSF-1). However, since there is currently no commercial porcine M-CSF protein, previous studies have used human M-CSF with higher homology instead. However, previous studies in this laboratory have found that heterologous M-CSF shows higher levels of inflammation than macrophages stimulated by native M-CSF (see the detection results of reactive oxygen species of mouse bone marrow-derived macrophage subtypes stimulated by human M-CSF and mouse M-CSF and the identification results of transcriptional levels of differential phenotypic genes in Examples 6 and 7 below), which has a great impact on the accuracy of the experimental results. Based on this, in order to reduce the inflammatory level of macrophages stimulated by heterologous M-CSF and to more accurately study porcine bone marrow-derived macrophages, this laboratory has constructed a eukaryotic expression system of recombinant porcine macrophage colony-stimulating factor for the first time.

[0039] The eukaryotic expression vector pCDNA used in the present invention TM3.1(+) and the prokaryotic expression vector pET-32a(+) were both maintained in this laboratory; Escherichia coli DH5α was purchased from Shanghai Bioengineering Co., Ltd.; Escherichia coli BL21(DE3) was purchased from Beijing Solebow Technology Co., Ltd.; CHO cells were maintained in this laboratory.

[0040] The experimental animals used in the present invention are: C57BL / 6 female mice, SPF grade, 6-8 weeks old, purchased from Shanghai Jiesijie Experimental Animal Co., Ltd.; commercial pigs, 15 days old, purchased from Tinglin White Pig Fattening Farm.

[0041] The restriction endonuclease used in the present invention was purchased from New England Biotechnology (Beijing) Co., Ltd.; Taq DNA polymerase was purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.; protein marker was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; DNA gel recovery kit was purchased from Omega; imidazole was purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; DCFH-DA was purchased from Sigma.

[0042] Other reagents used in the embodiments of the present invention are also conventional reagents and can be obtained by purchase or preparation using known methods.

[0043] Example 1. Construction of PM-CSF eukaryotic expression plasmid

[0044] 1. Synthesis of porcine macrophage colony stimulating factor (PM-CSF) gene

[0045] According to the porcine macrophage colony stimulating factor gene sequence (NM_001244523.2) published in the UniProt protein database, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize PM-CSF, and the PM-CSF gene was connected to the PUC57 vector. After enzyme digestion and sequencing identification, the pUC57-PM-CSF plasmid was obtained.

[0046] 2. Primer Design

[0047] According to the gene sequence of porcine macrophage colony stimulating factor published in UniProt protein database, TMHMM online software was used to predict the transmembrane domain of porcine macrophage colony stimulating factor gene. The prediction results are as follows: Figure 1 As shown in the figure, the starting position of the transmembrane sequence is 198 and the ending position is 220. Primers for homologous recombination were designed at the position where the transmembrane sequence was removed. The primers designed for the target sequence were PM-CSF F1 and PM-CSF R1. TM 3.1(+) The primers designed are PC F1 and PC R1. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and the sequences are as follows:

[0048] PM-CSF F1 (SEQ ID NO. 1): 5′-ctcggatccgccaccatgaccgcgccgggc-3′.

[0049] PM-CSF R1 (SEQ ID NO. 2): 5′-atggtggtggtgatggccggggagctgggg-3′.

[0050] PC F1 (SEQ ID NO. 4): 5′-ccccagctccccggccatcaccacccaccatcattaat-3′.

[0051] PC R1 (SEQ ID NO. 5): 5′-gcccggcgcggtcatggtggcggatccgagctcg-3′.

[0052] 3. Construction of PM-CSF eukaryotic expression plasmid

[0053] 3.1 PCR amplification was performed using the PUC57-PM-CSF plasmid synthesized in step 1 as a template. The PCR amplification system was as follows: 2 μL of PUC57-PM-CSF plasmid DNA, 1 μL of each of PM-CSF F1 and PM-CSF R1 primers (25 pmol / μL), 25 μL of Premix Taq (LA TaqVersion 2.0 plus dye), and H2O was added to make up the total volume to 50 μL. PCR amplification conditions: pre-denaturation at 98°C for 4 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, for a total of 30 cycles; extension at 72°C for 10 min. The eukaryotic vector pCDNA was also cloned. TM 3.1(+) PCR amplification was performed in the same system with primers PC F1 and PC R1.

[0054] 3.2 The amplified PCR product was recovered and purified, and the electrophoresis results were as follows Figure 2 As shown in A, a band of about 591 bp was obtained; the eukaryotic vector pcDNA TM 3.1(+) Electrophoresis results are as follows Figure 2 As shown in B, a band of about 5411 bp was obtained, which was consistent with the expected gene fragment size. The target gene fragment amplified by PCR was the gene fragment of the mature protein coding region, and the gene sequence was shown in SEQ ID NO.3.

[0055] SEQ ID NO.3:

[0056] atgaccgcgccgggcgccgccgggcgctgccctcccacgacatggctgggccctctgctgctgctggtctgtctcctggtgagcagg

[0057] agtaccgccgaggaggtgtcggagaactgtagccacatgattggggacggacacctgaaggtcctgcagcagctgattgacagtca

[0058] gatggagacctcgtgccaaattgcctttgagtttgtagaccaggagcagttgacggatccagtgtgctatctgaagaaggcctttctcca

[0059] ggtgcaggacatactggatgaaaccatgcgcttcagagacaacactcccaatgccaacgtcattgtccagctccaggaactctctctga

[0060] ggctcaacagctgcttcaccaaggactacgaagagcaggacaaggcctgtgtccgaactttctatgagacgcccctccagttgctgga

[0061] gaagatcaagaatgtctttaatgaaacaaagaatctcctgaaaaaggactggaacattttcagcaagaactgcaacaatagctttgctaa

[0062] atgctccagccagggccatgagaggcagcccgagggacgctccgacccccagctccccggc

[0063] 3.3 Subclone the target gene fragment into pCDNA TM 3.1 (+) eukaryotic expression vector, the resulting ligation product was transformed into DH5α competent cells, white colonies were picked for culture, a small amount of plasmid was extracted, and PCR and restriction enzyme digestion were performed for identification. Figure 3 As shown, the results showed that the recombinant plasmid was constructed correctly, and the obtained recombinant plasmid was named pCDNA TM 3.1-PM-CSF.

[0064] 3.4 The positive clones were further sent to Shanghai Biotech Co., Ltd. for sequencing verification to confirm that the sequence had no mutations and the reading frame was correct. The sequencing results showed that the amplified PM-CSF gene was 591 bp in length, and its ORF was 591 bp in length, encoding 203 amino acid residues, with a 100% homology to the PM-CSF gene reference sequence published in GenBank. DNAstar11.0 software was further used to compare the obtained sequence with the M-CSF gene sequences of other animals known in GenBank for nucleotide and amino acid homology analysis. The results showed that the ORF of the amplified PM-CSF had 78.1%, 79.1% and 83.9% homology to the nucleotide sequence of M-CSF of humans, cats and mice, respectively; the deduced amino acid sequence had 83.7%, 87.2% and 78.7% homology, respectively.

[0065] Example 2 Expression of recombinant protein in CHO cells

[0066] The PM-CSF eukaryotic expression plasmid pCDNA obtained in Example 1 TM 3.1-PM-CSF was transfected into CHO cells with a viability of more than 90%, cultured for 24 hours and fed, and cultured for 5 days. 1 mL of cells was centrifuged to collect the cell supernatant and cells respectively, the cells were lysed to collect the cell lysate, and the protein expression was detected by Western blot.

[0067] The specific method of Western blot detection is as follows: after SDS-PAGE electrophoresis, the cell supernatant and cell lysate were transferred to a nitrocellulose membrane, blocked with 5% BSA for 2 h, anti-6×His monoclonal antibody was diluted 1:1000 as primary antibody, HRP-labeled goat anti-mouse IgG was diluted 1:5000 as secondary antibody, reacted at 37°C for 1 h, washed and developed with ECL. The results are shown in Figure 4 Western blot results showed that pCDNA expressed in CHO cells TM 3.1-PM-CSF recombinant plasmid showed a specific protein band at a molecular weight of about 23.2kD (lane 2), which is basically consistent with the deduced recombinant protein size. TM This band did not appear in CHO cells expressing the 3.1-PM-CSF recombinant plasmid (shown in lane 1), indicating that the recombinant protein was expressed in the cell supernatant and not in the cell lysate (shown in lane 3).

[0068] Comparative Example 1 Construction of PM-CSF prokaryotic expression system and expression of its recombinant protein in Escherichia coli

[0069] 1. Primer Design

[0070] According to the gene sequence of porcine macrophage colony stimulating factor published in UniProt protein database, the signal peptide of porcine macrophage colony stimulating factor was detected using Newpro Bio protein signal peptide prediction tool. The results are as follows Figure 5 As shown, the probability of having a signal peptide is 99.45%, and the signal peptide type is SP (Sec / SPI); the cleavage site is: 32-33, with a probability of 95.520%. Homologous recombination primers were designed for the sequence with the signal peptide removed. The designed primers are PM-CSF F2 and PM-CSF R2, and EcoR V and EcoR I restriction sites (underlined parts) are introduced at the 5' and 3' ends of the transmembrane region sequence, respectively. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and the sequences are as follows:

[0071] PM-CSF F2 (SEQ ID NO.6):5'-gacaaggccatggct gatatc gaggaggtgtcggagaactgtagc-3'.

[0072] PM-CSF R2(SEQ ID NO.7):5'-ttgtcgacggagctc gaattc ttacactggcaattccacccg-3'.

[0073] 2. Construction of PM-CSF prokaryotic expression plasmid

[0074] 2.1 PCR amplification was performed using the PUC57-PM-CSF plasmid synthesized in step 1 of Example 1 as a template. The PCR amplification system was as follows: 2 μL of PUC57-PM-CSF plasmid DNA, 1 μL of each of PM-CSF F2 and PM-CSF R2 primers (25 pmol / μL), 25 μL of Premix Taq (LA Taq Version 2.0 plus dye), and H2O was added to make up the total volume to 50 μL. PCR amplification conditions: 98°C pre-denaturation for 4 min; 98°C denaturation for 10 s, 55°C annealing for 30 s, 72°C extension for 60 s, for a total of 30 cycles; 72°C extension for 10 min.

[0075] 2.2 The amplified PCR product was recovered and purified. The electrophoresis results were as follows: Figure 6 As shown, a fragment of about 678 bp in size was obtained (lanes 1 and 2), which was consistent with the expected gene fragment size. The gene sequence of the target gene fragment obtained by PCR amplification is shown in SEQ ID NO.8.

[0076] SEQ ID NO.8:

[0077] gaggaggtgtcggagaactgtagccacatgattggggacggacacctgaaggtcctgcagcagctgattgacagtcagatggagac

[0078] ctcgtgccaaattgcctttgagtttgtagaccaggagcagttgacggatccagtgtgctatctgaagaaggcctttctccaggtgcagga

[0079] catactggatgaaaccatgcgcttcagagacaacactcccaatgccaacgtcattgtccagctccaggaactctctctgaggctcaaca

[0080] gctgcttcaccaaggactacgaagagcaggacaaggcctgtgtccgaactttctatgagacgcccctccagttgctggagaagatcaa

[0081] gaatgtctttaatgaaacaaagaatctcctgaaaaaggactggaacattttcagcaagaactgcaacaatagctttgctaaatgctccagc

[0082] cagggccatgagaggcagcccgagggacgctccgacccccagctccccggctttgtcttgcgcctgctcgtgcccagcatcatcctg

[0083] gtcctgctggccgtcggcggcctcttgttctacaggcggaggcggtggagccttcgagagccttggacagtggatcctcccatggagc

[0084] aaccagagggcagccccctgacccaggatgaggacagacgggtggaattgccagtgtaa

[0085] 2.3 Connect the target gene fragment into the pET-32a(+) vector, transform the resulting ligation product into DH5α competent cells, pick white colonies for culture, extract a small amount of plasmid, and perform PCR and enzyme digestion identification. The enzyme digestion identification results are as follows Figure 7As shown, the results showed that the recombinant plasmid was constructed correctly, and the obtained recombinant plasmid was named pET-32a-PM-CSF.

[0086] 3. Expression of Recombinant Protein in E. coli

[0087] The PM-CSF prokaryotic expression plasmid pET-32a-PM-CSF and pET-32a empty vector plasmid obtained in step 2.2 were transformed into competent cells BL21 (DE3) respectively. The specific transformation steps were as follows: pET-32a-PM-CSF and pET-32a empty vector plasmids were added to the competent cells BL21 (DE3) at a ratio of 1:10, respectively. After ice bathing for 30 minutes, heat shock was performed in a 42°C water bath for 45 seconds, ice bathing for 2 minutes, LB solid culture medium containing Amp was applied, and cultured in an oven at 37°C overnight. Pick a single colony after transformation, inoculate 7mL of LB culture medium containing Amp, and culture at 37°C with shaking. When the OD600 of the bacterial solution was 0.8, IPTG was added to a final concentration of 0.1mmol / L, and the culture was continued for 12 hours. 1mL of the bacterial solution was centrifuged to collect the bacteria, and the expression of the recombinant protein was detected by SDS-PAGE electrophoresis. The results are as follows Figure 8 As shown, the results show that the induced pET-32a-PM-CSF recombinant bacteria have a specific protein band at a molecular weight of about 43.7kD (lane 4), which is basically consistent with the deduced recombinant protein size. The expression level of this band is not much different from that of the uninduced pET-32a-PM-CSF recombinant bacteria (lane 3), but the expression level of the band of the induced pET-32a-empty vector bacteria (lane 2) is smaller than that of the uninduced pET-32a-empty vector bacteria (lane 1), indicating that the recombinant protein is expressed.

[0088] The induced expression pET-32a-PM-CSF recombinant bacteria and pET-32a empty vector bacteria, and the uninduced expression pET-32a-PM-CSF recombinant bacteria and pET-32a empty vector bacteria were further transferred to nitrocellulose membrane after SDS-PAEG analysis, and Western blot analysis was performed. The results are as follows Fig. 9As shown. The results of Western blot analysis showed that the induced expression of pET-32a-PM-CSF recombinant bacteria showed a very narrow specific band at about 43.7kD (lane 4), while the uninduced expression of pET-32a-empty vector bacteria did not show any band at the same position (lane 1), confirming that the recombinant protein was correctly expressed; and the uninduced expression of pET-32a-PM-CSF recombinant bacteria also showed a very narrow specific band at the same position (lane 3), which showed that the protein expression level of the induced expression of pET-32a-PM-CSF recombinant bacteria did not change significantly compared with the uninduced expression of pET-32a-PM-CSF recombinant bacteria, indicating that its expression level was not ideal and subsequent activity verification could not be performed.

[0089] Example 3 Purification and refolding of recombinant protein

[0090] The cell supernatant collected by centrifugation in Example 2 was chelated with a Ni2+-NTA affinity chromatography column and incubated at 4°C overnight. After overnight column hanging and before elution, the flow-through was collected for SDS-PAGE analysis. The next day, different concentrations and amounts of elution buffer (25-50 ml of eluent containing 20-100 mmol / L imidazole, other components of the eluent also include: 1.64 g Na3PO4, 14.61 g NaCl. Specifically, the following were used in sequence: 25 ml of eluent containing 20 mmol / L imidazole, 50 ml of eluent containing 20 mmol / L imidazole, 25 ml of eluent containing 50 mmol / L imidazole, 50 ml of eluent containing 50 mmol / L imidazole, 25 ml of eluent containing 100 mmol / L imidazole) were used for elution in sequence, and each elution peak was collected step by step, and the protein purification process was analyzed by SDS-PAGE. The results are as follows: Fig.10 As shown, the results show that when the cell supernatant is washed, most of the impurities can be removed (lanes 5-9), and the purity of the recombinant protein can reach 99.0%; when the imidazole concentration is 50-100mmol / L, a relatively ideal purified protein band can be obtained (lanes 7-9). The eluted protein was dialyzed with PBS at 4°C for 24h, and the protein concentration was determined by the Bio-Tech Protein BCA Kit to be 817μg / mL. After filtration and sterilization, it was frozen at -20°C for later use.

[0091] Example 4 Activity determination of recombinant protein

[0092] 1. Isolation and culture of mouse bone marrow-derived macrophages: C57BL / 6 female mice were killed by cervical dislocation, and the hind limbs of the mice were separated and soaked in 75% alcohol for 15 minutes, and then transferred to the clean bench. Cut off both ends of the bone, and insert a 1ml syringe into both ends of the bone for flushing. Use a 5mL syringe to draw 1640 culture medium containing 10% serum and 1% antibiotics to flush the bone marrow. Rinse both ends of the bone once into a 15mL centrifuge tube, centrifuge at 4℃550×g for 5 minutes in a low-temperature horizontal centrifuge, and discard the supernatant. The precipitated cells were suspended and mixed by blowing in 1640 medium, washed twice, centrifuged at 4°C 550×g for 5 min, and the supernatant was discarded. The cells were resuspended in 2 mL of red blood cell lysis buffer and lysed for 5 min. During the period, the mixture was mixed several times by inversion every two minutes, centrifuged at 4°C and 550×g for 5 min, and washed twice with PBS. The centrifuged cells were resuspended into a single cell suspension in 1640 medium containing 1% antibiotics + 10% FBS + 20-200 ng / mL PM-CSF (the purified recombinant protein obtained in Example 3), and the cell density was adjusted to 1×10 6 Each well was plated in a six-well plate, and the culture medium was replaced after 3 days. The cell morphology was observed under an inverted microscope every day. The biological activity results of different concentrations of recombinant protein (20ng / mL, 100ng / mL, 200ng / mL) on mouse bone marrow-derived macrophages are shown in Fig.11 The results showed that the concentration of recombinant protein in the culture medium of mouse bone marrow-derived macrophages was 20 ng / mL, which could significantly stimulate mouse BMHC (bone marrow-derived stem cells) to differentiate into macrophages.

[0093] 2. Isolation and culture of porcine bone marrow-derived macrophages: Commercial pigs were isolated and cultured using the same method as step 1. Cell morphology was observed under an inverted microscope every day. The biological activity results of 20 ng / mL recombinant protein on porcine bone marrow-derived macrophages are shown in Figure 2. Fig.12 The results showed that adding 20 ng / mL of recombinant protein to the culture medium of porcine bone marrow-derived macrophages could significantly stimulate porcine BMHC (bone marrow-derived stem cells) to differentiate into M0 macrophages, and the stimulation results were consistent with the stimulation effect of adding recombinant protein to mouse bone marrow-derived macrophages.

[0094] Example 5 Phagocytosis Experiment

[0095] To test the differentiation degree of macrophages, a phagocytosis experiment was performed. The pET-28a-EGFP was streaked, and a single colony was selected and inoculated into a liquid culture medium containing 50 μg / ml KanrLB. When the colony was cultured at 37°C until OD600 = 0.6-0.8, a final concentration of 0.3 mM IPTG was added, and the cells were induced at 37°C for 3 hours. The bacterial concentration was diluted to a multiplicity of infection of 20:1, and then inoculated into the pig-derived M0 macrophages (PM0) differentiated in step 2 of Example 4. After incubation at 37°C for 0.5 h, the phagocytosis ability of the M0 macrophages was verified. The results are as follows: Fig.13 The results showed that green fluorescence (blue excitation) was visible under a fluorescence microscope, proving that the polarized macrophages induced by the stimulus (recombinant protein) had phagocytic ability.

[0096] Example 6 Detection of reactive oxygen species in macrophage subtypes stimulated by M-CSF in different species

[0097] Reactive oxygen species are important immune mediators released by macrophages in response to pathogens such as bacteria, viruses, and parasites. By producing reactive oxygen species, macrophages can kill or at least inhibit the growth of pathogens and protect the body from infection. By interacting DCFH-DA (2,7-dichlorofluorescein diacetate) with differentiated macrophage subtypes, the changes in reactive oxygen species of activated bone marrow-derived macrophages were detected, and the green fluorescence intensity was detected by flow cytometry to show the level of ROS. Related studies have shown that cytokines of different species may have different effects on the differentiation and function of macrophages due to their different amino acid sequences and post-translational modifications. For example, although human and mouse cytokines are similar in structure, they may have different efficiencies or effects on the macrophage activation pathway due to subtle differences. Based on this, we stimulated differentiated mouse bone marrow-derived macrophages with human M-CSF (HM), porcine M-CSF (PM), and mouse M-CSF (MM), and detected the reactive oxygen levels of each differentiated mouse bone marrow-derived macrophage.

[0098] The specific steps are as follows:

[0099] 1. C57BL / 6 female mice were killed by dislocating the neck, and the hind limbs of the mice were separated. After soaking in 75% alcohol for 15 minutes, they were transferred to the clean bench. The two ends of the bone were cut off, and a 1ml syringe was inserted into the two ends of the bone for flushing. A 5mL syringe was used to draw 1640 culture medium containing 10% serum and 1% antibiotics to flush the bone marrow. Both ends of the bone were flushed once into a 15mL centrifuge tube, and centrifuged at 4℃550×g for 5 minutes in a low-temperature horizontal centrifuge, and the supernatant was discarded. The precipitated cells were suspended and mixed by blowing in 1640 medium, washed twice, centrifuged at 4°C 550×g for 5 min, and the supernatant was discarded. The cells were resuspended in 2mL of red blood cell lysis buffer and lysed for 5 min. During the period, the cells were mixed several times by inversion every two minutes, centrifuged at 4°C and 550×g for 5 min, and washed twice with PBS. The centrifuged cells were resuspended into a single cell suspension in 1640 medium containing 1% antibiotics + 10% FBS + 20ng / mL human M-CSF (purchased from PEPROTECH), porcine M-CSF (the purified recombinant protein obtained in Example 3), or mouse M-CSF (purchased from PEPROTECH) to adjust the cell density to 1×10 6 Each well was plated in a six-well plate, and the culture medium was replaced after 3 days. After 7 days of culture, differentiated human M0 macrophages (HM0), porcine M0 macrophages (PM0), and mouse M0 macrophages (MM0) were obtained.

[0100] 2. Macrophages (HM0, PM0, MM0) were cultured at 1×10 per well. 6 The cells were plated in six-well plates, washed twice with PBS after overnight culture, added with DCFH-DA (20 μmol / L; Sigma D6883), incubated at 5% CO2 and 37°C for 30 min, then washed three times with PBS, digested and resuspended, and the mean fluorescence intensity was analyzed by flow cytometry. Fig.14 As shown, the mouse bone marrow macrophages differentiated by porcine M-CSF and human M-CSF showed high levels of reactive oxygen species, while the levels of reactive oxygen species in the mouse bone marrow macrophages differentiated by mouse M-CSF were very low. The results prove that allogeneic M-CSF stimulated differentiated bone marrow macrophages to induce high levels of reactive oxygen species.

[0101] Example 7 Identification of transcriptional levels of differentially phenotypic genes of macrophage subtypes stimulated by M-CSF in different species

[0102] In order to explore the degree of stimulation of mouse bone marrow-derived macrophages by stimulatory factors (M-CSF) of different species, M0, M1, and M2 macrophages were collected after being stimulated by stimulators (20 ng / mL of HM, MM, or PM), and then nucleic acids were extracted to detect changes in the mRNA levels of their phenotypic genes. The specific experimental steps are as follows:

[0103] 1. Obtaining M0 macrophages: Obtain mouse bone marrow-derived M0 macrophages stimulated with human, porcine, and mouse M-CSF, respectively, using the same method as step 1 in Example 6;

[0104] 2. Obtaining M1 macrophages: Add 100ng / ml LPS or 100ng / ml IFN-γ to M0 macrophages for polarization for 24 hours to obtain mouse bone marrow-derived M1 macrophages stimulated with human, porcine, and mouse M-CSF, respectively;

[0105] 3. Obtaining M2 macrophages: Add 100ng / ml IL-4 or 100ng / ml IL-10 to M0 macrophages for polarization for 24 hours to obtain mouse bone marrow-derived M2 macrophages stimulated with corresponding human, porcine, and mouse M-CSF;

[0106] 4. Use the Novezan Nucleic Acid Extraction Kit to extract nucleic acids from M0 macrophages, M1 macrophages, and M2 macrophages (this step is machine-operated, and nucleic acid products can be obtained by simply adding cells to the kit and loading it on the machine);

[0107] 5. The extracted nucleic acid product was reverse transcribed using the reverse transcription system: 4xHifair AdvanceFast One-StepRT SuperMix 5μL, gDNA Remover Mix 1μL, and the volume was adjusted to 20uL with the extracted nucleic acid. The reaction procedure was 37℃ for 5min and then 86℃ for 30s;

[0108] 6. Use the nucleic acid reverse transcription product obtained in step 5 as a template to prepare the RT-qPCR system, which includes: 10 μL of 2xUniversal Blue SYBR Green gPCR Master Mix, 0.4 μL of upstream and downstream primers, and Nuclease-Free Water to make up to 20 uL after adding different templates.

[0109] 7. Perform fluorescence quantitative PCR detection on the machine to obtain the relative expression levels of iNOS and Arg-1 mRNA.

[0110] The relative expression levels of iNOS and Arg-1 mRNA in M0 macrophages were used as internal references in the calculation of each group to obtain the relative expression level of specific mRNA (iNOS) in M1 macrophages and the relative expression level of specific mRNA (Arg-1) in M2 macrophages. The results are shown in Figure 2. Fig.15 As shown in the results, it can be seen that both porcine M-CSF and human M-CSF have stronger adverse effects on mouse bone marrow macrophages than mouse native M-CSF.

[0111] Based on the results of Examples 6 and 7, the following conclusion can be drawn: When the porcine M-CSF obtained in the embodiment of the present invention is used to stimulate the differentiation of porcine bone marrow-derived macrophages, the level of reactive oxygen species and adverse effects will be significantly reduced compared to the use of heterologous M-CSF (such as human M-CSF).

[0112] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A method for constructing a eukaryotic expression plasmid of recombinant porcine macrophage colony stimulating factor, characterized in that: The following steps are involved: A. Synthesis of PUC57-PM-CSF plasmid: According to the published porcine macrophage colony stimulating factor gene sequence, the porcine macrophage colony stimulating factor gene was synthesized, and then the synthesized porcine macrophage colony stimulating factor gene was cloned into the PUC57 plasmid to obtain the PUC57-PM-CSF plasmid; B. Construction of PM-CSF eukaryotic expression plasmid: The transmembrane domain of porcine macrophage colony stimulating factor was predicted, and primers for homologous recombination were designed at the position where the transmembrane region sequence was removed; then, the synthesized PUC57-PM-CSF plasmid was used as a template and the designed primer pairs were used for PCR amplification. The amplified target gene was purified and subcloned into the corresponding site of the eukaryotic expression vector. The obtained ligation product was transformed into Escherichia coli DH5α competent cells to obtain the correctly identified PM-CSF eukaryotic expression plasmid.

2. The method for constructing the eukaryotic expression plasmid of recombinant porcine macrophage colony stimulating factor according to claim 1, characterized in that: In step B, the sequences of the primer pair are shown as SEQ ID NO.1 and SEQ ID NO.

2.

3. The method for constructing the eukaryotic expression plasmid of recombinant porcine macrophage colony stimulating factor according to claim 1, characterized in that: In step B, the nucleotide sequence of the target gene is shown as SEQ ID NO.

3.

4. The method for constructing the eukaryotic expression plasmid of recombinant porcine macrophage colony stimulating factor according to claim 1, characterized in that: In step B, the eukaryotic expression vector is pcDNA TM 3.1(+).

5. The method for constructing the eukaryotic expression plasmid of recombinant porcine macrophage colony stimulating factor according to claim 1, characterized in that: In step B, the PCR amplification reaction system is: 2 μL of PUC57-PM-CSF plasmid DNA, 1 μL of 25 pmol / μL PM-CSF F1 and PM-CSF R1 primers, 25 μL of Premix Taq, and H2O is added to make up the total volume to 50 μL.

6. The method for constructing the eukaryotic expression plasmid of recombinant porcine macrophage colony stimulating factor according to claim 1, characterized in that: In step B, the reaction conditions of the PCR amplification are: pre-denaturation at 98°C for 4 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, for a total of 30 cycles; extension at 72°C for 10 min.

7. A eukaryotic expression plasmid of recombinant porcine macrophage colony stimulating factor constructed according to the method according to any one of claims 1 to 6.

8. A recombinant protein, characterized in that The recombinant protein is obtained by the following steps: transfecting the eukaryotic expression plasmid of the recombinant porcine macrophage colony stimulating factor described in claim 7 into CHO cells with a viability of more than 90%, and purifying the cell supernatant collected after culture.

9. The recombinant protein according to claim 8, characterized in that The specific steps of the purification are: chelating the cell supernatant with an affinity chromatography column, then eluting with an elution buffer containing 20-100 mmol / L imidazole, and collecting the elution peak to obtain the purified recombinant protein.

10. Use of the recombinant protein according to claim 8 as a stimulator in promoting the differentiation of porcine bone marrow-derived macrophages.

Images