Preclinical biodistribution detection kit for mRNA-based allogeneic human T cell products and its detection method
By screening the specific sequence of CD3 at the mRNA level and constructing an RT-qPCR detection method, the problem of difficulty in distinguishing between T cells and tumor cells at the DNA level is solved, and specific detection and pharmacopoeia distribution analysis of ungenerated T cells is realized, which can better reflect the survival and distribution of living cells.
Patent Information
- Application Number
- CN202510376755.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-28
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2045-03-28
AI Technical Summary
It is difficult to perform biological analysis of the pharmacopoeia and distribution of immune cell therapy products that do not carry exogenous genes such as CAR sequences at the DNA level, especially distinguishing between T cells and tumor cells.
By screening CD3 specific sequences at the mRNA level, designing primer pairs and probes, a one-step RT-qPCR detection method is constructed to distinguish human T cells from human tumor cells.
The specific detection of ungenerated T cells is achieved, and the analysis of pharmacopoeia and biodistribution can be performed before clinical practice, which can better reflect the survival and distribution of living cells.
Smart Images

Figure CN119876364B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a preclinical biodistribution detection kit for a universal human T cell product based on mRNA and a detection method thereof, belonging to the technical fields of biomedical industry, research and development of cell gene therapy products, research and development of tumor immunotherapy products, molecular biology research, cell engineering research, preclinical research of drugs, pharmacokinetic research, drug bioanalysis, and biodistribution research. Background Art
[0002] In recent years, biomedicine has had a strong and comprehensive development trend globally. In addition to traditional small molecule chemical drugs, more and more biopharmaceuticals have been approved for clinical use. Current biopharmaceuticals mainly include monoclonal antibodies, proteins, polypeptide drugs, ADC drugs, bispecific antibodies, etc. In addition, cell and gene therapy drugs have also become a new hot research object in the research and development of biomedicine. Among them, cell therapy products have become an important focus of cell gene therapy drugs.
[0003] Since Novartis Pharmaceutical Corporation's Kymriah became the world's first approved CAR-T cell therapy product, in the field of immunocyte therapy, based on different types of immunocyte therapy, the research and development pipelines have blossomed, and many products have entered the preclinical or clinical research and development stage. Currently, there are a wide variety of immunocyte therapy products reported in the research and development stage. In addition to gene-modified products expressing the CAR structure such as CAR-T, CAR-NK, and CAR-γδ T cell products, there are also T cell therapy products without gene modification or even gene knockout, such as γδT and tumor-infiltrating T lymphocytes (TIL), as well as other autologous or allogeneic NK cells, NKT cells, etc. without gene modification or even gene knockout.
[0004] The analysis and evaluation of pharmacokinetic distribution is an inevitable step in the preclinical research stage and clinical research stage of drugs. There are practical difficulties and challenges in the technical implementation of the preclinical pharmacokinetic distribution evaluation research of cell therapy products. For example, for gene-modified T cell therapy products such as CAR-T or CAR-γδT that clearly carry foreign genes after gene modification, by detecting the CAR sequence they carry externally, the product can be specifically distinguished from human blood samples in clinical settings and preclinical blood samples and tissue samples loaded with human tumor cells at the DNA level, so as to conduct detection and analysis. Therefore, for gene-modified immunocyte therapy products with CAR, the preclinical pharmacokinetics and biodistribution bioanalysis are relatively easy.
[0005] For immune cell therapy products, generally, preclinical pharmacokinetics, toxicokinetics, and biodistribution studies need to be carried out using tumor-bearing animals loaded with human tumor cells before clinical trials. However, for immune cell therapy products derived from human sources that do not carry exogenous genes such as CAR or have undergone individual other gene knockouts, it is difficult to distinguish them from the human tumor cells of tumor-bearing animals, which also makes it impossible to carry out pharmacokinetic and distribution analysis. Therefore, for immune cells without exogenous genes such as the CAR sequence structure, how to conduct pharmacokinetic and distribution bioanalysis at the DNA level has become a practical difficulty in the preclinical research and development of such cell therapy products.
[0006] At the genomic DNA level, whether it is immune cells such as T cells or human tumor cells, that is, as long as they are human cells, their DNA sequences are basically exactly the same, and it is difficult to find good differential sequences. This is one of the common challenges faced by unmodified immune cells. Similarly, for human T cell therapy products, although it is well-known in the art that CD3 is a characteristic marker of T cells and T cells can be detected through CD3, at the genomic DNA level, both T cells and tumor cells can express the CD3 gene sequence and CD3 can be detected. Therefore, it is very difficult to develop a specific method for CD3 suitable for preclinical and even clinical use at the DNA level for unmodified T cells.
[0007] Patent 202311203128.3 proposes a general method for detecting human T cells based on nucleic acid variants. This is a general method for detecting T cells at the DNA level. Based on the difference in gene methylation of CD3 and T cells, T cell detection is carried out through the variant form of CD3. Through this method, detection at the DNA level can be well achieved. However, this method requires the extracted DNA to be transformed, additional transformation experimental steps are involved, and the control of transformation efficiency is also involved. Moreover, it is difficult to distinguish dead cell products and live cell products for cell therapy products at the DNA level. This is a common understanding of the disadvantages of detecting cell therapy products at the DNA level in the industry. Therefore, this method has deficiencies such as cumbersome steps and limited application in actual use. Summary of the Invention
[0008] The technical problems to be solved by the present invention:
[0009] 1. Screen the CD3 target sequence at the mRNA level. The CD3 molecule contains multiple subunits, namely CD3ε, CD3δ, CD3γ, and CD3ζ. The molecular weights are basically above 20KD, and the smallest molecular weight is 16KD. The mRNA sequences corresponding to these subunits have relatively large lengths. Therefore, it is not easy to achieve and challenging to find a suitable subunit among multiple subunits and a sequence with good specificity in a very long sequence, as the screening library capacity is very large.
[0010] 2. Design and screening of primer pairs and probes. For different target molecules, designing and screening primer pairs and probes that meet the actual application has practical differences and personalized technical challenges in terms of technical implementation. For many alternative target sequences, different primer pairs are designed to confirm specific primers, and the primers also need to amplify with high fidelity to prevent problems such as dimers, nonspecificity, etc. that affect efficient amplification, non-specific amplification, and efficiency. Probes also need to overcome similar technical problems.
[0011] 3. Preparation and provision of standards. Since mRNA-based detection is involved, the preparation and provision of mRNA standards, and whether the mRNA standards can be stable and have good applicability are also potential challenges.
[0012] 4. Construction of reaction systems. For example, choosing to construct a one-step reaction system or a two-step reaction system. The reaction system of the RT-qPCR two-step method is relatively cumbersome, and the one-step method involves efficiency and repeated use of RNA, all of which are technical challenges.
[0013] 5. Adjustment of the components and ratios in the reaction system, selection of enzymes, optimization of conditions such as reaction temperature, and how to control the Tm value from the source design.
[0014] 6. Overcoming the relative instability, large fluctuations, easy degradation of RNA, and the problems of preparation and stability of mRNA standards.
[0015] 7. To meet industrial applications, especially in the bioanalysis of pharmacokinetic distribution, in addition to comprehensively overcoming the above actual technical difficulties and paying attention to optimizing and improving technical detail conditions, it is also necessary to meet the regulatory requirements of the methodology of the biodistribution of cell gene therapy products, such as the regulatory acceptance criteria for sensitivity, matrix effect, accuracy, precision, and amplification efficiency. In addition, if industrial drug analysis requirements are to be met, potential matrix interference also needs to be overcome, which is a technical problem that is routinely overcome in this technical field of pharmaceutical research and development and is also one of the most difficult technical challenges in the industrial analysis community.
[0016] To solve the above technical problems, the present invention adopts the following technical solutions:
[0017] In the first aspect, the present invention provides the application of the mRNA sequence shown in SEQ ID No. 1 in the preparation of products for specifically distinguishing human T cells and human tumor cells.
[0018] In the second aspect, the present invention provides the application of a reagent for detecting the mRNA sequence shown in SEQ ID No. 1 in the preparation of a preclinical biodistribution detection kit for universal human T cell products based on mRNA.
[0019] In a third aspect, the present invention provides primer pairs for specifically differentiating human T cells from human tumor cells. The primer pairs are used for amplifying the mRNA sequence shown in SEQ ID No. 1; the primer pairs consist of a forward primer Primer-F and a reverse primer Primer-R, the forward primer Primer-F is the primer shown in SEQ ID No. 2, and the reverse primer Primer-R is the primer shown in SEQ ID No. 3.
[0020] In a fourth aspect, the present invention provides the use of the primer pairs for specifically differentiating human T cells from human tumor cells in the preparation of a preclinical biodistribution detection kit for a universal human T cell product based on mRNA.
[0021] In a fifth aspect, the present invention provides a probe. The probe is a Taqman probe in which a luminescent group is coupled to the 5´ end and a quenching group is coupled to the 3´ end of the gene sequence shown in SEQ ID No. 4.
[0022] In a sixth aspect, the present invention provides a primer-probe set for specifically differentiating human T cells from human tumor cells, including the primer pairs for specifically differentiating human T cells from human tumor cells and the probe.
[0023] In a seventh aspect, the present invention provides the use of the primer-probe set for specifically differentiating human T cells from human tumor cells in the preparation of a preclinical biodistribution detection kit for a universal human T cell product based on mRNA.
[0024] In an eighth aspect, the present invention provides an mRNA standard. The sequence of the mRNA standard is that an extension protection sequence shown in SEQ ID No. 6 is added to the 5’ end of the mRNA sequence shown in SEQ ID No. 1 and an extension protection sequence shown in SEQ ID No. 7 is added to the 3’ end.
[0025] Preferably, the sequence of the mRNA standard is the sequence shown in SEQ ID No. 5.
[0026] In a ninth aspect, the present invention provides the use of the mRNA standard in the preparation of a product for specifically differentiating human T cells from human tumor cells.
[0027] In a tenth aspect, the present invention provides a preclinical biodistribution detection kit for a universal human T cell product at the mRNA level, including: the primer-probe set for specifically differentiating human T cells from human tumor cells and the mRNA standard.
[0028] Preferably, it further includes: an RNA carrier diluent and a Master Mix mixture component.
[0029] Preferably, the mRNA standard is used to construct a standard curve, a primer pair or a primer probe set is used to construct a qPCR detection system, a specific mRNA sequence shown in SEQ ID No. 1 is obtained through an amplification reaction, and the differences between human T cells and human tumor cells are identified.
[0030] Preferably, the amplification reaction conditions are: 55°C / 15 minutes; 95°C / 30 seconds; 95°C / 10 seconds, 60°C / 30 seconds, 45 cycles.
[0031] In an eleventh aspect, the present invention provides an application of the mRNA sequence shown in SEQ ID No. 1 in detecting the pharmacokinetic distribution of human T cell products in mice and tumor-bearing mice bearing human tumor cell lines.
[0032] The present invention has the beneficial effects:
[0033] The present invention has developed a new type of universal and specific bioanalysis method for detecting human non-genetically modified T cells by detecting CD3 mRNA specific sequences, which can be well used for preclinical pharmacokinetic and biodistribution bioanalysis of T cell therapy products (including natural non-genetically modified T cells, non-CD3 gene knockout T cells, CAR-T cells and TIL cells, etc.). mRNA exists in living cells and is also based on the in vivo transcription of living cells. The half-life of mRNA in vivo is short, and it is difficult to retain it when the cell dies. Therefore, the present invention can detect cell therapy products at the mRNA level, and can better reflect the survival and distribution of living cells compared to DNA level detection. At present, there is no similar analysis method for evaluating T cell pharmacokinetic distribution at the mRNA level. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 It is an agarose gel electrophoresis diagram of the results of primer amplification on genomic DNA. Figure 1 A is based on the genomic DNA level of human tumor cells (Daudi) to determine the utility and specificity of pre-selected primers; Figure 1 B is to determine the utility and specificity of the preselected primers at the T cell genomic DNA level; Figure 1 A and Figure 1 The primers used in the lanes with the same number in B are the same. Among them, M: DNA Marker; 1: the first CD3 primer pair; 2: the second CD3 primer pair; 3: the third CD3 primer pair; 4: the fourth CD3 primer pair; 5: the fifth CD3 primer pair; 6: the first TCR primer pair; 7: the second TCR primer pair; 8: the third TCR primer pair; 9: the fourth TCR primer pair; 10: the fifth TCR primer pair.
[0035] Figure 2 It is an agarose gel electrophoresis diagram of the primer amplification results screened at the mRNA level. Figure 2 A is to determine the utility and specificity of pre-selected primers based on RNA levels in human tumor cells (Daudi); Figure 2 B is to determine the utility and specificity of the preselected primers at the human T cell RNA level; Figure 2 A and Figure 2 The primers used in the lanes with the same number in B are the same. Among them, M: DNA Marker; 1: the first CD3 primer pair; 2: the second CD3 primer pair; 3: the third CD3 primer pair; 4: the fourth CD3 primer pair; 5: the fifth CD3 primer pair; 6: the first TCR primer pair; 7: the second TCR primer pair; 8: the third TCR primer pair.
[0036] Figure 3 The specificity of the CD3δ primer pair and the specifically amplified mRNA target sequence of the present invention for various tumor cells and mice is identified at the mRNA level. Among them, M: DNA Marker; 1: A549 lung cancer human alveolar basal epithelial cells; 2: Daudi tumor cells; 3: NOG non-tumor-bearing mice; 4: T cell injection; 5: B-NDG mice bearing melanoma; 6: C57BL / 6 mice bearing human lymphoma; 7: NOG mice bearing human lymphoma cell line Daudi-luc cells. DETAILED DESCRIPTION
[0037] The present invention is further described by the following embodiments. It should be understood that the following embodiments are only used to illustrate the present invention, but not to limit the present invention.
[0038] At the DNA level, although the genomic DNA sequences contained in various cells of the same species are common, due to the spatiotemporal differences in gene expression, the transcription of these sequences at the RNA level has spatiotemporal differences, such as tissue specificity or cell specificity. For T cells or human tumor cells, although there are common sequences at the genomic DNA level, there may be differences at the mRNA level, for example, the mRNA sequence may not be expressed or may be different.
[0039] Based on this, the present invention has developed a new general and specific bioanalysis method for detecting human non-genetically modified T cells by detecting the specific mRNA sequence of CD3. Although CD3 is an important marker of T cells and is well-known in the industry, CD3 has four major subunits, namely CD3ε, CD3δ, CD3γ, and CD3ζ, and each subunit has an mRNA sequence of hundreds of bases. After a series of explorations, extensive comparisons, experimental screening, and optimizations, the present invention finally determined a general analysis method for detecting T cells (regardless of the type of T cells) by one-step RT-qPCR based on a segment of the mRNA sequence of CD3δ.
[0040] The general and specific preclinical bioanalysis method for T cells of the present invention is to amplify and detect the target RNA sequence in mRNA standards, quality control samples, and / or test samples by one-step RT-qPCR. The method designs a probe molecule based on the TaqMan probe method. The TaqMan probe is based on the cDNA strand reverse-transcribed from RNA and is single-stranded DNA. The 5´ end is coupled with the fluorescent group FAM, and the 3´ end is coupled with the quenching group TAMRA. The free intact probe has no fluorescent signal, and the fluorescence emitted by the fluorescent group will be absorbed and quenched by the quenching group. When the probe is hydrolyzed, the fluorescent group and the quenching group are separated, and the fluorescent signal can be detected. At the beginning of the reaction, the template strand is denatured by heat to form a single strand. The TaqMan probe anneals to the template strand preferentially, and then the primer anneals to the template. Subsequently, strand extension occurs. During the extension process, Taq enzyme exerts its 5´-3´ exonuclease activity and will excise the probe base by base from the 5´ end when it encounters the probe. The fluorescent group will be separated from the quenching group, so the fluorescence detection system can receive the fluorescent signal. For each amplified DNA strand, one fluorescent molecule is formed, and the accumulation of the fluorescent signal is synchronized with the formation of the PCR product. The standard curve is based on the linear relationship between the Ct value and the Log value of the sample concentration (counted in copies). The quality control samples and test samples can be calculated according to the standard curve regression-fitted with the standards. The Log value of the unknown sample concentration can be obtained through the Ct value of the sample, and then the sample concentration can be obtained. The one-step RT-qPCR method can directly put the mRNA standard and the blood or tissue sample containing mRNA in one reaction system, and realize reverse transcription and qPCR amplification in one round of experimental steps, rather than first reverse-transcribing RNA into cDNA and then taking the cDNA for qPCR. The continuous one-step method is beneficial to the operation of the methodology, and the reduction of steps is beneficial to the stability of the method and the better comparability of different batches of experiments.
[0041] The tumor cells described in the present invention include, but are not limited to, A549 human lung alveolar basal epithelial cells, Daudi tumor cells, melanoma, human lymphoma, human lymphoma cell line Daudi-luc cells, etc. The T cells described in the present invention include, but are not limited to, natural unmodified T cells, non-CD3 gene knockout T cells, CAR-T cells, and TIL cells, etc.
[0042] Primer and probe design:
[0043] CD3δ forward primer (Primer-F forward primer): 5’ TACTGGCTACCCTTCTCTCGCA3’ (SEQ ID No.2)
[0044] CD3δ reverse primer (Primer-R reverse primer): 5’ CCCAGGTCCAGTCTTGTAATGTCT 3’ (SEQ ID No.3)
[0045] CD3δ probe (Taqman probe): 6-FAM5’ TGAGGACAGAGTGTTTG 3’NFQ-MGB (SEQ ID No.4)
[0046] mRNA target sequence specifically amplified by primer-probe:
[0047] 5’ TACTGGCTACCCTTCTCTCGCAAGTGAGCCCCTTCAAGATACCTATAGAGGAACTTGAGGACAGAGTGTTTGTGAATTGCAATACCAGCATCACATGGGTAGAGGGAACGGTGGGAACACTGCTCTCAGACATTACAAGACTGGACCTGGG3’ (SEQ ID No.1)
[0048] Standard product mRNA sequence of the method constructed in the present invention (mRNA-CD3δ standard product)
[0049] 5’ ATGGAACATAGCACGTTTCTCTCTGGCCTGGTACTGGCTACCCTTCTCTCGCAAGTGAGCCCCTTCAAGATACCTATAGAGGAACTTGAGGACAGAGTGTTTGTGAATTGCAATACCAGCATCACATGGGTAGAGGGAACGGTGGGAACACTGCTCTCAGACATTACAAGACTGGACCTGGGAAAACGCATCCTGGACCCACGAGGA3’ (SEQ ID No. 5)
[0050] In addition, in the bioanalytical methods for pharmacokinetics and distribution, whether it is qPCR or RT-qPCR, standard products are required to construct the standard curve of the method or prepare quality control samples. The standard products for qPCR are DNA or plasmid standard products. However, for the one-step RT-qPCR method, its standard products pose certain challenges because the stability of mRNA standard products and the integrity of the bases containing the target sequence without being affected are very important. The standard products are constructed with cDNA corresponding to the mRNA target sequence as the template to construct the template plasmid, and the template plasmid is synthesized by in vitro transcription method and then purified. To ensure the stability of mRNA and the integrity of the target sequence mRNA standard products after synthesis, in the synthesis of mRNA standard products of the present invention, some sequences are added to extend both ends of the target sequence as protective sequences. The extended protection sequence at the 5' end is: ATGGAACATAGCACGTTTCTCTCTGGCCTGG (SEQ ID No. 6); the extended protection sequence at the 3' end is AAAACGCATCCTGGACCCACGAGGA (SEQ ID No. 7).
[0051] In summary, the present invention can be well used for the preclinical pharmacokinetics and biodistribution bioanalysis of T cell therapy products (including natural unmodified T cells, non-CD3 gene knockout T cells, even CAR-T cells and TIL cells, etc.). Moreover, mRNA exists in living cells and is also based on in vivo transcription of living cells. The in vivo half-life of mRNA is relatively short, and it is difficult to remain after cell death. Therefore, detecting cell therapy products at the mRNA level has an advantage over detecting at the DNA level in that it can better reflect the survival and distribution of living cells. Currently, there is no analytical method for evaluating the pharmacokinetics and distribution of T cells at the mRNA level of the same type, which is also the creative advantage of the present invention.
[0052] Instruments and Equipment
[0053] 1) Real-time fluorescence quantitative PCR instrument (Thermo Fisher Scientific, QuantStudio 5 or equivalent alternative version);
[0054] 2) Fluorescent quantitative PCR 8-tube strip & cap (BBI, F602004-0001, or equivalent alternative);
[0055] 3) Vortex mixer (IKA, LAB DANCER S000 or equivalent alternative);
[0056] 4) -10°C ~ -30°C refrigerator (Haier, DW-30L818, or equivalent alternative);
[0057] 5) Refrigerator at -60°C to -90°C (Haier, DW-86L959BPT, or equivalent alternative);
[0058] 6) Tabletop mini centrifuge (IKA, mini G, or equivalent alternative);
[0059] 7) 96-well PCR plate (AXYGEN, PCR-96-LP-AB-C, or equivalent alternative);
[0060] 8) Refrigerator at 2°C to 8°C (Midea, MC-4L1005, or equivalent alternative);
[0061] 9) Pipettes (Eppendorf, 0.1 - 2.5 μL, 0.5 - 10 μL, 2 - 20 μL, 10 - 100 μL, 20 - 200 μL, 100 - 1000 μL);
[0062] 10) Biosafety cabinet (Haier, 1780-IIA2, or equivalent alternative).
[0063] Reagents and Materials
[0064] 1) mRNA-CD3δ standard (at -60°C to -90°C);
[0065] 2) CD3δ forward primer (at -10°C to -30°C);
[0066] 3) CD3δ reverse primer (at -10°C to -30°C);
[0067] 4) CD3δ probe (at -10°C to -30°C);
[0068] 5) Hiscript II U+ One Step qRT-PCR Probe Kit (Vazyme, Cat#Q223, Lot#7E2120L4 or other batch equivalent alternative, at -10°C to -30°C);
[0069] 6) Human T cells (Shandong Zhizhen Pharmaceutical Technology Co., Ltd., Ruihongdi Medicine, at -60°C to -90°C);
[0070] 7) Yeast tRNA (Thermo Fisher Scientific, Cat#AM7119, at -10°C to -30°C);
[0071] 8) RNase-free double distilled water (Sangon Biotech, Cat#B541018-0010, at -10°C to -30°C);
[0072] 9) Blank NOG tumor-bearing mice (Vital River).
[0073] Solution preparation
[0074] 1) RNA carrier diluent: Add tris-HCl with a final concentration of 5 ± 0.1 mM, EDTA with a final concentration of 0.5 ± 0.05 mM, and SDS (sodium dodecyl sulfate) with a mass-volume ratio of 0.1% to RNase-free double-distilled water, adjust the pH between 6.5 and 7.0, and then add Yeast tRNA with a final concentration of 0.04 ± 0.005 mg / mL. After aliquoting, store at -80 °C for later use.
[0075] 2) RNA solution of blank experimental animals: Dilute the total RNA extracted from the whole blood or tissues of blank NOG tumor-bearing mice to 200 ng / μL with 0.04 mg / mL Yeast tRNA diluent (RNA carrier diluent), vortex thoroughly, and store for later use.
[0076] 3) Diluent for probes and primers: Dissolve the probe and primer dry powder in RNase-free double-distilled water to a final concentration of 10 μM respectively, vortex thoroughly, and store for later use.
[0077] 4) mRNA standard stock solution: Dilute the mRNA-CD3δ standard with 0.04 mg / mL Yeast tRNA diluent (RNA carrier diluent) to 1.000×10 8 copies / μL, aliquot and store in an ultra-low temperature freezer for later use.
[0078] The preparation of the reaction system and the control of the reaction conditions are shown in Tables 1 to 5.
[0079] Table 1 Preparation of the reaction system for standards and quality control samples
[0080]
[0081] Table 2 Preparation of the reaction system for test samples
[0082]
[0083] Table 3 Preparation of the standard curve
[0084]
[0085] Table 4 Preparation of quality control samples
[0086]
[0087] Table 5 Control of reaction conditions
[0088]
[0089] The temperature setting fluctuation of the reaction conditions is only allowed to be ±0.5 °C up and down.
[0090] Sensitivity and quantification range
[0091] The quantification range of the method described in the present invention is 2.000×10 7 copies / reaction or μg total RNA ~ 5.000×10 1 copies / reaction or μg total RNA, and the sensitivity is 50 copies / reaction or μg total RNA.
[0092] The main components of the kit formed based on the technical solution of the present invention include:
[0093] (1) T cell detection mRNA standard;
[0094] (2) RNA carrier diluent;
[0095] (3) Mixed reagent of RNA primer pairs and probe sets;
[0096] (4) Master Mix mixed components.
[0097] The following further lists examples to illustrate the present invention in detail. It should also be understood that the following examples are only used to further illustrate the present invention and cannot be construed as limiting the protection scope of the present invention. Some non-essential improvements and adjustments made by those skilled in the art based on the above content of the present invention all fall within the protection scope of the present invention. The specific process parameters and the like in the following examples are also only an example within a suitable range, that is, those skilled in the art can make selections within a suitable range through the description in this article, rather than being limited to the specific values in the following examples.
[0098] Example 1: Experimental example of screening specific primer amplification results at the genomic DNA level
[0099] CD3 is a characteristic marker of T cells. TCR is also a characteristic marker of T cells. According to the characteristics of T cells, the inventor designed and synthesized multiple pairs of primers from different CD3 chains and different TCR chains. The preclinical pharmacokinetic distribution of T cells is generally studied based on mice bearing human tumor cells. Therefore, these preselected primers were used to conduct specific screening on human tumor cells and T cells. If T cells can amplify the target sequence at the DNA level, then a corresponding-sized sequence can also be amplified on tumor cells. Therefore, it is very difficult to distinguish T cells from other human cells at the genomic level. This example aims to illustrate that it is very difficult to find a method to specifically distinguish natural T cells at the DNA level, which also indirectly illustrates the significance of detecting T cells from the mRNA level in the present invention.
[0100] Figure 1 : An agarose gel electrophoresis image of the primer amplification results screened on genomic DNA. Figure 1 A is to determine the practicability and specificity of preselected primers at the genomic DNA level based on human tumor cells (Daudi); Figure 1 B is to determine the practicability and specificity of preselected primers at the genomic DNA level of T cells; Figure 1 A of Figure 1 The primers used in the lanes with the same number in B of
[0101] The first CD3 primer pair is the aforementioned CD3δ forward primer and CD3δ reverse primer. The sequences of other primer pairs are shown in Table 6.
[0102] Table 6 Sequences of primer pairs
[0103]
[0104] Discussion: Through Blast alignment, the present invention pre-screened multiple pairs of primers for different target sequences as shown in Example 1. Among them, the primer pairs targeting CD3 in the ten preselected sequences can amplify the same sequences for both tumor cells and T cells at the genomic DNA level (see Figure 1 ), so it is impossible to specifically distinguish between tumor cells and T cells. The last five primer pairs among these 10 primer pairs are primer pairs targeting TCR. Some primer pairs cannot amplify any bands for tumor cells and T cells at all and are not available; although two primer pairs can amplify bands, they can amplify bands of the same size for the genomic DNA of both tumor cells and T cells. The results show that neither the CD3 primer pair nor the TCR primer pair of T cells can specifically detect and distinguish T cells and tumor cells at the genomic DNA level, and some cannot even amplify the target sequence. Thus, it is difficult to find a specific T cell detection method at the genomic DNA level to achieve preclinical pharmacokinetics and distribution studies.
[0105] Therefore, using the said 10 pairs of preselected sequences cannot specifically distinguish tumor cells from T cells at the genomic DNA level. That is, specific detection cannot be carried out at the genomic DNA level. Even using the TCR primer pairs of T cells, it is impossible to distinguish T cells from tumor cells, or the preselected primer pairs simply cannot amplify the target sequence. It can be seen that it is difficult to find a specific T cell detection method at the genomic DNA level for practical and preclinical pharmacokinetics and distribution studies.
[0106] Example 2: Experimental example for screening the specificity of primer amplification at the mRNA level
[0107] As mentioned above, in Example 1, the specific primer pairs for distinguishing T cells from tumor cells were screened at the genomic DNA level, but it was found that it was difficult to specifically detect T cells at the DNA level. In this example, at the mRNA level, the mRNA was reverse transcribed into cDNA for PCR amplification, so as to screen the usability and specificity of the primer pairs. Among the pre-screened primer pairs involved in Example 1, the fourth TCR primer pair and the fifth TCR primer pair were not further used in Example 2 because there was no amplification product in Example 1, and the other pre-screened primer pairs were all continued to be used in Example 2. Through the gel electrophoresis diagrams of Example 1 and Example 2, among many primer pairs based on the CD3 subunit, through exploration and screening, the sequences and methods that can specifically distinguish T cells from human cells, especially tumor cells, were finally found, so that the primer pairs and target sequences claimed in the present invention can be determined.
[0108] Figure 2 It is an agarose gel electrophoresis diagram of the primer amplification results screened at the mRNA level. Figure 2 A in is to determine the usability and specificity of the preselected primers at the RNA level of human tumor cells (Daudi); Figure 2 B in is to determine the usability and specificity of the preselected primers at the RNA level of human T cells; Figure 2 A in and Figure 2 The primers used in the corresponding lanes with the same numbers in B are the same. Among them, M: DNA Marker; 1: the first CD3 primer pair; 2: the second CD3 primer pair; 3: the third CD3 primer pair; 4: the fourth CD3 primer pair; 5: the fifth CD3 primer pair; 6: the first TCR primer pair; 7: the second TCR primer pair; 8: the third TCR primer pair.
[0109] Discussion: Among the five pairs of primers for the CD3 chain, the first CD3 primer pair (that is, the CD3δ primer pair claimed in the present invention) was screened out, which can specifically distinguish T cells from tumor cells (see Figure 2 )). In addition, as Figure 2As shown, it was also found that primer pairs targeting TCR can also distinguish T cells from human tumor cells (see Figure 2 ). However, TCR is specific to T cell subsets, and the TCR chain types may vary among different T cell subsets, while CD3 is present in all T cells. Therefore, the CD3 primer pairs selected are more suitable for developing a more broad-spectrum and versatile T cell detection method. Accordingly, the present invention finally determined the selected CD3 primer pairs and the optimized design implementation scheme for the mRNA target sequences corresponding to these primer pairs.
[0110] Example 3: Utility of the primer pairs and target sequences claimed in the present invention in preclinical pharmacokinetics and distribution
[0111] To further verify the applicability and utility of the primer pairs and target sequences based on the CD3δ subunit determined by screening in the present invention (the CD3δ primer pairs claimed in the present invention and the mRNA target sequences specifically amplified by the primer probes) in preclinical pharmacokinetic distribution studies, reverse transcription PCR amplification was performed on RNA samples of multiple T cells, as well as mice or tumor-bearing mice, using these primer pairs to examine the specificity of the detection method described in the present invention.
[0112] Figure 3 It is to identify the specificity of the CD3δ primer pairs of the present invention and the specifically amplified mRNA target sequences for various tumor cells and mice at the mRNA level. Among them, M: DNA Marker; 1: A549 human lung adenocarcinoma alveolar basal epithelial cells; 2: Daudi tumor cells; 3: NOG non-tumor-bearing mice; 4: T cell injection; 5: B-NDG mice bearing melanoma; 6: C57BL / 6 mice bearing human lymphoma; 7: NOG mice bearing the human lymphoma cell line Daudi-luc cells.
[0113] Discussion: As Figure 3 shown, among the results of reverse transcription PCR of numerous samples, only the T cell samples could amplify the target bands of the expected size, and no amplification bands were observed in mice, tumor-bearing mice, and various tumor cells. The results demonstrated the specificity of this technical solution, which is fully applicable to the pharmacokinetic distribution detection of T cell products loaded with human tumor cells and has practical value in preclinical T cell research. In summary, the results proved that the present invention has good specificity and is of specific value for the detection of T cell pharmacokinetic distribution in animal experiments with tumor-bearing mice or experiments with human tumor cells.
[0114] Example 4: Application performance of the standard curve
[0115] The standard curve was prepared according to the technical methods and steps of the present invention, and the results were very good. The accuracy and precision results of the standard curve are shown in Table 7.
[0116] Table 7 Accuracy and Precision Results of the Standard Curve
[0117]
[0118] Discussion: The standard curve well meets the requirement of a sensitivity of 50 copies, with very good accuracy and precision. The precision is less than 10%, and the accuracy is around 100%, indicating that the method described in the present invention has excellent performance, the standard curve has very good performance, and can achieve accurate detection of samples.
[0119] Example 5: Example for Investigating Accuracy and Precision
[0120] According to the method and steps of the present invention, 3 sets of quality control samples (ULOQ, HQC, MQC, LQC, LLOQ) with 5 different known concentrations were prepared, and their copy number concentrations were detected using the standard curve. The accuracy (recovery rate) of each set of quality control samples met the accuracy requirements of the qPCR quantification method in the pharmaceutical field. The accuracy of all samples in each set was within 50 - 150%, for example, basically stable within 80 - 120%, and the accuracy between batches of each set was between 80 - 120%. The precision (CV%) was within 20%, and the performance of accuracy and precision was very good. The accuracy and precision results of each set of quality control samples and between batches are shown in Tables 8 to 11.
[0121] Table 8 Accuracy and Precision Results of the First Set of Quality Control Samples
[0122]
[0123] Table 9 Accuracy and Precision Results of the Second Set of Quality Control Samples
[0124]
[0125] Table 10 Accuracy and Precision Results of the Third Set of Quality Control Samples
[0126]
[0127] Table 11 Accuracy and Precision Results between Batches
[0128]
[0129] Example 6: Case for Investigating Matrix Effect
[0130] Based on the method described in the present invention, analytes with a target concentration of 25,000 copies per microgram or per reaction were prepared using the RNA of tissues or blood from 5 different blank experimental animal mice, and then detected to investigate their recovery rates. The matrix effect investigation results are shown in Table 12.
[0131] Table 12 Results of matrix effect investigation
[0132]
[0133] The results showed that the recoveries of the samples prepared with RNA from 5 mice were all within the acceptable range of 50 - 150% required by the industry. The recovery rate of some individuals was about 90%, indicating that this method has good performance and selectivity and is not easily interfered by matrices from different individual sources.
Claims
1. Use of the mRNA sequence shown in SEQ ID No. 1 in preparing a product for specifically distinguishing human T cells from human tumor cells.
2. Use of a reagent for detecting the mRNA sequence shown in SEQ ID No. 1 in the preparation of a universal mRNA-based preclinical biodistribution detection kit for human T cell products.
3. Use of a primer pair for specifically distinguishing human T cells from human tumor cells in the preparation of a universal mRNA-based human T cell product preclinical biodistribution detection kit, the primer pair being used to amplify the mRNA sequence shown in SEQ ID No. 1; the primer pair consists of a Primer-F forward primer and a Primer-R reverse primer, the Primer-F forward primer is the primer shown in SEQ ID No. 2, and the Primer-R reverse primer is the primer shown in SEQ ID No.
3.
4. Use of a primer-probe set for specifically distinguishing human T cells from human tumor cells in the preparation of a universal human T cell product preclinical biodistribution detection kit based on mRNA, the primer-probe set comprising a primer pair and a probe for specifically distinguishing human T cells from human tumor cells; the primer pair is used to amplify the mRNA sequence shown in SEQ ID No. 1; the primer pair consists of a Primer-F forward primer and a Primer-R reverse primer, the Primer-F forward primer is the primer shown in SEQ ID No. 2, and the Primer-R reverse primer is the primer shown in SEQ ID No. 3; the probe is a Taqman probe with a luminescent group coupled to the 5' end and a quenching group coupled to the 3' end of the gene sequence shown in SEQ ID No.
4.
5. Use of an mRNA standard in the preparation of a product for specifically distinguishing human T cells from human tumor cells, wherein the sequence of the mRNA standard is an mRNA sequence as shown in SEQ ID No. 1 with an extended protection sequence as shown in SEQ ID No. 6 added to the 5' end and an extended protection sequence as shown in SEQ ID No. 7 added to the 3' end.
6. The use according to claim 5, characterized in that The sequence of the mRNA standard is the sequence shown in SEQ ID No.
5.
7. Application of the product for detecting the pharmacokinetic and biodistribution of human T cells in normal mice and tumor-bearing mice based on the mRNA sequence shown in SEQ ID No. 1.
Citation Information
Patent Citations
A universal analytical method for detecting human T cells based on nucleic acid variants
CN116949156B
Method for preparing recombinant Enbrel Fab fragment in insect cell expression system
CN106749664A
Universal analysis method for detecting human T cells based on nucleic acid variants
CN116949156A