Method for identifying camel milk based on milk-derived exosome lncRNA molecular marker
By extracting and analyzing the exosome lncRNA molecular markers in camel milk, the problem of difficulty in accurately identifying camel milk in the prior art is solved, and the high accuracy and reliability of the identification are achieved.
Patent Information
- Application Number
- CN202410485019.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-22
- Publication Date
- 2025-04-25
AI Technical Summary
The prior art is difficult to accurately identify the authenticity of camel milk, especially when distinguishing dairy products from different sources, there is a lack of effective molecular marking methods.
By extracting and analyzing exosomal lncRNA molecular markers in camel milk, using bioinformatics tools for comparison and screening, specific primers were designed for qRT-PCR reactions, and the specificity of lncRNA molecular markers were verified.
It achieves a highly accurate identification of camel milk, can effectively distinguish camel milk from other animal milk, and improves the accuracy and reliability of the identification.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a method for identifying camel milk based on exosome lncRNA molecular markers. Background Art
[0002] Camel milk is a nutritious animal milk that contains a high proportion of unsaturated fatty acids, vitamins, minerals and immunoglobulins. Camel milk is very popular in some areas due to its unique nutritional value and health benefits. However, due to its high price, there are some cases of adulteration in the market, so the authenticity of camel milk has become an important issue. At present, the identification of camel milk mainly includes sensory identification, that is, identifying camel milk by tasting, smelling and observing sensory characteristics such as color, but this method relies on personal experience and sensory sensitivity and has limited accuracy; physical and chemical methods, that is, determining the content of fat, protein, lactose, ash, etc. in camel milk, and using colorimetry. These methods can provide certain identification capabilities, but cannot distinguish all types of adulteration; electrophoresis techniques, such as whey protein electrophoresis, can be used to analyze the protein components in milk, thereby distinguishing milk from different sources; immunological methods, using antibodies to bind to specific components in milk to detect specific dairy products, this method has high specificity and sensitivity; spectral techniques, such as infrared spectroscopy, nuclear magnetic resonance, etc., can be used to analyze the molecular structure and composition of milk. However, there is currently no method for identifying camel milk through nucleic acid molecular markers.
[0003] Exosomes are small vesicles secreted by cells, with diameters usually between 30 and 150 nm. Exosomes are widely present in animal body fluids, such as blood, urine, saliva, semen, and milk. In recent years, research on milk exosomes has gradually increased, and their composition and function have attracted widespread attention. The composition of milk exosomes is very complex, including lipids, proteins, nucleic acids, and cytokines. As a marker, exosomes and their contents have long-term stability. They are relatively stable in the in vivo and in vitro environment, not easily degraded and destroyed, and can maintain their biological activity and information content. The composition and content of proteins and nucleic acids in exosomes can reflect the biological state and functional specificity of the cells from which they are derived. The nucleic acid molecules contained in exosomes, such as miRNA, cirRNA, and lncRNA, also have certain species specificity. Compared with miRNA, lncRNA is longer, less conserved among different species, and more stable as a molecular marker; cirRNA has a lower expression level in cells. Therefore, miRNA and cirRNA are not suitable as a molecular marker to distinguish different species, while lncRNA is more suitable as a molecular marker to distinguish the origins of different species. Summary of the invention
[0004] In order to address the gaps in the prior art, the present invention provides a highly accurate method for identifying camel milk based on molecular markers.
[0005] To achieve the above object, the present invention provides a method for identifying camel milk based on exosome lncRNA molecular markers, comprising the following steps: A. Collection and pretreatment of milk samples Milk samples from four animals, camel, horse, donkey and cow, were collected. The colostrum samples were centrifuged twice to preliminarily remove casein and milk fat, and the middle layer whey was collected.
[0006] B. Extraction of exosomes from cow and camel milk A certain amount of rennet solution is prepared, and casein is coagulated by rennet in the middle layer whey pretreated in step A, and the residual casein is removed by centrifugation, and the supernatant is collected; Filter the supernatant in step (1) using a filter and centrifuge again to collect the supernatant; Filter the supernatant in step (2) again using a filter and centrifuge to collect the supernatant; Ultracentrifuge the supernatant in step (3) to enrich the exosome precipitate; C. Extraction of exosomes from donkey milk and horse milk Centrifuge the middle layer whey pretreated in step A again and filter it using a filter to collect the supernatant. The supernatant in step (1) is centrifuged again and filtered to collect the supernatant; The supernatant in step (3) is subjected to ultracentrifugation to enrich the exosome precipitate; D. Extraction of milk exosome RNA Add lysis buffer to the exosomes and shake vigorously to fully lyse the exosomes; Add enzyme-free water, mix thoroughly, place on ice and centrifuge; After centrifugation, slowly transfer the top layer of liquid to a new centrifuge tube; Add isopropanol equal in volume to the upper liquid, mix thoroughly, place on ice and centrifuge again; Discard the supernatant, add ethanol, wash the precipitate and centrifuge again; Repeat step (5) and discard as much supernatant as possible; Add enzyme-free water to fully dissolve the RNA precipitate.
[0007] Bioinformatics screening of lncRNA molecular markers based on milk exosome sequencing data Comparison with the reference genome was performed using Hisat2 software Stringtie software was used to annotate and merge transcripts with the reference genome file; The merged new transcripts were annotated using Cuffcompare software; Gffread software was used to align the extracted sequences with the reference genome; CPC software was used to predict the coding capacity of transcripts; Cis-acting prediction to obtain neighbor gene pairs between lncRNA and coding genes Screening of lncRNA molecular markers in camel milk using ENSEMBL Blast tool F qRT-PCR reaction of lncRNA molecular markers in camel milk exosomes Reverse transcribe the exosomal RNA into cDNA using reverse transcriptase; Design specific primers based on the lncRNA molecular marker sequence of camel milk exosomes; Configure the PCR reaction system, set the PCR cycle parameters, and perform the PCR reaction; After the PCR, an appropriate amount of PCR product was taken for agarose gel electrophoresis, and the gel was irradiated with ultraviolet light and the bands were observed using a gel imaging system to verify the expression of camel milk lncRNA molecular markers in the milk of the four animals and detect the specificity of camel milk lncRNA molecular markers.
[0008] Furthermore, in step A, the activity of rennet is 1:100000 (European Commercial Unit, Berridge method), and the amount is 0.15 mg rennet per ml sample; the amount of 1% NaCl solution used is 500 ul.
[0009] Furthermore, the filters used in step A and step B are 0.45um and 0.22um disposable sterile syringe filters.
[0010] Furthermore, the exosomes enriched in step A are precipitated as camel milk and cow milk exosomes.
[0011] Furthermore, the exosomes enriched in step B are precipitated as donkey milk and horse milk exosomes.
[0012] Furthermore, the exosome RNA extracted in step D is camel, cow, donkey, or horse milk exosome RNA.
[0013] Furthermore, the cDNA used in step E is obtained by reverse transcription of exosome RNA from camel, cow, donkey, or horse milk. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 This is the sequence matching situation between the molecular marker sequence 1 provided in Example 1 of the present invention and the ENSEMBLE camel reference genome.
[0015] Figure 2This is the sequence matching situation between the molecular marker sequence 2 provided in Example 1 of the present invention and the ENSEMBLE camel reference genome.
[0016] Figure 3 This is a peak diagram of the qRT-PCR melting curve of the camel milk molecular marker sequence-primer and camel cDNA provided in Example 1 of the present invention.
[0017] Figure 4 This is a peak diagram of the qRT-PCR melting curve of the camel milk molecular marker sequence second primer and camel cDNA provided in Example 1 of the present invention.
[0018] Figure 5 The results of qRT-PCR agarose gel electrophoresis of the camel milk molecular marker sequence-primer provided in Example 1 of the present invention and the camel, cattle, donkey and horse milk exosome cDNA.
[0019] Figure 6 The results of qRT-PCR agarose gel electrophoresis of the camel milk molecular marker sequence primer provided in Example 1 of the present invention and the exosome cDNA of camel, cattle, donkey and horse milk.
[0020] Figure 3 and Figure 4 The peak values of the qRT-PCR melting curves of the primers designed for camel milk molecular markers were almost the same as those of the camel's own cDNA, indicating that the primers had good specificity.
[0021] Figure 5 and Figure 6 The middle hole M is the marker, hole a is for camel, hole b is for cow, hole c is for donkey, and hole d is for horse. The results showed that the camel milk molecular marker sequence 1 and sequence 2 only produced specific bands with the camel milk cDNA itself, and no bands appeared with the exosome cDNA of cow, donkey, and horse milk, indicating that only camel milk contains this molecular marker. DETAILED DESCRIPTION
[0022] The following specific embodiments are used to illustrate the present invention to better illustrate the purpose, technical solutions and advantages of the present invention, but are not used to limit the scope of the present invention. Example
[0023] Collection and preservation of camel, cow, donkey and horse milk samples Four individuals in good physical condition, healthy and disease-free with a lactation period of 2-3 months were selected from each animal for milk sample collection. Before milk collection, the udders were wiped and disinfected with alcohol, and milking was performed using a fully automatic milking machine. About 300 ml of fresh milk sample was collected from each individual.
[0024] Pretreatment of camel, cow, donkey and horse milk samples After collecting fresh animal milk samples, they were quickly placed in a -20℃ refrigerator to cool down. Ice packs were used to keep the temperature low during transportation until they were sent to the laboratory. After being sent to the laboratory, the milk samples were centrifuged at 4℃, 3000×g for 30min to initially remove impurities, milk protein and milk fat in the milk. After pretreatment, the milk samples were frozen in an ultra-low temperature refrigerator at -80℃.
[0025] Extraction of exosomes from camel and cow milk After preliminary centrifugation, the milk and camel milk samples were taken out from the -80°C ultra-low temperature freezer and placed at 4°C for dissolution; Prepare rennet solution in advance, add 0.15 mg rennet per ml sample, weigh an appropriate amount of rennet and dissolve it in 1% saline solution, and activate it in a water bath for 30 minutes; Add activated rennet solution to the sample and place in a water bath to coagulate for 25-30 minutes; After the curdling was completed, the mixture was centrifuged at 4°C, 12,000 × g for 30 min, and the supernatant was collected; The supernatant was centrifuged again at 4°C, 12,000 × g, for 1 h, and filtered using a 0.45 μm pore size filter to remove larger particles and cell debris, and the filtrate was collected; The filtrate collected in the previous step was centrifuged at 4°C, 30,000×g for 1 h, filtered again using a 0.22 μm filter to remove residual particles and cell debris, and the filtrate was collected again; The filtrate from the previous step was centrifuged at 4°C, 120,000×g for 2 h to enrich the exosome precipitate and store it in an ultra-low temperature refrigerator at -80°C.
[0026] Extraction of exosomes from donkey milk and horse milk After preliminary centrifugation, the donkey milk and horse milk samples were taken out from the -80°C ultra-low temperature freezer and placed at 4°C to dissolve; Centrifuge at 4°C, 12,000 × g for 1 h, perform primary filtration on the supernatant using a 0.45 μm pore size filter to remove larger particles and cell debris, and collect the filtrate; The filtrate collected in the previous step was centrifuged at 4°C, 30,000×g for 1 h, filtered again using a filter with a pore size of 0.22 μm to remove residual particles and cell debris, and the filtrate was collected again; The filtrate collected in the previous step was centrifuged at 4°C, 120,000×g for 2 h to enrich the exosome precipitate and store it in an ultra-low temperature refrigerator at -80°C.
[0027] Extraction of exosome RNA from milk of four animals Take out milk exosomes from -80℃ ultra-low temperature freezer, slowly dissolve at 4℃, and open the centrifuge in advance for precooling; Add 500 μL of lysis buffer to the exosomes and vortex vigorously for 3 min to fully lyse the exosomes; Add enzyme-free water at about 2 / 5 of the volume of the lysis buffer, mix thoroughly, and place on ice for 5 min; Centrifuge at 12000×g, 4℃ for 5min. The liquid in the tube is divided into three layers. Slowly transfer the top layer of liquid to a new centrifuge tube. The top layer is about 600μL. Only 500μL can be aspirated to avoid aspirating the middle layer. Add isopropanol equal in volume to the upper liquid, mix thoroughly, and let stand on ice for 10 min; Centrifuge at 12000×g, 4°C for 10 min and discard the supernatant carefully; Add 500 μL of 75% ethanol, flick the bottom of the tube to suspend the precipitate, and invert it several times; Centrifuge at 8000×g, 4°C for 3 min and discard the supernatant. Repeat the steps of adding ethanol and centrifugation, discarding as much supernatant as possible; Place on ice for 5 min to evaporate the residual ethanol in the tube, add 20 μL of enzyme-free water to fully dissolve the RNA precipitate, vortex for 3 min using a vortex shaker or repeatedly pipette to fully dissolve the RNA precipitate, and store at -80°C.
[0028] Bioinformatics screening of lncRNA molecular markers from milk exosome sequencing data Identification of lncRNA The clean data of milk exosomes from four different animals were compared with their respective reference genomes using Hisat2 software to generate sam files, which were then converted into bam files and sequenced. Use Stringtie software to annotate the bam file with the gtf reference genome and merge the transcripts of each biological replicate; use Cuffcompare software to annotate the merged new transcripts; Gffread software was used to align the extracted sequences with the reference genome; CPC software was used to predict the coding ability of transcripts with class code “u”, and the coding transcripts were removed, and the non-coding transcripts were the candidate lncRNAs.
[0029] Cis-acting prediction to obtain neighbor gene pairs between lncRNA and coding genes (1) Use the windowBed tool to search for overlapping regions within 100 bp upstream and downstream from the lncRNA gtf file and the mRNA gtf file, and output the results in the genepair.gtf file.
[0030] (2) Use the “cat” command to select a column of data with lncRNA names and extract the characters of these data. The results are saved in the lncRNA.txt file.
[0031] (3) Use the "cat" command to select the column of data with the mRNA name and extract the characters of this data. The results are saved in the coding.txt file.
[0032] (4) Use the delimiter to select the data of the 10th field, then use the delimiter again to select the data of the 2nd field, and append the results to the gene-name.txt file.
[0033] (5) The lncRNA.txt and coding.txt files are merged, then sorted and duplicated. Finally, the awk command is used to find the lines where the first and second fields are different, and the results are saved in the genepair.txt file.
[0034] (6) Add the gene_name.txt file and output the neighbor gene pairs between the lncRNA and the coding gene within 100 bp upstream and downstream.
[0035] LncRNAs with the same neighbor gene pairs were eliminated, and the remaining lncRNAs were sequenced using the ENSEMBL Blast tool to find lncRNAs that can be used as molecular markers to identify camel milk Screening of lncRNA molecular markers in camel milk using ENSEMBL Blast tool The lncRNA sequence of the camel successfully matches the gene sequence of its own reference genome, but fails to match the reference genome of cattle, donkeys, and horses, or the matching sequence does not overlap with the camel-specific sequence; When the lncRNA successfully matches the Ensembl reference genome gene, the query cover rate (sequence coverage) is 100% and the E value (Expect Value) is 0; The lncRNAs with large expression differences and low average expression levels in two biological replicates were eliminated, and the remaining ones were used as candidate provenance-specific lncRNA markers. The final candidate lncRNAs were determined to be able to serve as camel milk lncRNA molecular markers by designing primers and using qRT-PCR technology.
[0036] The ENSEMBLE Blast results for sequence 1 and sequence 2 are as follows: Figure 1 and Figure 2It shows that sequence 1 is located at bases 214573 to 215658 on camel chromosome 7, and sequence 2 is located at bases 2640041 to 2640646 on camel chromosome 11.
[0037] qRT-PCR reaction of lncRNA molecular markers in camel milk exosomes Reverse transcription to obtain cDNA: The first step is to remove gDNA, prepare a mixed solution in an enzyme-free centrifuge tube, dilute the four animal milk exosome RNA samples to a concentration of 1μg / μL, add 4×gDNA wiper Mix 4 μL, add enzyme-free water to a total volume of 16 μL, mix with a pipette, and react at 42°C for 2 minutes to remove gDNA; the second step is to configure the reverse transcription reaction system, directly add 5×HiScript III qRT SuperMix 4μL to the reaction tube in the first step, mix with a pipette; finally, perform reverse transcription reaction at 37°C for 15 minutes and 85°C for 5 seconds to obtain cDNA.
[0038] The cDNA was subjected to qRT-PCR reaction according to the standard operating procedures of the fluorescence quantitative kit, and the primers designed for the camel milk lncRNA molecular marker were used to amplify the milk exosome cDNA of four species: camel, cattle, donkey, and horse. The primer specificity was verified as follows Figure 3 and Figure 4 As shown, the PCR reaction system is shown in Table 1: Table 1 PCR reaction system The PCR reaction procedure is as follows: Sample volume: 20 μl Step 1: 94℃30s Step 2: PCR reaction Cycles: 45 Cycles 94℃ 5s 60℃ 30s Step 3: Obtain melting curve Agarose gel electrophoresis Weigh an appropriate amount of agarose powder, add TAE buffer and heat until melted; then cool to 50-60°C and add a certain amount of nucleic acid dye; after the comb is inserted, pour the prepared gel into the electrophoresis tank, wait for the colloid to completely solidify, add 5μL of Marker to the first well, and then load the sample. The sample volume is adjusted according to the concentration, ranging from 3-4μL; after loading, turn on the power supply, the voltage is 120V, the current is 110mA, and the electrophoresis can be completed in about 25 minutes.
[0039] Agarose gel electrophoresis results Figure 5 and Figure 6As shown, it was found that molecular marker sequence 1 and sequence 2 met the requirements for being used as molecular markers for identifying camel milk, so molecular marker sequence 1 and sequence 2 were used as lncRNA molecular markers for identifying camel milk.
Claims
1. A method for identifying camel milk based on exosome lncRNA molecular marking, It is characterized in that Including lactation exosome extraction and exosome RNA extraction, bioinformatics screening of lncRNA molecular markers, and qRT-PCR of camel milk molecular markers.
2. In the collection and pretreatment of the milk sample according to claim 1, It is characterized in that The milk samples collected and used are four animal milks: camel milk, donkey milk, horse milk and cow milk.
3. The bioinformatics screening lncRNA molecular marker of the lactate exosome sequencing data as claimed in claim 1, It is characterized in that Cis-acting (cis-acting) prediction was performed on candidate lncRNAs to identify neighbor gene pairs with mRNA, excluding lncRNAs with the same neighbor gene pairs, and lncRNAs with homology were eliminated.
4. The bioinformatics screening lncRNA molecular marker of the lactate exosome sequencing data as claimed in claim 1, It is characterized in that The candidate lncRNA predicted by cis-acting was compared with the reference genomes of four animals, namely Ensembl camel, cattle, donkey and horse, and lncRNAs with specificity in camel were screened out.
5. The bioinformatics screening lncRNA molecular marker of the lactate exosome sequencing data as claimed in claim 1, It is characterized in that Candidate lncRNAs with large differences in expression levels and low average expression levels screened by the Ensembl Blast tool were eliminated. The remaining lncRNAs can be used as an identification molecular marker for camel milk by designing primers and using qRT-PCR technology.
6. In the qRT-PCR of camel milk molecule labeling according to claim 1, It is characterized in that The molecule is labeled as lactate exosome lncRNA.
7. In the qRT-PCR of camel milk molecule labeling according to claim 1, It is characterized in that The nucleotide sequence marked by the lncRNA molecule of camel milk is: Sequence 1: TCAATGTTTTAAAGAAATAAATGTTAATGTAATTTTATTACATAAAAAACCCAAATATAGTCATGCATATGCACAGATATTTTTATATCTAAACATAAAAACATTCAATGAATAAAACATTCAATGAATAAAATGATAGAGATTTTCTTTATCATTGAGCTTTATTCTTTCCTGAACTTAAGGTTATTTCAGGTACTTCAGGGCTCCAGAGCTTGC CAGGAGACGCACATGTCCAAGAAGGCCAGTCCCCAGCAGGGAAGCAGGATGGAGCCCCCAGGTGCAGGTAGGTCACGGCAGGATGGGGTACTGGGGATGGTCGAAGGCAGGCAGGGAGGCTCGGGGTCAGGCAACGGGGAGGAAGCATCGGGGTGTATGTGGGCACAGGTAGGCCAAGGCAGGATGGAGTGAGGGCGCTGTGGGGACC CAAGTAGGAAGGGAGGGGAGGGTGCTTCAGGAGCCAGGGTCGGGTATCCCCCCCCCCCCACCTCCTCCTGCCCCCAAAGCAGCTGAGTCCCCTCCCTGAGCTCCCTGTCGGACAGGCCCAGCTTGGCATCTGCGTCCTTGCCCCCAAGTTGCTACACGGCTCCCCCCTCATCTGGAGCCCCGGCCACCTTTTCTTTCCCACCAGACT GAATGCATCTTTGGACATGTGGCTCTGGGATGAAATGTTTCCAGGGCACTTCATTGGCACTCTTAACTCGTGTCATAACACACCTGAATTGTTTTATAAGTACGTTTATAAATAGCTTATTCACAAGAATATCAAACTTCCTTCATTTGGTCAACATTGACAGATTGTAATTTTAGCATGTTATACAATTACTTCAATTAAGTTAAGTTAATTAAGTTAATTAAGTTAATTAAGTTAATTAAGTTAATT TTTCCCCCCTTTATCCGTGATCTTCTACAGACAAAAACTGGTCTGCTATTAGCTTAGAGTCCATCTCTGCCTTTGCTCTTTCATTTTTCCTGAACTTCTCTCGTGGGATAATTTCTCATTGCTTTCCCTGATCCTAACTTATTATAATTAAGTGGGTGTAGGAATAGGAATATAGTATAGTTATGAATGTAATTCCATTA TTCTAAATTGATTTAAATTTACTTAA Sequence 2: GAGCCCACAAACCCCTATTAAACACTATGCCACCAAAAAGTAATCGTCCCACCCGTCCCGACGAGCCCAAGAATCCAGAGACAAGGTCTTGGAGCTTAGAAGCAAAGAGGCCATTTTATCGCTCTGCCGGCAAAGGGGATTCACAGCAGGCTAGCGTCTTCAAAACTGTGACCACCTT GGGGATGGAGTGGGTGGGTGGTGGTTCTAGAGCCATAGCTCAAACAATCGGGCATCGATCACCACAGAATCGTTTTCTCATCAGAAGACTCAGAATGGTGTCACGATGCCTCCAGGTGACCCATTCTATAGAGGCTGGTGGTTAGATCTCGTTATCTCATCAAGCACTCAAGGTGGCCTTCTTGGTCACTCAGGCTATTTTGTCAGGTC ATTAGTCCCGTGACCGACCTTCTCCTCGGAGAAAGACTCAGAGACCCAGCATGATGATGACTTTCAATGAGTGAAATACAGTAAGATCGATAGCTTCCAGTTCAACAACAGGCCTGGAAACCGTGAGCCGCCACCAGCAAGTCAGACAGTTGACCGTTTCAGGGCGAGCATAAGAAACCGAATGACACCCCCCCCCCCAGCA.
8. In the qRT-PCR method of camel milk molecule labeling according to claim 1, It is characterized in that The upstream and downstream primers for the lncRNA molecule labeling of camel milk are: Sequence one upstream primer: CAAGGCAGGATGGAGTGAGGG Sequence primers: AGAGTGCCAATGAAGTGCCC Sequence 2 upstream primer: AGGGGATTCACAGCAGGCT Sequence 2 downstream primer: GAGTGACCAAGAAGGCCACA.
9. The length of the qRT-PCR primer product labeled by the camel ncRNA molecule of claim 1 is: sequence-345nt; sequence-2245nt.