A SNP molecular marker related to immune characteristics of yaks and application thereof

Abstract

This invention relates to the field of biological detection technology, and more particularly to a SNP molecular marker related to the immune characteristics of yaks and its application. The invention provides an SNP molecular marker for detecting the immunoglobulin content in yaks. The SNP molecular marker is located at position 107100737 on chromosome 2 of the yak reference genome LU_Bosgru_v3.0, with a mutated base of A or G. Based on the molecular marker alleles, yaks exhibit three genotypes: AA, AG, or GG. This invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes, and provides a basis for yak assisted breeding.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, and in particular to a SNP molecular marker related to the immune characteristics of yaks and its application. Background Technology

[0002] As a typical livestock in high-altitude and cold regions, the yak's unique survival and reproductive capabilities are a direct result of the harsh environment. Its immune system, as a key line of defense, exhibits remarkable adaptability, a crucial factor in its survival in these areas. A deeper understanding of the yak's immune characteristics can provide more scientific guidance for its feeding and management practices, improving its disease resistance and productivity.

[0003] Currently, disease-resistant breeding plays a crucial role in livestock production. It not only significantly enhances yaks' resistance and immunity to various pathogens, thereby reducing disease incidence, but also effectively reduces the use of antibiotics and other drugs. This is of great significance for maintaining ecological balance, reducing environmental pollution, and ensuring the safety and quality of livestock products. By utilizing advanced molecular marker technology, it is possible to precisely select and identify disease-related genes at the molecular level. This means that disease resistance can be accurately screened and evaluated in individuals early in their growth. This early screening method based on the molecular level not only greatly improves the efficiency and accuracy of disease-resistant breeding but also significantly shortens the breeding cycle and reduces breeding costs.

[0004] Based on this, the present invention is proposed. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker related to the immune characteristics of yaks and its application.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides an SNP molecular marker for detecting the immunoglobulin content in yaks. The SNP molecular marker is located at the 107100737th base on chromosome 2 of the yak reference genome LU_Bosgru_v3.0, and the mutated base is A or G.

[0008] Preferably, the immunoglobulin is one or more of immunoglobulin A, immunoglobulin G, and immunoglobulin M.

[0009] Preferably, based on molecular marker alleles, yaks have three genotypes: AA, AG, or GG.

[0010] The levels of immunoglobulin A and immunoglobulin G in yak individuals with genotype GG were significantly higher than those in yak individuals with genotypes AA or AG.

[0011] The content of immunoglobulin M in yak individuals with genotype GG was significantly higher than that in yak individuals with genotype AA.

[0012] The present invention also provides the application of the aforementioned SNP molecular marker in the preparation of products for detecting immune traits in yaks.

[0013] This invention also provides the application of the aforementioned SNP molecular marker in the preparation of products for the assisted breeding of yaks with high immunity.

[0014] The present invention also provides a primer pair for detecting the content of yak immunoglobulins using SNP molecular markers, the primer pair being shown in SEQ ID NO.1-2;

[0015] The SNP molecular marker is the SNP molecular marker described above.

[0016] The present invention also provides the application of the primer pair described herein in the preparation of products for detecting the immune traits of yaks and / or in assisting the breeding of yaks with high immunity.

[0017] This invention also provides a method for using SNP molecular markers to assist in the breeding of yaks with high immunity, comprising the following steps:

[0018] (1) Extracting yak genomic DNA;

[0019] (2) Using the genomic DNA obtained in step (1) as a template, perform PCR amplification using the primer pair to obtain PCR amplification products;

[0020] (3) Genotyping of PCR amplification products was performed to obtain yaks with different genotypes. The genotypes of yaks were associated with immunoglobulins, and yaks with high immunoglobulin content were screened to obtain yaks with high immunity.

[0021] The PCR amplification system consisted of: 12.5 μL of 2×L-Exp Taq Master Mix (dye plus), 8.5 μL of RNase-free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template DNA.

[0022] The PCR amplification program was as follows: 98℃ for 2 min; 98℃ for 10 s, 54℃ for 30 s, 72℃ for 10 s, for a total of 35 cycles; extension at 72℃ for 2 min.

[0023] The present invention also provides the application of the method in screening yaks with high immunity.

[0024] The present invention also provides a kit for detecting yak immune traits or assisting in the breeding of yaks with high immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0025] This invention provides a SNP molecular marker related to the immune characteristics of yaks and its application. The SNP molecular marker used in this invention to detect the immunoglobulin content in yaks is located at position 107100737 on chromosome 2 of the yak reference genome LU_Bosgru_v3.0, with a mutant base of A or G. When position 107100737 on chromosome 2 is A, the yak genotype is AA or AG. When position 107100737 on chromosome 2 is G, the levels of immunoglobulin A and immunoglobulin G in yak individuals with genotype GG are significantly higher than those in yak individuals with genotypes AA or AG. The levels of immunoglobulin A and immunoglobulin G were measured (p<0.05); the level of immunoglobulin M in yak individuals with genotype GG was significantly higher than that in yak individuals with genotype AA (p<0.05); by detecting the base at nucleotide site 107100737 on yak chromosome 2, the levels of IgA, IgG, and IgM in yak individuals can be determined. This invention provides a new SNP molecular marker resource for yak immune trait marker-assisted selection for non-diagnostic purposes, and provides a basis for yak assisted breeding. Attached Figure Description

[0026] Figure 1 This is the PCR amplification product; where M represents the marker.

[0027] Figure 2 The peak diagram and sequence are obtained after PCR products are purified and sequenced. Detailed Implementation

[0028] The present invention also provides an SNP molecular marker for detecting the immunoglobulin content in yaks, wherein the SNP molecular marker is located at the 107100737th base on chromosome 2 of the yak reference genome LU_Bosgru_v3.0, and the mutated base is A or G;

[0029] The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G, and immunoglobulin M.

[0030] In this invention, the primer pairs are as shown in SEQ ID NO.1-2;

[0031] Upstream primer SEQ ID NO.1: 5'-TCTGAGCAAGTAACACATTCC-3';

[0032] Downstream primer SEQ ID NO.2: 5'-TCCTGACATTGGGTCTGATTA-3';

[0033] The amplified fragment is 529 bp in length.

[0034] In the present invention, SEQ ID NO.3: TCTGAGCAAGTAACACATTCCTCAGTGAGACACCCCATCTCCTCATATATATACTTAGATCATTACTAGGGCATTTCCCCAGGAGACAAAATTACTAGAACTAGAAGCAAACAAAATGTGTTTCCCCAGGCTTCAAAATGACAAATACCAAGTG TGTGTGGTTTGGGAGGCAGGCATGTGTGTGGGGGCTATAAGTGTAAGCTTGAACACCTCGTGGAGAACTATCAAATCTTATCTATATCTCTTTAGATTACAAATCCCACACCCTTTGCACTATACAATGCTGCCTTTCCAAGGAATGAAGCAAGCCTTGT A GAATCTTTGAAGGGACAATTATGAGCTGAACCAGTTGCATGCCTAAACATTTATGCAGTTAACAAACACACACACACATTTGTAAGTATAAAATAGCTCAATAATTCCTTTTTCTACAAAAAAAAAAGATGCAAAATTCATTTAGAAAGTTAAAGAGAAATAAATTGACTTTACACTAATTCCATTAAATTAATCAGACCCAATGTCAGGA.

[0035] The SNP molecular marker is located at position 315 of SEQ ID NO.3.

[0036] In this invention, the PCR amplification system is as follows: 12.5 μL of 2×L-Exp Taq Master Mix (dye plus), 8.5 μL of RNase-free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template DNA;

[0037] The PCR amplification program was as follows: 98℃ for 2 min; 98℃ for 10 s, 54℃ for 30 s, 72℃ for 10 s, for a total of 35 cycles; extension at 72℃ for 2 min.

[0038] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] 1 Sample Collection

[0041] The samples were obtained from Nya yaks from the pasture in Jiali County, Nagqu City, Tibet Autonomous Region. 5 mL of blood samples were collected from 191 fasting yaks and placed in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 10 min. The supernatant was collected into PE tubes, sealed, and stored at -20°C. Another 5 mL of blood sample was collected and added to blood collection tubes containing EDTA-K2 anticoagulant. The blood samples were quickly mixed after collection, placed in a sampling box with ice packs for temporary storage, and then transported back to the laboratory and frozen at -20°C for DNA extraction.

[0042] 2. Main Reagents and Instruments

[0043] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genome extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikerui Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. Immunoglobulin A (IgA) (MB-4907A), immunoglobulin G (IgG) (MB-4616A), and immunoglobulin M (IgM) (MB-4908A) detection kits were purchased from Jiangsu Enzyme-Label Biotechnology Co., Ltd.

[0044] 3 methods

[0045] 3.1 Detection of immunoglobulins IgA, IgG, and IgM

[0046] The IgA, IgG, and IgM detection kits from Jiangsu Enzyme Biotechnology Co., Ltd. were used for assays using a one-step sandwich method with double antibodies. First, the required strips were removed from the aluminum foil bag after equilibration at room temperature for 20 minutes. The remaining strips were sealed in a resealable bag and returned to 4°C. Standard and sample wells were prepared. 50 μL of different concentrations of standard were added to each standard well. 10 μL of the test sample was added to each sample well, followed by 40 μL of sample diluent. No diluent was added to the blank wells. Except for the blank wells, 100 μL of horseradish peroxidase (HRP)-labeled detection antibody was added to each of the standard and sample wells. The reaction wells were sealed with sealing film and incubated at 37°C in a water bath or incubator for 60 minutes. The liquid was discarded, and the plates were patted dry on absorbent paper. Washing buffer was added to each well, and the plates were allowed to stand for 1 minute. The washing buffer was then discarded, and the plates were patted dry on absorbent paper. This washing process was repeated 5 times (or a plate washer could be used). 50 μL each of substrates A and B were added to each well, and the plates were incubated at 37°C in the dark for 15 minutes. Add 50 μL of stop solution to each well, and measure the OD value of each well at 450 nm within 15 min. Finally, plot the standard curve: In an Excel worksheet, plot the standard concentration on the x-axis and the corresponding OD value on the y-axis to create a linear regression curve of the standard. Calculate the IgA, IgG, and IgM concentrations of each sample according to the curve equation.

[0047] 3.2 Extraction of genomic DNA from blood

[0048] Genomic DNA was extracted from blood samples using the blood genomic extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The extracted DNA was then analyzed for concentration and purity using a UV spectrophotometer. Concentrations >20 ng / μL and OD values ​​>20 were acceptable. 260 / OD 280 A pH between 1.7 and 1.9 is sufficient for experimental needs; store at -20°C for future use.

[0049] 3.3 Primer Design

[0050] Based on the chromosome 2 sequence of the yak genome LU_Bosgru_v3.0, specific primers containing the g107100737A>G SNP site were designed using the Pick Primers online tool provided by NCBI.

[0051] Primer sequence

[0052] F: 5'-TCTGAGCAAGTAACACATTCC-3' (SEQ ID NO: 1);

[0053] R: 5'-TCCTGACATTGGGTCTGATTA-3' (SEQ ID NO: 2).

[0054] The amplified fragment was 529 bp in length, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0055] 3.4 PCR Amplification and Sequencing

[0056] PCR amplification system 25μL: 2×L-Exp Taq MasterMix (dye plus) 12.5μL, RNase free water 8.5μL, upstream primer 1μL, downstream primer 1μL, template DNA 2μL.

[0057] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 54℃ for 30 s, 72℃ for 10 s, for a total of 35 cycles; extension at 72℃ for 2 min.

[0058] PCR products were detected by 1% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Beijing Qingke Biotechnology Co., Ltd. The agarose gel electrophoresis results are as follows: Figure 1 As shown. Figure 1 The PCR-amplified sequence was 529 bp in length. Sequencing revealed an A / G mutation at position 315 of the amplified product (nucleotide 107100737 on chromosome 2 of the LU_Bosgru_v3.0 genome). The amplified product band was clear and free of extraneous bands, demonstrating good specificity. This site was preliminarily identified as a yak SNP marker, named g107100737A>G SNP. The PCR-amplified sequence is shown in SEQ ID NO:3, with an A mutation at position 315. The PCR-amplified product fragment size met expectations and is ready for further experiments.

[0059] SEQ ID NO:3

[0060] TCTGAGCAAGTAACACATTCCTCAGTGAGACACCCCATCTCCTCATATATATACTTAGATCATTACTAGGGCATTTCCCCAGGAGACAAAATTACTAGAACTAGAAGCAAACAAAATGTGTTTCCCCAGGCTTCAAAATGACAAATACCAAGTGTGT GTGGTTTTGGGAGGCAGGCATGTGTGTGGGGGCTATAAGTGTAAGCTTGAACACCTCGTGGAGAACTATCAAATCTTATCTATATCTCTTTAGATTACAAATCCCACACCCTTTGCACTATACAATGCTGCCTTTCCAAGGAATGAAGCAAGCCTTGTA GAATCTTTGAAGGGACAATTATGAGCTGAACCAGTTGCATGCCTAAACATTTATGCAGTTAACAAACACACACACACATTTGTAAGTATAAAATAGCTCAATAATTCCTTTTTCTACAAAAAAAAAAGATGCAAAATTCATTTAGAAAGTTAAAGAGAAATAAATTGACTTTACACTAATTCCATTAAATTAATCAGACCCAATGTCAGGA.

[0061] The sequencing results of PCR products were compared using the bioanalysis software MEGA 11.0, and the sequencing peak diagrams were analyzed to complete the typing.

[0062] 4. Statistical Analysis

[0063] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. Popgen32 software was used to calculate the gene frequency, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test. Polymorphism information content (PIC) software was used to calculate the PIC calculation software. IBM SPSS Statistics 26 software was used to analyze the association between different genotypes in yaks and immunoglobulins IgA, IgG, and IgM using a general linear model. Results are expressed as mean ± standard error.

[0064] 5 Results

[0065] 5.1 PCR amplification and sequencing results

[0066] The amplification products of the g107100737A>G SNP site on yak chromosome 2 were detected using 1% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 529 bp, which met the expected size, and the next step of the experiment could be carried out.

[0067] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2 .Depend on Figure 2 It can be seen that the AG mutation occurs at the g107100737A>GSNP site, resulting in three genotypes: AA, AG, and GG.

[0068] 5.2 Statistical Analysis Results

[0069] Analysis of the genotypes and allele frequencies of the g107100737A>G SNP locus on chromosome 2 of yaks from the perspective of population genetics. As shown in Table 1, at the g107100737A>G SNP locus, the AA genotype frequency was the highest and was the dominant genotype, and the A allele frequency was 77.9%, showing the dominant allele. By χ 2 The adaptability test showed that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.344, and PIC was 0.285. Since 0.25<PIC<0.50, it belonged to moderate polymorphism.

[0070] Table 1 Polymorphism of the g107100737A>G SNP locus on chromosome 2 of yaks

[0071]

[0072] 5.3 Association analysis of different genotypes with IgA, IgG, and IgM

[0073] The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and the contents of immunoglobulins IgA, IgG, and IgM. The results showed that the contents of immunoglobulin A and immunoglobulin G in yak individuals with the GG genotype were significantly higher than those in yak individuals with the AA or AG genotype, and the content of immunoglobulin M in yak individuals with the GG genotype was significantly higher than that in yak individuals with the AA genotype (p<0.05). The results are shown in Table 2.

[0074] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0075]

[0076] Note: Different lowercase letters marked between data in the same row indicate significant differences (P<0.05).

[0077] As shown in Table 2, the contents of immunoglobulin A and immunoglobulin G in yak individuals with the GG genotype were significantly higher than those in yak individuals with the AA or AG genotype, and the content of immunoglobulin M in yak individuals with the GG genotype was significantly higher than that in yak individuals with the AA genotype (p<0.05), indicating that the bases at the g107100737A>G SNP locus on chromosome 2 of yaks were significantly correlated with yak IgA, IgG, and IgM (p<0.05), and were SNP markers related to yak IgA, IgG, and IgM.

[0078] This invention provides a SNP molecular marker related to the immune characteristics of yaks and its application. The SNP molecular marker used in this invention to detect the immunoglobulin content in yaks is located at position 107100737 on chromosome 2 of the yak reference genome LU_Bosgru_v3.0, with a mutant base of A or G. When position 107100737 on chromosome 2 is A, the yak genotype is AA or AG. When position 107100737 on chromosome 2 is G, the levels of immunoglobulin A and immunoglobulin G in yak individuals with genotype GG are significantly higher than those in yak individuals with genotypes AA or AG. The levels of immunoglobulin A and immunoglobulin G were measured (p<0.05); the level of immunoglobulin M in yak individuals with genotype GG was significantly higher than that in yak individuals with genotype AA (p<0.05); by detecting the base at nucleotide site 107100737 on yak chromosome 2, the levels of IgA, IgG, and IgM in yak individuals can be determined. This invention provides a new SNP molecular marker resource for yak immune trait marker-assisted selection for non-diagnostic purposes, and provides a basis for yak assisted breeding.

[0079] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of a reagent for detecting a molecular marker in the preparation of a product for detecting the content of maternal bovine immunoglobulin, characterized in that, The molecular marker is located at the 107100737th base on chromosome 2 of the yak reference genome LU_Bosgru_v3.0, with the mutated base being A or G; The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G, and immunoglobulin M; The levels of immunoglobulin A and immunoglobulin G in yak individuals with genotype GG were significantly higher than those in yak individuals with genotypes AA or AG. The content of immunoglobulin M in yak individuals with genotype GG was significantly higher than that in yak individuals with genotype AA.

2. Use according to claim 1, characterized in that, The reagent is a primer pair, as shown in SEQ ID NO. 1~2.

3. A method for marker assisted selection of immune traits in yaks for non-disease diagnostic purposes, characterized by, Includes the following steps: (1) Extracting yak genomic DNA; (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.1~2 to obtain the PCR amplification product; (3) Genotyping of PCR amplification products was performed to obtain yaks with different genotypes. The genotypes of yaks were associated with immunoglobulins, and yaks with high immunoglobulin content were screened. The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G, and immunoglobulin M; The levels of immunoglobulin A and immunoglobulin G in yak individuals with genotype GG were significantly higher than those in yak individuals with genotypes AA or AG. The content of immunoglobulin M in yak individuals with genotype GG was significantly higher than that in yak individuals with genotype AA. The yak in question is the Nya yak; The PCR amplification system is: 2x L-Exp Taq Master Mix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template DNA 2 μL; The PCR amplification program was as follows: 98℃ for 2 min; 98℃ for 10 s, 54℃ for 30 s, 72℃ for 10 s, for a total of 35 cycles; extension at 72℃ for 2 min.

Images