Helicobacter pylori virulence genotyping / mutation and drug-resistant gene mutation detection kit and signal calculation method

Abstract

The invention discloses a detection kit suitable for helicobacter pylori virulence genotyping / mutation and drug-resistant gene mutation in an excrement sample and a signal calculation method. The kit comprises a primer / probe / capture probe for specifically detecting the following genes or mutation sites or polymorphisms on the genes: an infectious gene, a virulence typing gene (VacA / CagA / CagL / HtrA), a clarithromycin drug-resistant gene, a tetracycline drug-resistant gene, a levofloxacin drug-resistant gene, an amoxicillin drug-resistant gene, a metronidazole drug-resistant gene and a furazolidone drug-resistant gene, the kit comprises a cytochrome P450 enzyme 2C19 gene and an exogenous internal standard primer / probe / capture probe. The signal calculation method can make the detection result more intelligent and standardized. According to the kit, one-time polymorphism detection of helicobacter pylori infection, virulence typing, drug resistance type and proton pump inhibitor related metabolic genes can be achieved from samples such as excrement and gastric mucosa of a patient, and hierarchical management and radical treatment of helicobacter pylori can be achieved clinically in an auxiliary mode.

Description

Technical Field

[0001] The present invention belongs to the field of microbial detection, and in particular relates to a Helicobacter pylori virulence gene typing / mutation and drug resistance gene mutation detection kit and a signal calculation method. Background Art

[0002] The occurrence of gastric cancer is related to many factors. Among them, Helicobacter pylori (Hp) has been confirmed to be a Class I carcinogen of gastric cancer. Eradication of Hp can reduce the risk of gastric cancer and the mortality rate related to gastric cancer.

[0003] Helicobacter pylori is a fastidious bacterium. It has strict requirements on the gas environment and nutritional conditions for in vitro isolation and culture, and it grows slowly. Generally, it takes 48 to 72 hours of culture at 37°C under microaerobic conditions to grow into needle-shaped colonies. Helicobacter pylori is a tiny spiral Gram-negative bacterium. The typical culture is S-shaped, C-shaped or seagull-shaped under an optical microscope. The bacteria may become spherical if the culture time is prolonged in vitro, nutrition is deficient or under antibiotic pressure. There are bundles of flagella at the end of the bacteria, which play a key role in bacterial movement; there is no obvious capsule and no spores are produced.

[0004] H. pylori isolates can show a wide diversity in polymorphisms of virulence factor genes, which may determine the increased risk of developing gastrointestinal diseases. Finding virulence factors in infected H. pylori isolates may identify risk groups for early treatment to control adverse outcomes, especially gastric cancer.

[0005] Helicobacter pylori eradication treatment often uses a combination of two or three antibiotics, combined with acid inhibitors (such as proton pump inhibitors) and bismuth-containing protective agents. With the gradual increase in antibiotic resistance, the success rate of eradication of Helicobacter pylori infection is decreasing. Data show that the resistance rates of Helicobacter pylori infection in patients with initial diagnosis to clarithromycin, metronidazole and levofloxacin are 25%, 30% and 20%, respectively; while the resistance rates of Helicobacter pylori infection in patients with follow-up visits to clarithromycin, metronidazole and levofloxacin have increased, reaching 66%, 54% and 28%, respectively. This can also explain why some patients fail after the initial eradication treatment and need to change antibiotics for further treatment. This abuse has promoted the occurrence of Hp multidrug resistance, causing patients to go through many twists and turns in the treatment process, and is also prone to waste of medical resources. In addition to antibiotic resistance affecting the eradication rate, human metabolism of the CYP2C19 gene also affects the efficacy of proton pump inhibitors. If the patient's metabolism of the CYP2C19 gene is not clear before treatment, and the treatment plan cannot be adjusted in time, it is likely to lead to treatment failure. Reselecting a new proton pump inhibitor will increase the burden of treatment.

[0006] Metronidazole is a drug precursor with antibacterial activity. It can be reduced to nitroso derivatives and hydroxylamine derivatives. The reduction products are cytotoxic and can degrade and break bacterial DNA and even cause bacterial death. Hp resistance to metronidazole is mainly related to mutations related to the rdxA gene.

[0007] Clarithromycin is a macrolide antibiotic that can bind to the ribosomes in bacteria and inhibit their protein synthesis. If the Hp 23s rRNA gene site mutates, it can cause changes in the ribosome structure, thereby affecting the binding of clarithromycin to the Hp ribosome, thereby causing drug resistance.

[0008] Amoxicillin is the only β-lactam drug used to treat Hp infection. It can penetrate the bacterial cell wall, bind to the penicillin-binding protease in the bacterial inner membrane, interfere with cell wall synthesis and cause bacterial death. The mutation of the PBPI gene site on Hp is the cause of amoxicillin resistance.

[0009] Levofloxacin is a fluoroquinolone antibiotic, and its main mechanism of action is to inhibit the activity of bacterial DNA gyrase and hinder the replication of bacterial DNA. Mutations in the gyrA gene of Hp can cause Hp to become resistant to levofloxacin.

[0010] Furazolidone belongs to the nitrofuran class of drugs, and its mechanism of action is similar to that of metronidazole (but is not affected by the rdxA gene). It mainly interferes with the oxidoreductase of bacteria, thereby blocking the normal metabolism of bacteria and exerting an antibacterial effect. Mutations in the Pord and Oord gene-related sites of Hp will affect Hp's resistance to furazolidone.

[0011] Tetracycline is an antibacterial drug that mainly interacts with the 16S rRNA of the bacterial ribosome 30S subunit to prevent the binding of aminoacyl-tRNA to the ribosome, thereby affecting peptide chain extension and hindering protein synthesis. Most scholars believe that Hp tetracycline resistance is related to mutations in the AGA926-928 site of the 16S rRNA gene. This region is located at the helix31 of the Hp ribosome and is the main binding site for tetracycline and 16S rRNA. Nucleotide mutations in the helix31 region will affect the affinity of 16SrRNA for tetracycline binding, and then affect the antibacterial effect of tetracycline.

[0012] Urease A (UreA) is a highly conserved subunit of the Hp urease structural gene and is a marker of Hp infection.

[0013] Helicobacter pylori contains two genes, VacA and CagA, which encode vacuolating toxin and cytotoxin-related proteins, respectively. According to the expression of these two genes, HP strains are divided into two main types: type I and type II. Type I contains CagA and VacA genes and expresses one or both of them, i.e., the combination of VacA gene middle region type M1, M2 and signal sequence type S1, S2 (S1 / M1, S1 / M2, S2 / M1, S2 / M2) needs to exist at the same time as CagA gene, and type I is closely related to gastric diseases. Type II does not contain CagA gene, does not express two proteins, has weak toxicity, and generally has no obvious clinical symptoms after infection.

[0014] The vacuolating cytotoxin A (VacA) gene is commonly found in Hp and encodes a vacuolating cytotoxin. VacA is the main virulence factor of Hp strains. The VacA gene is composed of two signal transduction regions (sl, s2) and two central regions (ml, m2). The gene type of VacA determines the toxicity level of Hp clinical isolates. Generally speaking, the s1m1 strain of VacA produces a large amount of toxin and has a high activity of vacuolation in gastric epithelial cells, the s1m2 strain produces a moderate amount of toxin, the s2m2 produces little or no toxin, and the s2m1 is very rare. Therefore, the s1m1 and s1m2 genotypes encode highly toxic or moderately toxic proteins, which are commonly found in patients with gastric diseases, and the s1m1 genotype increases the risk of gastric cancer and peptic ulcers. The s2m2 and s2m1 genotypes encode low-toxic proteins and are rarely associated with peptic ulcers or gastric cancer. Therefore, testing the VacA genotype helps to understand the pathogenic mechanism of Hp and determine the severity of the disease, providing assistance for the treatment of Hp-infected patients.

[0015] As a component of the type VI secretion system (T4SS), CagL binds to the basolateral side of the host gastric epithelium with integrin α5β1 to promote CagA translocation leading to carcinogenesis. Helicobacter pylori isolates with CagL amino acid polymorphism Y58 / E59 carry a 4.6-fold increased risk of gastric cancer using higher integrin α5β1. In addition, it has been reported that Helicobacter pylori CagL-Y58 / E59 can activate higher integrin α5β1 under adverse pH conditions, thereby promoting the vicious cycle of hypochloraemic acidosis in gastric carcinogenesis.

[0016] The high temperature requirement A (HtrA) protein is a chaperone and serine protease. H. pylori HtrA consists of a signaling domain, a serine protease domain, and PDZ-1 and PDZ-2 domains. HtrA secreted by H. pylori opens tight junctions and adherens junctions by cleaving the extracellular domains of occludin, mucin-8, and e-cadherin, so that H. pylori can cross the epithelial monolayer to the basolateral membrane to interact with integrin α5β1 and T4SS-injected CagA.

[0017] Studies have shown that Helicobacter pylori isolates carrying HtrA-171Leu are associated with an increased risk of GC, and may work alone or in conjunction with CagL-58Tyr / 59Glu to promote the risk of gastric cancer. The two targets, HtrA-171Leu and CagL-58Tyr / 59Glu, can be used to screen people at risk of eradicating Helicobacter pylori, thereby hindering its carcinogenic process.

[0018] The shared dining system makes children more susceptible to Hp infection. Most adult Hp infections are acquired in childhood, mostly in early childhood. After infection, it is generally difficult to clear spontaneously, leading to lifelong infection. At present, clinical diagnosis and treatment adopt pathological examination of Helicobacter pylori and its drug resistance, and the method of obtaining gastric mucosa by gastroscopy for children and the elderly seriously hinders the general public's awareness of the harm of Helicobacter pylori and the desire to eradicate Helicobacter pylori. Therefore, a non-invasive method is needed to achieve individualized eradication treatment of Hp infection. It is a simple, comfortable, non-invasive and inexpensive method to detect Helicobacter pylori through feces. However, the composition of feces is complex, including gastrointestinal mucosal cells, Hp, various gastrointestinal flora, food residues, proteins, fats, pigments, etc., and the genomic DNA in feces will be severely fragmented and degraded, making its content in feces extremely low, making it very difficult to extract high-quality DNA from feces. At the same time, the quality of extracted DNA is not high, and even some components in feces will inhibit the later PCR reaction. At the same time, the existing respiratory tests can only detect infection. For the detection of Pylori in fecal samples, it is currently impossible to isolate and culture the Pylori and conduct drug sensitivity tests because it involves intestinal microecology. It can be seen from the existing published patents that the public information does not fully cover the detection of Pylori virulence genes, Pylori infection dual-target detection, mutation sites of drug-resistant genes, and polymorphism detection of proton pump inhibitor-related metabolic genes, and basically only partial molecular detection can be achieved in gastric mucosal samples.

[0019] Therefore, there is a need in the art for a method that can accurately identify Helicobacter pylori, virulence type and resistance type, and polymorphism of proton pump inhibitor-related metabolic genes in fecal samples, while realizing a chip signal calculation method to facilitate automated judgment of result detection, making the test results more intelligent and standardized, so as to take targeted treatment measures, thereby increasing the Helicobacter pylori eradication rate and reducing the risk of cancer. Summary of the invention

[0020] In view of one or more problems existing in the prior art, the object of the present invention is to provide a kit and a signal calculation method for rapidly detecting Helicobacter pylori virulence gene typing / mutation and drug resistance gene mutation using stool samples.

[0021] A kit for detecting virulence gene typing / mutation and drug resistance gene mutation of Helicobacter pylori, comprising a reaction solution and a nucleic acid extraction reagent for specifically detecting the following genes and their mutation sites and polymorphisms:

[0022] In some embodiments, Helicobacter pylori-related gene mutations and polymorphisms and their site information are:

[0023] CagL gene: sites 172-174 (GAT / AAT / TAT) and 175-177 (AAA / GAA);

[0024] HtrA gene: 511-513 sites (TCA / TTA / TTG);

[0025] 23s rRNA gene: 2142-2144 positions (AAA / GAA / CAA / AGA);

[0026] 16s rRNA gene: 926-928 positions (AGA / TTC / GTA / GGA / AGC / TGA / ACG);

[0027] GyrA gene: 259-261 sites (AAT / AAC / AAG / AAA / ATC), 271-273 sites (GAT / GGT / TAT / AAT);

[0028] PBP1 gene: T556S (1666-1668 is ACC / AGC), N562Y / D (1684-1686 is AAT / TAT / GAT);

[0029] rdxA gene: 148C>T / 184T>G / 565G>T, 616-618 position (GCA / GCG / ACG)

[0030] porD gene: 357C>T / 356A>G / 353G>A;

[0031] oorD gene: 41A>G / 122A>G / 349C>A / G;

[0032] CYP2C19 gene: 636A>G / 681A>G.

[0033] In some embodiments, the amplification primers for Helicobacter pylori related genes are:

[0034] The nucleotide sequences of the primers for specific amplification of the 23s rRNA gene are as follows:

[0035] SEQ ID NO:1AGAGATTCAGTGAAATTGTAG

[0036] SEQ ID NO:2CCTATCCTGCGCATGATATTC

[0037] SEQ ID NO:3CTTGGTGGGTAGTTTGAC

[0038] SEQ ID NO:4CCATTACACTCAACTTGC

[0039] The nucleotide sequences of the primers for specific amplification of VacA gene S1 typing are as follows:

[0040] SEQ ID NO:5ATCGCCCTCTGGTTTCTC

[0041] SEQ ID NO:6TTCCTACAGCAGCGCCTGTAG

[0042] The nucleotide sequences of the primers for specific amplification of VacA gene S2 typing are as follows:

[0043] SEQ ID NO:7ATTATCTCTCTCGCTTTAG

[0044] SEQ ID NO:8TGGCTGGAATGATCACGGTC

[0045] The nucleotide sequences of the primers for specific amplification of VacA gene M1 typing are as follows:

[0046] SEQ ID NO:9AATATCAGTCTGGGAAG

[0047] SEQ ID NO:10ACACCACTAAARTCTAAGG

[0048] The nucleotide sequences of the primers for specific amplification of the VacA gene M2 typing are as follows:

[0049] SEQ ID NO:11GCTTATTTTAATGGCAATATTTATCTG

[0050] SEQ ID NO:12CTAAAATCCAAAGCACTAG

[0051] The nucleotide sequences of the primers for specific amplification of the CagA gene are as follows:

[0052] SEQ ID NO:13TGGCTCAAGCTCGTGAATG

[0053] SEQ ID NO:14GAATCAGAATAATCTTTCATATTC

[0054] The nucleotide sequences of the primers for specific amplification of the CagL gene are as follows:

[0055] SEQ ID NO:15GCAAGTGCTCAAAAACTTAGA

[0056] SEQ ID NO:16TAATAAAAGTTCAGGGCTAGAC

[0057] The nucleotide sequences of the primers for specific amplification of the HtrA gene are as follows:

[0058] SEQ ID NO:17GTGATTCGCATCACTAAAGAC

[0059] SEQ ID NO:18CTGTTTGAATGAAATTCTCATAG The nucleotide sequences of the primers for specific amplification of the GyrA gene are as follows:

[0060] SEQ ID NO:19CCAAAGTCGCTTATAAAAAAAGC SEQ ID NO:20TCGCCATCAATAGAGCCAAAG The nucleotide sequences of the primers for specific amplification of the PBP1 gene are as follows:

[0061] SEQ ID NO:21CGCATTAAAGGTTTAGAAATTG

[0062] SEQ ID NO:22CTGTAAGGTGGGGGTAAAGC The nucleotide sequences of the primers for specific amplification of the rdxA gene are as follows:

[0063] SEQ ID NO:23CCATTCTTGCAAGATGTTTGA

[0064] SEQ ID NO:24CATTTYTTCATTAAARTAGCTG

[0065] SEQ ID NO:25CAATAAGCCTAAAATCGCATG

[0066] SEQ ID NO:26 CAACTTTAATTTAGGTTTGATTATAG The nucleotide sequences of the primers for specific amplification of the porD gene are as follows:

[0067] SEQ ID NO:27GTGTGCGTGGATGTCTG

[0068] SEQ ID NO:28 The nucleotide sequences of the primers for specifically amplifying the oorD gene are as follows:

[0069] SEQ ID NO:29GAATGGCTAAAATGAGCGC

[0070] SEQ ID NO:30CCGATACAACTCTCTGGGTAG

[0071] SEQ ID NO:31AAAGAAGCGAAAAGGTTAAG

[0072] SEQ ID NO:32CTTCAATCGCCGCTTTAGCGAC The nucleotide sequences of the primers for specific amplification of the CYP2C19 gene are as follows: SEQ ID NO:33AAAGATCAGCAATTTCTTAAC

[0073] SEQ ID NO:34CCCAGAAAAAAAGACTGTAAG

[0074] SEQ ID NO:35TTGTTTTCTCTTAGATATGC

[0075] SEQ ID NO:36GTGTTCTTTTACTTTCTCC

[0076] The nucleotide sequences of the primers for specific amplification of the 16s rRNA gene are as follows: SEQ ID NO: 37CGCACAAGCGGTGGAGCA

[0077] SEQ ID NO:38CAAGGTCTGGCAAGCCAGAC

[0078] The nucleotide sequences of the primers for specific amplification of the UreA gene are as follows:

[0079] SEQ ID NO:39GAAGACATCACTATCAAC

[0080] SEQ ID NO: 40AGCCGATTTGAACCGGTCTG.

[0081] In the kit, the reaction solution specifically includes PCR reaction solutions I, II, III and IV.

[0082] The PCR reaction solution I includes typing amplification primers:

[0083] UreA gene primers (SEQ ID NO:39 / SEQ ID NO:40);

[0084] CagA gene primers (SEQ ID NO: 13 / SEQ ID NO: 14);

[0085] 23s rRNA gene primers (SEQ ID NO:3 / SEQ ID NO:4);

[0086] VacA gene M1 primer (SEQ ID NO:9 / SEQ ID NO:10);

[0087] VacA gene M2 primer (SEQ ID NO: 11 / SEQ ID NO: 12);

[0088] 16s rRNA gene primers (SEQ ID NO:37 / SEQ ID NO:38);

[0089] CagL gene primers (SEQ ID NO: 15 / SEQ ID NO: 16);

[0090] The PCR reaction solution II includes typing amplification primers:

[0091] 23s rRNA gene primers (SEQ ID NO: 1 / SEQ ID NO: 2);

[0092] PBP1 gene primers (SEQ ID NO:21 / SEQ ID NO:22);

[0093] HtrA gene primers (SEQ ID NO: 17 / SEQ ID NO: 18);

[0094] Primers for site 148 / 184 of rdxA gene (SEQ ID NO:23 / SEQ ID NO:24);

[0095] Primers for site 565 / 616 of rdxA gene (SEQ ID NO: 25 / SEQ ID NO: 26);

[0096] porD gene primers (SEQ ID NO: 27 / SEQ ID NO: 28);

[0097] The PCR reaction solution III includes typing amplification primers:

[0098] VacA gene S1 primer (SEQ ID NO:5 / SEQ ID NO:6);

[0099] VacA gene S2 primer (SEQ ID NO:7 / SEQ ID NO:8);

[0100] oorD gene primers (SEQ ID NO:29 / SEQ ID NO:30 / SEQ ID NO:31 / SEQ ID NO:32);

[0101] GyrA gene primers (SEQ ID NO: 19 / SEQ ID NO: 20);

[0102] CYP2C19 gene 636 site primers (SEQ ID NO: 33 / SEQ ID NO: 34);

[0103] CYP2C19 gene 681 site primers (SEQ ID NO: 35 / SEQ ID NO: 36);

[0104] In some embodiments, among the primers, the 5' end of the primers with even SEQ ID NO number and SEQ ID NO:23, SEQ ID NO:27, and SEQ ID NO:29 is modified with a biotin label, and a spacer is connected between the amplification primer and the biotin, and the spacer is one or a combination of two of (PEG)n and TEG, and the number n in the (PEG)n is 3-18.

[0105] In some embodiments, the PCR reaction solution IV includes Hotstart Taq and RNase A.

[0106] In some embodiments, the kit uses a quantum dot chip hybridization detection method to detect genes, and the kit also includes a detection chip.

[0107] The detection chip comprises a solid phase carrier and a specific detection probe coupled to the solid phase carrier. The solid phase carrier is a nylon membrane or a polyethylene sheet, which is modified with carboxyl groups.

[0108] In some embodiments, the specific detection probe is specifically:

[0109] 2142C detection probe for 23s rRNA gene: GCAAGACGGCAAGAC (SEQ ID NO: 41)

[0110] 2142G detection probe for 23s rRNA gene: GCAAGACGGGAAGAC (SEQ ID NO: 42)

[0111] 2143G detection probe for 23s rRNA gene: CAAGACGGGAGGACC (SEQ ID NO: 43)

[0112] 23s rRNA gene 2142-2143AA detection probe: GCAAGACGGAAAGAC (SEQ ID NO: 44)

[0113] VacA gene S1 typing detection probe: TCACRACCGTGATCATTCCAG (SEQ ID NO: 45)

[0114] VacA gene S2 typing detection probe: TACGCCAAAACGATCCCATAC (SEQ ID NO: 46)

[0115] VacA gene M1 typing detection probe: GCGAGCGCTCATACGGTCAAT (SEQ ID NO: 47)

[0116] VacA gene M2 typing detection probe: CAAAGAGCGATAACGGGCTAA (SEQ ID NO: 48)

[0117] CagA gene detection probe: AGCGCTCATTTGTCAGAGTATG (SEQ ID NO: 49)

[0118] CagL gene 172T site detection probe: CCTAGCGCTAATTATRAAA (SEQ ID NO: 50)

[0119] CagL gene 175G site detection probe: CTAGCGCTAATWATGAAATG (SEQ ID NO: 51)

[0120] CagL gene 172G / A, 175A site detection probe: CGCTARCGCTAATGATAAAAT (SEQ ID NO: 52), GCTAGCGCTAATAATAAAATG (SEQ ID NO: 53)

[0121] HtrA gene 511-513TTA site detection probe: GATTCTAATGATATTTTAGTGG (SEQ ID NO: 54)

[0122] HtrA gene 511-513TTG site detection probe: ATTCTAATGATATTTTGGTGG (SEQ ID NO: 55)

[0123] HtrA gene 511-513 TCA site detection probe: TGATTCTAATGATATTTCAGTGG (SEQ ID NO: 56)

[0124] GyrA gene 259-261AAG site detection probe: CATGGWGATAAGGCGG (SEQ ID NO: 57)

[0125] GyrA gene 259-261AAA site detection probe: CCATGGWGATAAAGCGG (SEQ ID NO: 58)

[0126] GyrA gene 259-260AT site detection probe: CCATGGWGATATCGCGG (SEQ ID NO: 59)

[0127] GyrA gene 259-260AT site detection probe: CCCATGGWGATATTGCGG (SEQ ID NO: 60)

[0128] GyrA gene 259-261 AAT / AAC site detection probe: CCATGGWGATAASGCGG (SEQ ID NO: 61)

[0129] GyrA gene 271-273GGT site detection probe: TAANGCGGTTTATGGTGCGT (SEQ ID NO: 62)

[0130] GyrA gene 271-273TAT site detection probe: GATAANGCGGTTTATTATGCGT (SEQ ID NO: 63)

[0131] GyrA gene 271-273AAT site detection probe: GATAANGCGGTTTATAATGCGT (SEQ ID NO: 64)

[0132] GyrA gene 271-273GAT site detection probe: GATAANGCGGTTTATGATGCG (SEQ ID NO: 65)

[0133] PBP1 gene 1666-1668 AGC site detection probe: TGCCGGTAAAAGCGGGA (SEQ ID NO: 66)

[0134] PBP1 gene 1666-1668ACC site detection probe: TTGCCGGTAAAACCGGGA (SEQ ID NO: 67)

[0135] PBP1 gene 1684-1686 TAT site detection probe: CTCTAACAACTATATTGAT (SEQ ID NO: 68),

[0136] PBP1 gene 1684-1686GAT site detection probe: CTCTAACAACTAGATTGA (SEQ ID NO: 69)

[0137] PBP1 gene 1684-1686AAT site detection probe: ACTCTAAYAACAATATTG (SEQ ID NO: 70), CTCTAAYAACAATGTGG (SEQ ID NO: 71)

[0138] rdxA gene 148T site detection probe: CTCTTACAACACGTAGCCAT (SEQ ID NO: 72)

[0139] rdxA gene 148C site detection probe: CTCTTACAACACGCARCCAT (SEQ ID NO: 73)

[0140] rdxA gene 184G site detection probe: GGTTACTAATAAGGRTGTAAAA (SEQ ID NO: 74)

[0141] rdxA gene 184T site detection probe: TGGTTACTAATAAGGATTTAAAA (SEQ ID NO: 75)

[0142] rdxA gene 565T site detection probe: TTTGATCGCATTGTGTAAGA (SEQ ID NO: 76)

[0143] rdxA gene 565G site detection probe: TTTGATCGCATTGGGTAAG (SEQ ID NO: 77), TTGATTGCTTTGGGTAAG (SEQ ID NO: 78)

[0144] rdxA gene 616-618GCA site detection probe: GAAAATCAAAAGTTGATGCAATTA (SEQ ID NO: 79)

[0145] rdxA gene 616-618GCG site detection probe: GAAAATCAAAAGTTGATGCGATTA (SEQ ID NO: 80)

[0146] rdxA gene 616-618ACG site detection probe:

[0147] GAAAATCAAAAGTTGATACGATTAC(SEQ ID NO:81)

[0148] porD gene 353A site detection probe: AGTGAGAGCGGTAGTGGGC (SEQ ID NO: 82)

[0149] porD gene 356G site detection probe: TGAGTGAGAGCGGCAGCGG (SEQ ID NO: 83)

[0150] porD gene 357T site detection probe: CGCTATCGCTCTCACTCAAT (SEQ ID NO: 84)

[0151] porD gene 357C / 356A / 353G site detection probe: CAAATTGAGCCYGCTACCGCT (SEQ ID NO: 85)

[0152] oorD gene 41G site detection probe: CAGATGGGGTTGCCGT (SEQ ID NO: 86)

[0153] oorD gene 122G detection probe: TTTCTTTTTCAACCCCCA (SEQ ID NO: 87)

[0154] OorD gene 349A site detection probe: GCAAATAATGCGTGAGATT (SEQ ID NO: 88)

[0155] oorD gene 349G site detection probe: GCAAGTAATGCGTGAGAT (SEQ ID NO: 89)

[0156] oorD gene 41A site detection probe: CAGATGGGGTTACCGTT (SEQ ID NO: 90)

[0157] oorD gene 122A site detection probe: TTGGCATGGGGATTGAA (SEQ ID NO: 91)

[0158] oorD gene 349C site detection probe: GCAACTAATGCGTGAGATT (SEQ ID NO: 92)

[0159] CYP2C19 gene 636G site detection probe: GCACCCCCTGGATCCA (SEQ ID NO: 93)

[0160] CYP2C19 gene 681G site detection probe: GATTATTTCCCGGGAA (SEQ ID NO: 94)

[0161] CYP2C19 gene 636A site detection probe: CACCCCCTGAATCCAG (SEQ ID NO: 95)

[0162] CYP2C19 gene 681A site detection probe: GATTATTTCCCAGGAAC (SEQ ID NO: 96)

[0163] 16s rRNA gene 926-928TTC site detection probe: GTTTAATTCGATTCTACAC (SEQ ID NO: 97)

[0164] 16s rRNA gene 926-928GTA site detection probe: GGTTTAATTCGAGTATACA (SEQ ID NO: 98)

[0165] 16s rRNA gene 926-928 TGA site detection probe: TGGTTTAATTCGATGATAC (SEQ ID NO: 99)

[0166] 16s rRNA gene 926-928AGC site detection probe: GGTTTAATTCGAAGCTACA (SEQ ID NO: 100)

[0167] 16s rRNA gene 926-928ACG site detection probe: GTTTAATTCGAACGTACAC (SEQ ID NO: 101)

[0168] 16s rRNA gene 926-928GGA site detection probe: GTTTAATTCGAGGATACAC (SEQ ID NO: 102)

[0169] 16s rRNA gene 926-928AGA site detection probe: TGGTTTAATTCGAAGATAC (SEQ ID NO: 103)

[0170] UreA gene detection probe: AAGCCGTTAGCGTGAAG (SEQ ID NO: 104)

[0171] 23S rRNA gene detection probe: GAGGCTTGCAAAGGTTGGC (SEQ ID NO: 105)

[0172] The detection probe is used for hybridization capture of specific gene amplification products. The 5' end of the detection probe nucleotide is an amino group. There is a spacer between the amino group and the nucleotide. The spacer is one or a combination of (PEG)n and TEG. The number n in (PEG)n is 3-18.

[0173] In some embodiments, the specific detection kit for genes, mutation sites, and polymorphisms also includes:

[0174] Nucleic acid extraction reagent: It comprises a solid support containing a specific capture probe, wherein the capture probe is used to capture a specific gene sequence from a sample nucleic acid, the nucleotide sequences of the specific capture probe are respectively shown in SEQ ID NO: 105-122, and the 3' end of the capture probe nucleotide is an amino group, and there is a spacer between the amino group and the nucleotide, and the spacer is one or a combination of two of (PEG)n and TEG, and n in the (PEG)n is 3-18.

[0175] The UreA gene capture probe: AATGTCTAAGCGTTTACCGAAAG (SEQ ID NO: 106);

[0176] The 16s rRNA gene capture probe: CCAGGCGGGATGCTTAATGC (SEQ ID NO: 107);

[0177] The CYP2C19 gene capture probe: CTCCCTGCAATGTGATCTGC (SEQ ID NO: 108), AATTACAACCAGAGCTTGGC (SEQ ID NO: 109);

[0178] The oorD gene capture probes: GCAATCAATTTGGCTAAAATTG (SEQ ID NO: 110), CTTTCTTGGGCTTCTTTAGAAAC (SEQ ID NO: 111);

[0179] The porD gene capture probe: CCTTTAACTTACCCTCTCTT (SEQ ID NO: 112);

[0180] The rdxA gene capture probes: TGATCCAAAAATTTCATTGATTTTCC (SEQ ID NO: 113), CTCACGCCCATGCAAATTTG (SEQ ID NO: 114);

[0181] The GyrA gene capture probe: CACTAATTCCAAGCGCATG (SEQ ID NO: 115);

[0182] The HtrA gene capture probe: TATTCTTTATTGCTCCCTGGAA (SEQ ID NO: 116);

[0183] The CagL gene capture probe: GTAGGTGCTATCCAGTTGCTT (SEQ ID NO: 117);

[0184] The VacA gene capture probes: GTTATTAAAAGCGATTGTGCC (SEQ ID NO: 118), CCGCTTTTCCTAGATGGATATC (SEQ ID NO: 119), AGCAGCGCCTGTAGCGATACC (SEQ ID NO: 120), TACAGCGGTACCTGTAGCGATA (SEQ ID NO: 121);

[0185] The 23S rRNA gene capture probes: GGAATTTCGCTACCTTAGGACCGT (SEQ ID NO: 122), CAAGGATGGCTCCATAAGAGCC (SEQ ID NO: 123).

[0186] In some embodiments, the PCR reaction solution I / II / III further comprises 25 mM Tris (pH 8.9), 100 mM KCl, 6.68 mM MgCl 2 、1.67mM(NH 4 ) 2 SO 4 , TritonX100 0.017%, PVP 5%, 1.34M betaine, 0.13μM-0.67μM primer, UNG 0.013U / μL, dN(U)TPmix0.47mM.

[0187] In some embodiments, at least one of the PCR reaction solutions I, II, and III further includes an internal standard, and the internal standard is an exogenous nucleic acid containing the SUC2 gene, and its nucleotide sequence is: (SEQ ID NO: 124).

[0188] The kit also includes a capture probe, an amplification primer and a detection probe for specifically detecting the internal standard, and the nucleotide sequence thereof is:

[0189] Capture probe: GATTGGTCCACAGAGCCAAATC (SEQ ID NO: 125);

[0190] Amplification primers: TGTTCAGCCTGTCGTTG (SEQ ID NO: 126), ACCTATATCGGCAGCGTAAC (SEQ ID NO: 127);

[0191] Detection probe: CTTTCATCGTCGCTGGAGCCGG (SEQ ID NO: 128);

[0192] The 3' end of the capture probe nucleotide is an amino group, and there is a spacer between the amino group and the nucleotide. and TEG, one or a combination of two, the where n is 3-18.

[0193] The 5' end of the detection probe is labeled with an amino group, and a spacer is connected between the oligonucleotide single strand of the detection probe and the amino group. and TEG, one or a combination of two, the n in n is 3-18.

[0194] The 5' end of the reverse primer (SEQ ID NO: 127) in the amplification primer is modified with a biotin label, and a spacer is connected between the amplification primer and the biotin, and the spacer is and TEG, one or a combination of two, the where n is 3-18.

[0195] In some embodiments, a quality control detection probe is arranged on the detection chip, and its nucleotide sequence is TGCTGTTAGTTGCAGCT (SEQ ID NO: 129);

[0196] The 5' end of the quality control detection probe is labeled with an amino group, and a spacer is connected between the oligonucleotide single strand of the quality control detection probe and the amino group. and TEG, one or a combination of two, the Where n is 3-18. Meanwhile, the 3' end of the quality control detection probe is labeled with biotin, and a spacer is connected between the oligonucleotide single strand of the quality control detection probe and the biotin, and the spacer is and TEG, one or a combination of two, the where n is 3-18.

[0197] In some embodiments, the kit further comprises:

[0198] (1) washing solution: containing sodium chloride, polyethylene glycol 8000 and sodium citrate, optionally containing 2-20 mM Tris (pH 7.0), 50-500 mM NaCl, 5-50 mM sodium citrate, 1-10% PEG8000; and / or

[0199] (2) paraffin oil; and / or

[0200] (3) Positive control: Helicobacter pylori culture and 100 pg / μL human genome, the concentration of Helicobacter pylori culture is 400-1000 copies / mL, the virulence type of Helicobacter pylori is: S1 / M2, CagA+ / HtrA 511-513 site TCA / CagL172-174 site GAT / CagL175-177 site AAA, and the remaining resistance detection sites are all wild type; and / or

[0201] (4) Negative control: 100 pg / μL human genome;

[0202] In some embodiments, the sample comprises stool, gastric mucosa, gastric juice, oral saliva.

[0203] The present invention also provides a method for calculating the signal of the detection result of Helicobacter pylori virulence gene typing / mutation and drug resistance gene mutation. In some embodiments, the detection image is analyzed using analysis software to identify the specificity and relative gray value of the spot signal at different positions on the detection chip, which is specifically based on the software's clipping algorithm and gray value algorithm.

[0204] The cropping algorithm is as follows: edge detection and contour recognition are performed on the image; if the recognition result is a complete contour, cropping is performed directly according to the complete contour; if the recognition result is a partial contour, the scattered contours are spliced, and the four corner coordinates of the complete image in the original image are calculated, and the four corner coordinates are converted according to the length and width attributes of the detection chip. After the image is converted, the complete contour is obtained and then cropping is completed to obtain a complete chip image.

[0205] The gray value algorithm is as follows: according to the properties of the detection chip, the cropped chip image is segmented to obtain each hybridization point; then the image is grayed to identify the circularity, center position and circular area of ​​different hybridization point signal points, and when the set parameters (the parameters can be determined according to the pre-experiment) are reached, it is determined whether the hybridization point has a potential positive signal point; for the hybridization point with potential positive signal points, the positive point gray value (signal point gray value-background average gray value) is calculated, and the quality control point gray value is calculated in the same way, and then the relative gray value (positive point gray value / quality control point gray value) is obtained. If the relative gray value is greater than or equal to the set positive judgment value, the specific value is output and displayed in the software interface. Otherwise, no numerical value is output and displayed.

[0206] Compared with the prior art, the present invention has the following characteristics:

[0207] 1) The present invention adopts the coupled capture probe solid support nucleic acid separation and purification technology to quickly, efficiently and with high quality enrich and separate the Helicobacter pylori genome, fragments and infection, virulence, drug resistance and other related genes and internal standard genes discharged from the stomach in feces, avoid the loss of nucleic acids in fecal samples during the separation and purification process, and eliminate the interference of large-scale microbial genomes in the intestinal microecology.

[0208] 2) After separating and purifying nucleic acids from samples such as feces and gastric mucosa, the present invention extracts and separates the genome, gene fragments and solid support complexes, and then elutes them and then all enters the amplification system, achieving no inhibition or interference with the detection system, and can achieve one-time comprehensive detection of Helicobacter pylori infection, virulence genes and their virulence intensity, 6 types of Helicobacter pylori therapeutic drug resistance mutations, and proton pump inhibitor metabolic enzyme gene polymorphisms with high sensitivity and specificity, which can assist in the clinical realization of Helicobacter pylori graded management and radical treatment.

[0209] 3) An exogenous internal control system (SUC2 gene) is used to effectively solve the problem of invalid detection caused by low concentration of human genomic DNA from intestinal exfoliated cells as an internal standard and concentration differences between different individuals.

[0210] 4) Classification was performed based on the results of clinical culture drug sensitivity tests of gastric mucosa and sequencing identification of gastric mucosa / feces, more mutant types were screened out, and more comprehensive detection reagents were developed with better coverage. Multiplex PCR technology and quantum dot gene chip detection technology were used to achieve three-tube amplification to identify 59 gene mutation types and polymorphism types of 10 genes. At the same time, Helicobacter pylori dual targets (UreA gene and 23s rRNA gene) were used for infection detection to effectively prevent missed detection in fecal samples, and virulence typing of VacA, CagA, CagL and HtrA genes was performed, which can play a positive role in the graded treatment and eradication treatment of Helicobacter pylori, with a detection sensitivity of 400 copies / mL.

[0211] 5) The present invention provides a quality control detection probe for optical interference determination for the analysis and calculation of the signal value of the positive signal point, and at the same time provides a method for identifying and evaluating the positive signal of the quantum dot gene chip detection result and calculating the signal grayscale value, and uses the grayscale value of the quality control point to determine the relative grayscale value of the positive point, which is conducive to automatic signal recognition and judgment, making the detection result more intelligent and standardized. BRIEF DESCRIPTION OF THE DRAWINGS

[0212] Figure 1 Schematic diagram of the specificity of the detection probe.

[0213] Figure 2 The capture probe detection results (with some comparison groups).

[0214] Figure 3 Hybridization plot for detection sensitivity.

[0215] Figure 4 Results of stool sample testing. DETAILED DESCRIPTION

[0216] The present invention will be further described below in conjunction with the accompanying drawings.

[0217] Case study 1: Design and screening of primers and detection probes for Helicobacter pylori infection genes, virulence genes, drug resistance genes, and CYP2C19 gene-related sites

[0218] Primer probes for Helicobacter pylori-related genes are designed, based on the public sequence information of the bioinformatics database on the one hand, and the sequencing sequence information of each detection gene of the clinical (feces and gastric mucosa) positive samples on the other hand. In addition, the drug resistance mutation detection type is classified by the clinical gastric mucosa culture drug sensitivity results, and the correctness of the public information in the literature is verified. All the sequence information obtained is compared and analyzed, and the designed primer probes can better cover all the detection sites. Finally, the designed primer probes detect the genes and sites in the fecal samples (breath C13 positive) and if there is a signal, relevant sequencing is performed, and the sequence is analyzed again to determine whether the designed primer probes cover the detection sites and perform relevant correction designs, and multiple combination tests, sensitivity and specificity tests are performed, and finally the amplification primers and detection probes of the present invention are obtained.

[0219] In the Genebank database, according to the published CagL gene sequence of Helicobacter pylori (NCBI: MK014461.1-MK014478.1), HtrA gene sequence (NCBI: MH926335.1-MH926354.1), CagA gene sequence (NCBI: AB017921.1-017923.1, AB015404.1-015415.1), UreA gene sequence (GQ403135.1-GQ403154.1), 23s rRNA gene (LC595594.1-LC595601.1), VacA gene sequence (AY737319.1, HQ287752.1-HQ287754.1, HM047640.1-HM047735.1), 16s rRNA genes (AY456638.1, PP263608.1-PP263610.1, OR865988.1-OR866002.1, OR535252.1, OR262895.1, OQ748121.1, OQ748120.1, OQ748119.1), GyrA genes (KC864786.1, LC595336.1, KT992391.1, KC864785.1, OL85471 7.1, OL854698.1, OL854630.1, OL854730.1, OL854808.1, OL854648.1, OL854739.1, OL854773.1, KT198992.1), PBP1 gene (KC763639.1, AF315501.1, KC763636.1, AF316109.1, AF315502.1), rdxA gene (AF184267.1, AF 184268.1, AF183174.1, AF184266.1, OP903240.1, OP903241.1, DQ270007.1, AY063488.1, AF315501.1, AY 063489.1, EF444880.1, EF471983.1, EF471985.1, EF471986.1, EF471987.1, EF471990.1), porD gene (AF021 092.1, AP017632.1, LS483488.1, CP028325.1, CP078492.1, CP032041.1, CP079364.1, CP079343.1, CP079278.1, CP079089.1), oorD gene (AF021094.1, AP017632.1, LS483488.1, CP028325.1, CP079505.1, CP078884.1).1. Multiple complete sequences of CP079318.1, CP079490.1, CP078885.1, CP079406.1, and CP078818.1 were downloaded, and DNAMAN software was used to perform upstream and downstream comparison analysis of relevant detection sites. The specific detection mutation point and polymorphism point information are as follows.

[0220] CagL gene: 172-174 sites (GAT / AAT / TAT) and 175-177 sites (AAA / GAA); HtrA gene: 511-513 sites (TCA / TTA / TTG);

[0221] 23s rRNA gene: 2142-2144 positions (AAA / GAA / CAA / AGA);

[0222] 16s rRNA gene: 926-928 positions (AGA / TTC / GTA / GGA / AGC / TGA / ACG);

[0223] GyrA gene: 259-261 sites (AAT / AAC / AAG / AAA / ATC), 271-273 sites (GAT / GGT / TAT / AAT);

[0224] PBP1 gene: T556S (1666-1668 ACC / AGC), N562Y / D (1684-1686 AAT / TAT / GAT);

[0225] rdxA gene: 148C>T / 184T>G / 565G>T, 616-618 position (GCA / GCG / ACG)

[0226] porD gene: 357C>T / 356A>G / 353G>A; oorD gene: 41A>G / 122A>G / 349C>A / G; CYP2C19 gene: 636A>G / 681A>G; The final amplification primer information is as follows:

[0227]

[0228]

[0229]

[0230] Note: The 5' end of the primers with even SEQ ID NOs and SEQ ID NO:23, SEQ ID NO:27, and SEQ ID NO:29 is modified with a biotin label, and a spacer is connected between the amplification primer and the biotin. n is 9.

[0231] The grouping of PCR reaction solution I / II / III is as follows:

[0232] PCR reaction solution I includes typing amplification primers:

[0233] UreA gene primers (SEQ ID NO:39 / SEQ ID NO:40);

[0234] CagA gene primers (SEQ ID NO: 13 / SEQ ID NO: 14);

[0235] 23s rRNA gene primers (SEQ ID NO:3 / SEQ ID NO:4);

[0236] VacA gene M1 primer (SEQ ID NO:9 / SEQ ID NO:10);

[0237] VacA gene M2 primer (SEQ ID NO: 11 / SEQ ID NO: 12);

[0238] 16s rRNA gene primers (SEQ ID NO:37 / SEQ ID NO:38);

[0239] CagL gene primers (SEQ ID NO: 15 / SEQ ID NO: 16);

[0240] The PCR reaction solution II includes typing amplification primers:

[0241] 23s rRNA gene primers (SEQ ID NO: 1 / SEQ ID NO: 2);

[0242] PBP1 gene primers (SEQ ID NO:21 / SEQ ID NO:22);

[0243] HtrA gene primers (SEQ ID NO: 17 / SEQ ID NO: 18);

[0244] Primers for site 148 / 184 of rdxA gene (SEQ ID NO:23 / SEQ ID NO:24);

[0245] Primers for site 565 / 616 of rdxA gene (SEQ ID NO: 25 / SEQ ID NO: 26);

[0246] porD gene primers (SEQ ID NO: 27 / SEQ ID NO: 28);

[0247] The PCR reaction solution III includes typing amplification primers:

[0248] VacA gene S1 primer (SEQ ID NO:5 / SEQ ID NO:6);

[0249] VacA gene S2 primer (SEQ ID NO:7 / SEQ ID NO:8);

[0250] oorD gene primers (SEQ ID NO:29 / SEQ ID NO:30 / SEQ ID NO:31 / SEQ ID NO:32);

[0251] GyrA gene primers (SEQ ID NO: 19 / SEQ ID NO: 20);

[0252] CYP2C19 gene 636 site primers (SEQ ID NO: 33 / SEQ ID NO: 34);

[0253] CYP2C19 gene 681 site primers (SEQ ID NO: 35 / SEQ ID NO: 36);

[0254] In the above reaction solutions I, II, and III, at least one of the groups (or two or three of the groups) further includes SUC2 gene primers: SEQ ID NO:41 / SEQ ID NO:42.

[0255] The final detection probes are shown in the table below:

[0256]

[0257]

[0258]

[0259] Note: The 5' end of the detection probe nucleotide is an amino group, and there is a spacer between the amino group and the nucleotide. n is 9. The 3' end of the quality control detection probe is labeled with biotin, and a spacer arm is connected between the oligonucleotide single strand and the biotin. n is 6.

[0260] The layout of the detection chip is as follows:

[0261]

[0262]

[0263] Among them, Hp No. is used to mark the sample serial number.

[0264] See the specific detection diagram of each detection probe for Figure 1 As can be seen from the figure, the detection probes of each detection site have positive signals and internal control signals only at the corresponding sites, indicating that each detection probe is non-specific and the detection signal is acceptable. Implementation Case 2: Optimizing the concentration of amplification primers

[0265] Summary table of concentration settings and final concentrations for amplification primer screening:

[0266]

[0267]

[0268]

[0269] The optimized concentrations of the internal standard SUC2 gene detection primers (SEQ ID NO:41 / SEQ ID NO:42) were set to μM (0.2 / 0.24 / 0.28 / 0.32 / 0.36 / 0.4), and the optimal primer concentrations for the multiple combination were 0.08 / 0.08 μM.

[0270] Case Study 3: Capture Probe Screening

[0271] For all detected genes and mutation sites, polymorphic genes, and exogenous internal standard gene SUC2 conservative regions, multiple capture probes were designed for each gene (20 sites), and confirmed fecal breath C13 positive samples were used to screen the capture probes. The 3' end of the capture probe nucleotide is an amino group, and there is an arm between the amino group and the nucleotide. Said The n in is 9.

[0272] After the designed capture probes are delivered to the synthesis company for synthesis, each gene capture probe is connected to the solid support (nanomagnetic bead particles) according to the following connection method (by binding with N-hydroxysuccinimide and 1-ethyl-3-(3-dimethylaminopropylcarbodiimide)), the 3'-amino-modified capture probe is coupled to the surface carboxyl-modified magnetic beads, and then the 20 coupled magnetic beads are mixed in equal proportions for the capture of specific genes in stool samples. The capture probe concentration is 0.5-50μΜ, 2.5-1g / L nanomagnetic bead particles.

[0273] Specific capture and amplification operations:

[0274] (1) Take 5 g of fecal sample and add it to 20 mL / tube of sample preservation solution (self-produced), shake and mix for 1-2 min until homogenized, centrifuge the sample preservation solution at 4500 rpm for 3 min, transfer 200 μL of supernatant to a 2 mL centrifuge tube, add 200 μL of lysis solution (Tris-HCl 300 mM, SDS 2%), lyse for 10 min, add 100 μL of nucleic acid extraction reagent (0.3 M sodium chloride, 3 M sodium citrate, 0.8 mg / mL coupled capture probe magnetic beads (20 kinds of mixed)), then add 10 μL of 1 M sodium hydroxide, shake and mix, incubate at 95 degrees for 5 min, and at room temperature for 30 min.

[0275] (2) Place the centrifuge tube on a magnetic bead separation device and let it stand for 2-5 minutes. After the magnetic beads are adsorbed on the tube wall, place the centrifuge tube on the magnetic bead separation device, discard the liquid, and retain the magnetic beads. Add 0.8 mL of washing solution (5 mM Tris (pH 7.0), 200 mM NaCl, 20 mM sodium citrate, 5% PEG8000) and 0.2 mL of paraffin oil, shake evenly, let it stand for 2-5 minutes, discard the liquid, and retain the magnetic beads.

[0276] (3) Remove the centrifuge tube from the magnetic bead separation device, leaving the magnetic bead-nucleic acid complex. After drying, add 35 μL tris and elute at 95 degrees for 5 minutes to separate the magnetic beads. Pipette the supernatant into an EP tube for later use.

[0277] (4) Add 15 μL of reaction solution I / II / III to each PCR tube: 25 mM Tris (pH 8.9), 100 mM KCl, 6.68 mM MgCl 2 、1.67mM(NH 4 ) 2 SO 4 , TritonX100 0.017%, PVP 5%, 1.34M betaine, 0.13μM-0.67μM primers, UNG 0.013U / μL, dN(U)TPmix 0.47mM and 0.2μL enzyme solution (Hotstart Taq, RNase A), then add 10μL of extracted nucleic acid to each of the three reaction solutions and mix well;

[0278] (5) Transfer the amplification detection solution to a PCR reaction tube and place it in a real-time fluorescence PCR instrument (program: 50 degrees for 2 minutes, 95 degrees for 3 minutes; 45 cycles (95 degrees for 10 seconds, 58 degrees for 45 seconds, 72 degrees for 30 seconds)) for amplification.

[0279] Quantum dot fluorescence nucleic acid detection steps:

[0280] 1) After nucleic acid amplification, the product is subjected to nucleic acid denaturation treatment, wherein the nucleic acid denaturation method is alkaline denaturation.

[0281] 2) Add the denatured product and the detection membrane strip to a hybridization solution preheated to a certain temperature (40-55 degrees) for hybridization for 30 minutes to 2 hours. The hybridization solution is 2*SSC and 0.1% SDS.

[0282] 3) After hybridization, the detection membrane strip is transferred to a washing solution preheated to a certain temperature (40-55 degrees) for washing for 5-15 minutes. The washing solution is 0.5*SSC and 0.1% SDS.

[0283] 4) After washing, remove the washing solution and add it to an incubation solution at a certain temperature for incubation. The incubation time is 5-30 minutes. The temperature is 20-37 degrees. The incubation solution is 2*SSC and 0.1% SDS with 0.01nM-5nM SA-QD quantum dots (excitation wavelength is 200-500nm, emission wavelength is 400-700nm). The size of the quantum dots is 1-200nm.

[0284] 5) After the incubation is completed, the incubation solution is removed and a certain amount of washing solution is added for washing for 5-15 minutes. The washing solution is 0.5*SSC and 0.1% SDS.

[0285] 6) After washing, the detection membrane strip is placed in a fluorescence instrument for fluorescence detection and the grayscale value is read by analysis software and compared with the judgment by the naked eye.

[0286] The best capture probe (probe set 1) can be obtained through the detection results as follows:

[0287] UreA gene capture probe: AATGTCTAAGCGTTTACCGAAAG (SEQ ID NO: 106);

[0288] 16s rRNA gene capture probe: CCAGGCGGGATGCTTAATGC (SEQ ID NO: 107);

[0289] CYP2C19 gene capture probe: CTCCCTGCAATGTGATCTGC (SEQ ID NO: 108), AATTACAACCAGAGCTTGGC (SEQ ID NO: 109);

[0290] oorD gene capture probes: GCAATCAATTTGGCTAAAATTG (SEQ ID NO: 110), CTTTCTTGGGCTTCTTTAGAAAC (SEQ ID NO: 111);

[0291] porD gene capture probe: CCTTTAACTTACCCTCTCTT (SEQ ID NO: 112);

[0292] rdxA gene capture probe: TGATCCAAAAATTTCATTGATTTTCC (SEQ ID NO: 113), CTCACGCCCATGCAAATTTG (SEQ ID NO: 114);

[0293] GyrA gene capture probe: CACTAATTCCAAGCGCATG (SEQ ID NO: 115);

[0294] HtrA gene capture probe: TATTCTTTATTGCTCCCTGGAA (SEQ ID NO: 116);

[0295] CagL gene capture probe: GTAGGTGCTATCCAGTTGCTT (SEQ ID NO: 117);

[0296] VacA gene capture probes: GTTATTAAAAGCGATTGTGCC (SEQ ID NO: 118), CCGCTTTTCCTAGATGGATATC (SEQ ID NO: 119), AGCAGCGCCTGTAGCGATACC (SEQ ID NO: 120), TACAGCGGTACCTGTAGCGATA (SEQ ID NO: 121);

[0297] 23S rRNA gene capture probes: GGAATTTCGCTACCTTAGGACCGT (SEQ ID NO: 122), CAAGGATGGCTCCATAAGAGCC (SEQ ID NO: 123);

[0298] SUC2 gene capture probe: GATTGGTCCACAGAGCCAAATC (SEQ ID NO: 125) The stool sample test results using the defined capture probe (probe set 1) are shown in Figure 2 (Compared with some comparison groups: probe group 2, probe group 3) As shown in the figure, the signal of the DNA captured by probe group 1 after amplification and hybridization detection is stronger than that of probe group 2 and probe group 3, and some points of probe group 3 cannot be effectively detected.

[0299] Case study 4: Optimization of amplification system

[0300] Since the present invention is used to detect the genotype of Helicobacter pylori in fecal samples, a small amount of inhibitors will exist after nucleic acid separation and purification, and the enhancement of PCR amplification efficiency and anti-inhibition ability are mainly related to the ratio of each component in the reaction system. The concentration of each component in the PCR reaction system is orthogonally designed and tested, and the specific concentration settings are as follows:

[0301] 15mM Tris: pH8.0, pH8.3, pH8.6, pH8.9;

[0302] 20mM Tris: pH8.0, pH8.3, pH8.6, pH8.9;

[0303] 25mM Tris: pH8.0, pH8.3, pH8.6, pH8.9;

[0304] 30mM Tris: pH8.0, pH8.3, pH8.6, pH8.9;

[0305] KCl: 60mM, 80mM, 100mM, 120mM;

[0306] MgCl 2 :3.34mM, 5.01mM, 6.68mM, 8.35mM;

[0307] (NH 4 ) 2 SO 4 :0.835mM, 1.67mM, 2.5mM, 5.34mM;

[0308] TritonX100: 0.008%, 0.017%, 0.025%, 0.033%;

[0309] PVP: 3%, 4%, 5%, 6%;

[0310] Betaine: 1M, 1.34M, 1.44M, 1.5M;

[0311] dN(U)TPmix: 0.3mM, 0.35mM, 0.47mM, 0.53mM;

[0312] UNG: 0.008U / μL, 0.013U / μL, 0.018U / μL, 0.023U / μL;

[0313] After a large number of orthogonal optimization tests, the optimal reaction solution concentration was obtained:

[0314] 25mM Tris (pH8.9), 100mM KCl, 6.68mM MgCl 2 、1.67mM(NH4 ) 2 SO 4 , TritonX1000.017%, PVP 5%, 1.34M betaine, UNG 0.013U / μL, dN(U)TPmix0.47mM.

[0315] The final system detection sensitivity hybridization diagram is shown in Figure 3 As can be seen from the figure, after the negative feces matrix simulated samples containing different concentrations of Hp and human genome, the final screening system Hp sensitivity can reach 400 copies / mL, and the human genome sensitivity can reach 10pg / μL.

[0316] The results of the stool sample test for the confirmation system are shown in Figure 4 As can be seen from the figure, the stool tests of three patients with clinically known positive Hp infection (gastric mucosa) were all positive for Hp, and all detection points had valid signals without missing, indicating that the system can effectively detect stool samples.

[0317] Implementation Case 5: Calculation method and detection status of relative gray value of fluorescence signal of detection chip

[0318] The analysis software algorithm requirements are as follows:

[0319] 1) According to the membrane strip size of 15*15mm and the layout of the detection sites, set the recognition requirement parameters of the detection module;

[0320] 2) Cropping algorithm: Perform edge detection and contour recognition on the image. If the recognition result is a complete contour, cropping is performed directly according to the complete contour. If the recognition result is a partial contour, the scattered contours are spliced. By calculating the coordinates of the four corners of the complete image in the original image, the four corner coordinates are converted according to the length and width attributes of the template. After the conversion, the image obtains a complete contour and then the cropping is completed.

[0321] 3) Gray value algorithm: According to the attributes of the image template, the image is segmented into specific areas. Then the image is grayed, and the circularity, center position and circular area of ​​the signal points at different positions are identified. When the set parameters are reached (the specific set parameters can be determined according to the experiment), it is judged that there is a potential positive signal point at that position, and the gray value of the positive point is calculated (signal point gray value-background average gray value), and the relative gray value (positive point gray value / quality control point gray value) is obtained at the same time. If the relative gray value is greater than or equal to the set positive judgment value, the specific value is output and displayed in the software interface. Otherwise, there is no value output and display.

[0322] After developing the performance of the reagent, the development analysis software was used to study the positive judgment value of each site of the product. The relative gray value of the CC site was ≥90, and the relative gray value of the IC and other sites was ≥0.3 (i.e. the set positive judgment value).

[0323] According to the above requirements, the analysis software was developed and tested. The test results of breath C13 positive stool samples (9 cases) are summarized as follows:

[0324]

[0325]

[0326] The software analysis results were consistent with those of manual interpretation.

[0327] Example 6: Clinical sample validation

[0328] At the same time, 10 cases of C 13 Gastric mucosa and fecal samples of patients with positive or negative breath (UBT) test, and confirm that the patients have not received antibiotics, proton pump inhibitors, or bismuth-related treatment within one month. Gastric mucosa and fecal samples are simultaneously tested by the detection method of the present invention and Sanger sequencing is used to determine the mutation type.

[0329] The specific capture and detection steps refer to Example 3, the amplification system adopts the determined formula after optimization in Example 4 and the primer concentration determined in Example 2, and the detection chip and detection probe determined in Example 1 are used.

[0330] The test results are as follows:

[0331]

[0332]

[0333] As can be seen from the above table, the comparison results of gastric mucosal samples and fecal samples are consistent, and the sequencing type is also consistent with the detected type, indicating that the present invention can be used for non-invasive fecal detection of gastric Helicobacter pylori virulence typing, drug-resistant mutations and cytochrome P450 enzyme 2C19 gene polymorphism detection.

Claims

1. A primer kit for Helicobacter pylori virulence gene typing / mutation and drug resistance gene mutation amplification, characterized in that: The kit includes a reaction solution and a nucleic acid extraction reagent for specifically detecting the following genes and their mutation sites and polymorphisms: The site information of mutation and polymorphism detection genes is: CagL gene: sites 172-174 are GAT / AAT / TAT, sites 175-177 are AAA / GAA; HtrA gene: positions 511-513 are TCA / TTA / TTG; 23s rRNA gene: positions 2142-2144 are AAA / GAA / CAA / AGA; 16s rRNA gene: positions 926-928 are AGA / TTC / GTA / GGA / AGC / TGA / ACG; GyrA gene: positions 259-261 are AAT / AAC / AAG / AAA / ATC, positions 271-273 are GAT / GGT / TAT / AAT; PBP1 gene: 1666-1668 is ACC / AGC, 1684-1686 is AAT / TAT / GAT; rdxA gene: 148C>T / 184T>G / 565G>T, 616-618 positions are GCA / GCG / ACG; porD gene: 357C>T / 356A>G / 353G>A; oorD gene: 41A>G / 122A>G / 349C>A / G; CYP2C19 gene: 636A>G / 681A>G; The reaction solution specifically includes PCR reaction solutions I, II, III and IV; The PCR reaction solution I includes the following typing amplification primers: UreA gene primers are shown in SEQ ID NO:39 and SEQ ID NO:40; CagA gene primers are shown in SEQ ID NO: 13 and SEQ ID NO: 14; 23s rRNA gene primers are shown in SEQ ID NO:3 and SEQ ID NO:4); VacA gene M1 primers are shown in SEQ ID NO:9 and SEQ ID NO:10; VacA gene M2 primers are shown in SEQ ID NO: 11 and SEQ ID NO: 12; 16s rRNA gene primers are shown in SEQ ID NO:37 and SEQ ID NO:38; CagL gene primers are shown in SEQ ID NO: 15 and SEQ ID NO: 16; The PCR reaction solution II includes the following typing amplification primers: 23s rRNA gene primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2; The primers for the PBP1 gene are shown in SEQ ID NO:21 and SEQ ID NO:22; The primers for the HtrA gene are shown in SEQ ID NO: 17 and SEQ ID NO: 18; The primers for site 148 / 184 of the rdxA gene are shown in SEQ ID NO:23 and SEQ ID NO:24; The primers for the 565 / 616 site of the rdxA gene are shown in SEQ ID NO:25 and SEQ ID NO:26; The primers for the porD gene are shown in SEQ ID NO:27 and SEQ ID NO:28; The PCR reaction solution III includes the following typing amplification primers: VacA gene S1 primers are shown in SEQ ID NO:5 and SEQ ID NO:6; VacA gene S2 primers are shown in SEQ ID NO:7 and SEQ ID NO:8; oorD gene primers are shown in SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31 and SEQ ID NO:32; GyrA gene primers are shown in SEQ ID NO: 19 and SEQ ID NO: 20; The primers for site 636 of the CYP2C19 gene are shown in SEQ ID NO:33 and SEQ ID NO:34; The primers for site 681 of the CYP2C19 gene are shown in SEQ ID NO:35 and SEQ ID NO:36; Among the amplification primers, the 5' ends of the primers with even SEQ ID NO numbers and SEQ ID NO: 23, SEQ ID NO: 27, and SEQ ID NO: 29 are modified with a biotin label, and a spacer is connected between the amplification primer and the biotin, wherein the spacer is one or a combination of two of (PEG) n and TEG, and n in the (PEG) n is 3-18; The PCR reaction solution IV includes Hotstart Taq and RNase A.

2. The Helicobacter pylori virulence genotyping / mutation and drug resistance gene mutation detection kit according to claim 1, characterized in that: The kit uses a quantum dot chip hybridization detection method to detect genes, and the kit also includes a detection chip; the detection chip includes a solid phase carrier and a specific detection probe coupled to the solid phase carrier, and the solid phase carrier is a nylon membrane or a polyethylene sheet, which is modified with a carboxyl group; The specific detection probe is specifically: The 2142C detection probe for the 23s rRNA gene is shown in SEQ ID NO:41; The 2142G detection probe for the 23s rRNA gene is shown in SEQ ID NO:42; The 2143G detection probe of the 23s rRNA gene is shown in SEQ ID NO:43; The 2142-2143AA detection probe of the 23s rRNA gene is shown in SEQ ID NO:44; The VacA gene S1 typing detection probe is shown in SEQ ID NO:45; The VacA gene S2 typing detection probe is shown in SEQ ID NO:46; The VacA gene M1 typing detection probe is shown in SEQ ID NO:47; The VacA gene M2 typing detection probe is shown in SEQ ID NO:48; The CagA gene detection probe is shown in SEQ ID NO:49; The CagL gene 172T site detection probe is shown in SEQ ID NO:50; The CagL gene 175G site detection probe is shown in SEQ ID NO:51; The detection probes for the 172G / A and 175A sites of the CagL gene are shown in SEQ ID NO:52 and SEQ ID NO:53, respectively; The HtrA gene 511-513TTA site detection probe is shown in SEQ ID NO:54; The HtrA gene 511-513TTG site detection probe is shown in SEQ ID NO:55; The HtrA gene 511-513TCA site detection probe is shown in SEQ ID NO:56; The GyrA gene 259-261AAG site detection probe is shown in SEQ ID NO:57; The GyrA gene 259-261AAA site detection probe is shown in SEQ ID NO:58; The GyrA gene 259-260AT site detection probe is shown in SEQ ID NO:59 and SEQ ID NO:60; The GyrA gene 259-261 AAT / AAC site detection probe is shown in SEQ ID NO:61; The GyrA gene 271-273GGT site detection probe is shown in SEQ ID NO:62; The GyrA gene 271-273TAT site detection probe is shown in SEQ ID NO:63; The GyrA gene 271-273AAT site detection probe is shown in SEQ ID NO:64; The GyrA gene 271-273GAT site detection probe is shown in SEQ ID NO:65; The PBP1 gene 1666-1668AGC site detection probe is shown in SEQ ID NO:66; The detection probe for the 1666-1668ACC site of the PBP1 gene is shown in SEQ ID NO:67; The PBP1 gene 1684-1686 TAT site detection probe is shown in SEQ ID NO: 68; The detection probe for the 1684-1686GAT site of the PBP1 gene is shown in SEQ ID NO:69; The detection probes for the 1684-1686AAT site of the PBP1 gene are shown in SEQ ID NO:70 and SEQ ID NO:71; The rdxA gene 148T site detection probe is shown in SEQ ID NO:72; The rdxA gene 148C site detection probe is shown in SEQ ID NO:73; The 184G site detection probe of the rdxA gene is shown in SEQ ID NO:74; The rdxA gene 184T site detection probe is shown in SEQ ID NO:75; The rdxA gene 565T site detection probe is shown in SEQ ID NO:76; The 565G site detection probe of the rdxA gene is shown in SEQ ID NO:77 and SEQ ID NO:78; The 616-618GCA site detection probe of the rdxA gene is shown in SEQ ID NO:79; The 616-618GCG site detection probe of the rdxA gene is shown in SEQ ID NO:80; The 616-618ACG site detection probe of the rdxA gene is shown in SEQ ID NO:81; The porD gene 353A site detection probe is shown in SEQ ID NO:82; The porD gene 356G site detection probe is shown in SEQ ID NO:83; The porD gene 357T site detection probe is shown in SEQ ID NO:84; The porD gene 357C / 356A / 353G site detection probe is shown in SEQ ID NO:85; The oorD gene 41G site detection probe is shown in SEQ ID NO:86; The oorD gene 122G detection probe is shown in SEQ ID NO:87; The OorD gene 349A site detection probe is shown in SEQ ID NO:88; The oorD gene 349G site detection probe is shown in SEQ ID NO:89; The oorD gene 41A site detection probe is shown in SEQ ID NO:90; The oorD gene 122A site detection probe is shown in SEQ ID NO:91; The oorD gene 349C site detection probe is shown in SEQ ID NO:92; The CYP2C19 gene 636G site detection probe is shown in SEQ ID NO:93; The CYP2C19 gene 681G site detection probe is shown in SEQ ID NO:94; The CYP2C19 gene 636A site detection probe is shown in SEQ ID NO:95; The CYP2C19 gene 681A site detection probe is shown in SEQ ID NO:96; The 16s rRNA gene 926-928TTC site detection probe is shown in SEQ ID NO:97; The 16s rRNA gene 926-928GTA site detection probe is shown in SEQ ID NO:98; The 16s rRNA gene 926-928TGA site detection probe is shown in SEQ ID NO:99; The 16s rRNA gene 926-928AGC site detection probe is shown in SEQ ID NO: 100; The 16s rRNA gene 926-928ACG site detection probe is shown in SEQ ID NO: 101; The 16s rRNA gene 926-928GGA site detection probe is shown in SEQ ID NO:102; The 16s rRNA gene 926-928AGA site detection probe is shown in SEQ ID NO:103; The UreA gene detection probe is shown in SEQ ID NO: 104; The 23S rRNA gene detection probe is shown in SEQ ID NO: 105; The detection probe is used for hybridization capture of specific gene amplification products. The 5' end of the detection probe nucleotide is an amino group. There is a spacer between the amino group and the nucleotide. The spacer is one or a combination of (PEG)n and TEG. The number n in (PEG)n is 3-18.

3. A Helicobacter pylori virulence genotyping / mutation and drug resistance gene mutation detection kit according to claim 1, characterized in that: The nucleic acid extraction reagent comprises a solid support containing a specific capture probe, wherein the specific capture probe is used to capture a specific gene sequence from a sample nucleic acid, wherein the 3' end of the nucleotide of the specific capture probe is an amino group, and there is a spacer between the amino group and the nucleotide, wherein the spacer is and TEG, one or a combination of two, the Where n is 3-18; The nucleotide sequence of the specific capture probe is specifically: The UreA gene capture probe is shown in SEQ ID NO: 106; The 16s rRNA gene capture probe is shown in SEQ ID NO: 107; The CYP2C19 gene capture probe is shown in SEQ ID NO: 108 and SEQ ID NO: 109; The oorD gene capture probe is shown in SEQ ID NO: 110 and SEQ ID NO: 111; The porD gene capture probe is shown in SEQ ID NO: 112; The rdxA gene capture probe is shown in SEQ ID NO: 113 and SEQ ID NO: 114; The GyrA gene capture probe is shown in SEQ ID NO: 115; The HtrA gene capture probe is shown in SEQ ID NO: 116; The CagL gene capture probe is shown in SEQ ID NO: 117; The VacA gene capture probes are shown in SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120 and SEQ ID NO: 121; The 23S rRNA gene capture probe is shown in SEQ ID NO:122 and SEQ ID NO:

123.

4. The Helicobacter pylori virulence genotyping / mutation and drug resistance gene mutation detection kit according to claim 1, characterized in that: The PCR reaction solution I / II / III also contains 25mM Tris at pH 8.9, 100mM KCl, 6.68mM MgCl2, 1.67mM (NH4)2SO4, TritonX100 0.017%, PVP 5%, 1.34M betaine, 0.13μM-0.67μM primer, UNG 0.013U / μL, and dN(U)TPmix0.47mM.

5. The Helicobacter pylori virulence genotyping / mutation and drug resistance gene mutation detection kit according to claim 1, characterized in that: At least one of the PCR reaction solutions I, II, and III further includes an internal standard, wherein the internal standard is an exogenous nucleic acid containing the SUC2 gene, and the nucleotide sequence thereof is shown in SEQ ID NO: 124; The kit also includes a capture probe, an amplification primer and a detection probe for specifically detecting the internal standard, and the nucleotide sequence thereof is: The capture probe is shown in SEQ ID NO: 125; Amplification primers are shown in SEQ ID NO:126 and SEQ ID NO:127; The detection probe is shown in SEQ ID NO: 128; The 3' end of the capture probe nucleotide is an amino group, and there is a spacer between the amino group and the nucleotide. and TEG, one or a combination of two, the Where n is 3-18; The 5' end of the detection probe is labeled with an amino group, and a spacer is connected between the oligonucleotide single strand of the detection probe and the amino group. and TEG, one or a combination of two, the Where n is 3-18; The 5' end of the reverse primer SEQ ID NO: 127 in the amplification primer is modified with a biotin label, and a spacer is connected between the amplification primer and the biotin, and the spacer is and TEG, one or a combination of two, the where n is 3-18.

6. The Helicobacter pylori virulence genotyping / mutation and drug resistance gene mutation detection kit according to claim 2, characterized in that: A quality control detection probe is arranged on the detection chip, and its nucleotide sequence is shown in SEQ ID NO: 129; The 5' end of the quality control detection probe is labeled with an amino group, and a spacer is connected between the oligonucleotide single strand of the quality control detection probe and the amino group. and TEG, one or a combination of two, the wherein n is 3-18; the 3' end of the quality control detection probe is labeled with biotin, and a spacer is connected between the oligonucleotide single strand of the quality control detection probe and the biotin, and the spacer is and TEG, one or a combination of two, the where n is 3-18.

7. The Helicobacter pylori virulence genotyping / mutation and drug resistance gene mutation detection kit according to any one of claims 1 to 6, characterized in that: The kit also includes: (1) Washing solution: containing sodium chloride, polyethylene glycol 8000 and sodium citrate; and / or (2) paraffin oil; and / or (3) Positive control: Helicobacter pylori culture and 100 pg / μL human genome, the concentration of Helicobacter pylori culture is 400-1000 copies / mL, the virulence type of Helicobacter pylori is: S1 / M2, CagA+ / HtrA511-513 site TCA / CagL172-174 site GAT / CagL175-177 site AAA, and the remaining resistance detection sites are all wild type; and / or (4) Negative control: 100 pg / μL human genome.

8. The Helicobacter pylori virulence genotyping / mutation and drug resistance gene mutation detection kit according to claim 1, characterized in that: The samples used include stool, gastric mucosa, gastric juice and oral saliva.

9. A method for calculating the signal of Helicobacter pylori virulence gene typing / mutation and drug resistance gene mutation detection results, characterized in that: Use analysis software to analyze the test images and identify the specificity of spot signals at different positions on the test chip and the relative grayscale values ​​of the signals, which is specifically based on the software's cropping algorithm and grayscale value algorithm; The cropping algorithm is as follows: edge detection and contour recognition are performed on the image; if the recognition result is a complete contour, cropping is performed directly according to the complete contour; if the recognition result is a partial contour, the scattered contours are spliced, and the four corner coordinates of the complete image in the original image are calculated, and the four corner coordinates are converted according to the length and width attributes of the detection chip. After the image is converted, the complete contour is obtained and then cropping is completed to obtain a complete chip image; The gray value algorithm is as follows: according to the properties of the detection chip, the cropped chip image is segmented to obtain each hybridization point; then the image is grayed to identify the circularity, center position and circular area of ​​different hybridization points, and determine whether the hybridization point has a potential positive signal point; For hybridization points with potential positive signal points, the gray value of the positive point is calculated by using the gray value of the signal point minus the average gray value of the background. The gray value of the quality control point is calculated similarly, and then the relative gray value is calculated by the gray value of the positive point / the gray value of the quality control point. If the relative gray value is greater than or equal to the set positive judgment value, the specific value is output and displayed in the software interface; otherwise, no value is output or displayed.

Images