Primer probe combination, kit and method for detecting mycoplasma pneumoniae and josamycin drug-resistant mutation sites of mycoplasma pneumoniae

Abstract

The invention discloses a primer probe combination, a kit and a method for detecting mycoplasma pneumoniae and a josamycin drug-resistant mutation site thereof, and belongs to the technical field of biological detection.The drug-resistant mutation site is an A2067G mutation site of a 23S rRNA gene, and the primer probe combination comprises a first primer pair and a first probe which are used for detecting a mycoplasma pneumoniae P1 gene, the second primer pair and the second probe are used for detecting the drug-resistant mutation site; the kit comprises a positive quality control product, a negative quality control product and / or a wild type quality control product, and is used for ensuring the accuracy of a detection result. When the reagent combination, the kit and the method are used for detection, high accuracy and sensitivity are achieved, the lowest detection limit of mycoplasma pneumoniae drug-resistant mutation reaches 200 copies / mL, the concentration of wild template genes is within the range of 5 * 10 < 6 > copies / mL to 10 < 8 > copies / mL, and the mutation detection rate reaches 0.1%.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a primer-probe combination, a kit and a method for detecting Mycoplasma pneumoniae and josamycin-resistant mutation sites thereof. Background Art

[0002] Mycoplasma pneumoniae (MP) is an important pathogen that causes upper and lower respiratory tract infections in humans and is the leading cause of community-acquired pneumonia in school-age children and adolescents, accounting for 10%-40% of cases. Mycoplasma pneumoniae pneumonia (MPP) is usually mild and sometimes self-limited, however, the incidence of severe MPP requiring hospitalization has increased in recent years. Globally, the prevalence of M. pneumoniae shows a clear cyclical pattern, occurring every 3-7 years, with each outbreak lasting 1-2 years. For many years, macrolide antibiotics have been used as the first-line drug for the treatment of M. pneumoniae infection in children. Due to widespread use, macrolide-resistant Mycoplasma pneumoniae (MRMP) has emerged and spread globally for more than 20 years, with different prevalence rates in different regions, exceeding 90% in China. The main mechanism of resistance of Mycoplasma pneumoniae to macrolide drugs is site mutation. The mutation sites that have been found so far include 2063, 2064, 2067 and 2617. Among them, A2067G shows resistance to josamycin. In clinical practice, there are many kits for detecting drug-resistant mutations at sites 2063 and 2064 of the 23S rRNA gene. However, with the use of macrolide drugs, new drug-resistant mutation sites have been generated. The detection of these new sites is also very important for clinical guidance of drug use. Summary of the invention

[0003] In order to solve at least one of the above problems, the present invention provides a primer-probe combination, a kit and a method for detecting Mycoplasma pneumoniae and its josamycin-resistant mutation sites.

[0004] In order to achieve the above object, the present invention adopts the following technical means: The first aspect of the present invention provides a primer-probe combination for detecting Mycoplasma pneumoniae and its josamycin-resistant mutation site, wherein the drug-resistant mutation site is the A2067G mutation site of the 23S rRNA gene; the primer-probe combination comprises: (1) First primer-probe combination: The sequences of the first primer pair for targeted amplification of the Mycoplasma pneumoniae P1 gene are shown in SEQ ID No. 1 and SEQ ID No. 3, and the sequence of the first probe for detecting the Mycoplasma pneumoniae P1 gene is shown in SEQ ID No. 2; (2) Second primer-probe combination: The sequences of the second primer pair for targeted amplification of the A2067G mutation site of the 23S rRNA gene are shown in SEQ ID No. 4 and SEQ ID No. 6, and the sequence of the second probe for detecting the A2067G mutation site of the 23S rRNA gene is shown in SEQ ID No. 5; The first probe is labeled with a first fluorescent group at its 5' end and a first quencher group at its 3' end, and the second probe is labeled with a second fluorescent group at its 5' end and a second quencher group at its 3' end, wherein the first fluorescent group is different from the second fluorescent group, and the first quencher group and the second quencher group are the same or different.

[0005] Preferably, the first fluorescent group and the second fluorescent group are selected from FAM, CY3, CY-5, ROX, VIC and HEX, respectively, for example, ROX and VIC, or ROX and HEX, respectively.

[0006] Currently, there are many kits for detecting drug-resistant mutations at sites 2063 and 2064 of the 23S rRNA gene in clinical practice. However, with the use of macrolide drugs, new drug-resistant mutation sites have emerged. The detection of these new sites is also extremely important for clinical drug guidance. Among them, A2067G manifests as josamycin resistance.

[0007] In some embodiments of the present invention, a third primer-probe combination is further included: the sequences of the third primer pair for targeted amplification of the β-actin gene are shown in SEQ ID No. 7 and SEQ ID No. 9, respectively, and the sequence of the third probe for detecting the β-actin gene is shown in SEQ ID No. 8, the 5' end of the third probe is labeled with a third fluorescent group, and the 3' end is labeled with a third quenching group, the third fluorescent group is different from both the first fluorescent group and the second fluorescent group, and the third quenching group is the same as or different from the first quenching group or the second quenching group.

[0008] Preferably, the third fluorescent group is also selected from FAM, CY3, CY-5, ROX, VIC and HEX, but is different from the first fluorescent group and the second fluorescent group. For example, the first fluorescent group, the second fluorescent group and the third fluorescent group are VIC, ROX and CY-5, respectively, or HEX, ROX and CY-5, respectively.

[0009] The β-actin gene is used as the internal standard gene to ensure the accuracy of the whole detection process. Of course, those skilled in the art can also use other genes as internal standard genes.

[0010] The second aspect of the present invention provides a kit for detecting Mycoplasma pneumoniae and its josamycin-resistant mutation sites, comprising the primer-probe combination described in the first aspect.

[0011] In some embodiments of the present invention, positive quality control products, negative quality control products and / or wild-type quality control products and PCR detection reagents are also included.

[0012] In some embodiments of the present invention, the positive quality control product comprises the P1 gene and the gene with mutation at the 23S rRNA A2067G site and the internal standard gene sequence, and the specific sequence is shown in SEQ ID No. 10; the negative quality control product is RNase-free water; the wild-type quality control product comprises the P1 gene and the gene with no mutation at the 23S rRNA A2067G site and the internal standard gene sequence, and the specific sequence is shown in SEQ ID No. 11.

[0013] The third aspect of the present invention provides a method for detecting Mycoplasma pneumoniae and its josamycin-resistant mutation site, comprising the following steps: S1, obtaining a nucleic acid sample of a biological sample to be tested; S2, using the first primer pair and the first probe as well as the second primer pair and the second probe described in the first aspect to perform fluorescence quantitative PCR amplification detection on the nucleic acid sample obtained in step S1; S3, according to the Ct value of the test result, use the following table to determine whether Mycoplasma pneumoniae exists in the biological sample to be tested, and if so, whether the Mycoplasma pneumoniae has a drug-resistant mutation:

[0014] Wherein, Ct1 represents the Ct value obtained by detecting the first primer-probe combination, Ct2 represents the Ct value obtained by detecting the second primer-probe combination, and ΔCt=Ct2-Ct1.

[0015] In some embodiments of the present invention, step S2 also includes using the third primer pair and the third probe described in the first aspect to perform fluorescent quantitative PCR amplification detection on the nucleic acid sample obtained in step S1. If the Ct value obtained by the third primer-probe combination detection is not greater than 35, the judgment described in step S3 is performed.

[0016] In some embodiments of the present invention, the data collection in the fluorescence quantitative PCR amplification detection is set at 64°C.

[0017] In some embodiments of the present invention, the reaction system for fluorescent quantitative PCR amplification in step S2 is: TaqManqPCR buffer 12-13 μL, 5 U / μL Hotstart D-Taq 0.5-0.6 μL, primer probe working solution 6.5-7.0 μL, and a total volume of 20 μL.

[0018] In some embodiments of the present invention, in the primer-probe working solution: the final concentration of the first primer pair is twice that of the second primer pair and the third primer pair, the final concentration of the first probe is the same as the final concentration of the second primer pair, the final concentration of the second probe is the same as the final concentration of the first primer pair, and the final concentration of the third probe is 0.75 times the final concentration of the first probe.

[0019] In some embodiments of the present invention, the fluorescence quantitative PCR amplification program is: 50°C 2min; 95°C 2min; 91°C 15sec, 64°C 1min, 35-42 cycles.

[0020] In some embodiments of the present invention, the biological sample to be tested is an oropharyngeal swab, a nasopharyngeal swab, a bronchoalveolar lavage fluid or a sputum sample.

[0021] Beneficial effects of the present invention Compared with the prior art, the present invention has the following beneficial effects: The present invention is based on fluorescent quantitative PCR technology and is used for in vitro qualitative detection of the positivity of Mycoplasma pneumoniae, while detecting the macrolide josamycin antibiotic resistance mutation, analyzing the MP resistance mutation, guiding the clinical medication of MP-infected patients, improving the accuracy of diagnosis, and promoting precision medicine.

[0022] The present invention screened out the optimal primer-probe combination with good specificity and sensitivity. The minimum detection limit of Mycoplasma pneumoniae drug-resistant mutations can reach 200 copies / mL. 6 copies / mL~10 8 In the range of copies / mL, the mutation detection rate reached 0.1%. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The amplification curve obtained by the optimal primer-probe combination screened in Example 1 of the present invention is shown; Figure 2 The minimum detection limit amplification curve diagram in Example 3 of the present invention is shown; Figure 3 The amplification curves of the mutation ratios at 0.1% at different wild plasmid concentrations in Example 4 are shown; Figure 4The amplification curves of 7 clinical samples in Example 5 are shown. The blue color is the FAM fluorescence signal, which detects the drug-resistant type of Mycoplasma pneumoniae; the green color is the VIC fluorescence signal, which detects Mycoplasma pneumoniae; and the purple color is the CY5 fluorescence signal, which detects the human internal standard. DETAILED DESCRIPTION

[0024] The following examples are used to demonstrate preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors that can be used to implement the present invention and therefore can be considered as preferred embodiments of the present invention. However, it will be appreciated by those skilled in the art based on this specification that many modifications may be made to the specific embodiments disclosed herein and still achieve the same or similar results without departing from the spirit or scope of the present invention.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs, and the materials cited herein and those cited by them are incorporated by reference. Those skilled in the art will recognize or will learn through routine experimentation that there are many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the claims.

[0026] The technical solution of the present application is further described in detail below in conjunction with specific implementation methods.

[0027] Example 1 Primer probe design and screening Download the P1 gene sequence of Mycoplasma pneumoniae from the NCBI database, perform sequence comparison to find the conserved region of the P1 gene sequence and design primer probes. Design primer probes for the 2067 mutation site of the Mycoplasma pneumoniae resistance mutant, and design primer probes for the human β-actin gene. A total of 12 sets of primer probe combinations were designed, and the most suitable primer probe combination was screened out through sensitivity and tolerance tests. The specific implementation steps are as follows: We used 2067 (A) wild-type plasmid and 2067 (G) mutant positive plasmid as templates, and the concentration of wild-type template was 10 6 copies / mL, mutant positive template concentration is 10 4 The 12 sets of primer-probe combinations shown in Table 1 were screened to screen out primer-probe combinations with good sensitivity to drug-resistant mutations and good tolerance to wild-type. The screening results of the 12 sets of primer-probes are shown in Table 2.

[0028] Table 112 Primer probe combination information

[0029] Table 2 Primer probe screening results

[0030] The results showed that combination 3 had good sensitivity to drug-resistant mutations and good tolerance to wild-type, and was the most suitable primer-probe combination. The amplification curve using primer-probe combination 3 was as follows: Figure 1 The primer and probe sequence information of combination 3 is shown in Table 3.

[0031] Table 3 Primer probe sequence information for combination 3

[0032] Example 2 Method for detecting Mycoplasma pneumoniae and 23S rRNA gene A2067G mutation site using a kit 1. Preparation of primer and probe working solution The kit contains the primer probe dry powder obtained by screening in Example 1, Primer probe powder is diluted to 20 μM with 1×TE Buffer. The calculation method is as follows: Dilute according to the number of nmoles: 1×TE Buffer added to each tube = number of nmoles × 50 (μL); after adding 1×TE Buffer, vortex for about 30 seconds to evenly mix, and briefly centrifuge at low speed.

[0033] Prepare primer and probe working solutions according to Table 4 below, vortex mix the prepared solutions and label them.

[0034] Table 4 Preparation of primer probe working solution

[0035] 2. PCR detection reagents The kit also contains PCR detection reagents.

[0036] The PCR detection reagent used in this example is the Hieff Unicon® C15P2 TaqMan Multiplex qPCR Probe Kit reagent produced by Yisheng Biotechnology (Shanghai) Co., Ltd.

[0037] 3. Preparation of positive quality control, wild-type quality control and negative quality control The kit is equipped with positive quality control, wild-type quality control and negative quality control to monitor the effectiveness of the entire process from extraction to detection.

[0038] The negative quality control product is RNase-free water, and the positive quality control product is a sequence containing the P1 gene, a gene with a mutation at the 23S rRNA A2067G site, and an internal standard gene, the sequence of which is shown in SEQ ID No. 10.

[0039] The wild-type quality control product is a gene containing the P1 gene and the 23S rRNA A2067G site without mutation and an internal standard gene sequence, and the sequence is shown in SEQ ID No. 11.

[0040] There is only one base difference between the wild-type quality control and the positive quality control at position 2067, that is, the positive quality control has base G at position 2067, while the wild-type quality control has base A at position 2067.

[0041] Positive control product sequence SEQ ID No. 10: CAGATCACCTTTAACCCCTTTGGCGGCTTTGGTTTGAGTGGGGCTGCACCCCAACAGTGAAACGAGGTCAAAAACAAGGTCCCCGTCGAGGTGGCGCAAGACCCCTCCAATCCTTATCGGTTTGCCGTTTTACTCGTGCCAACGGCGGCCG TAACTATAACGGTCCTAAGGTAGCGAAATTCCTAGTCGGGTAAATTCCGTCCCGCTTGAATGGTGTAACCATCTCTTGACTGTCTCGGCTATAGACTCGGTGAAATCCAGGTACGGGTGAAGACACCCGTTAGGCGCAACGGGACGGAAAG G CCCCGTGAAGCTTTACTGTAGCTTAATAGGAAGGAAGGCTGGAAGAGTGCCTCAGGGCAGCGGAACCGCTCATTGCCAATGGTGATGACCTGGCCGTCAGGCAGCTCGTAGCTCTTCTCCAGG Wild-type quality control product sequence SEQ ID No. 11: CAGATCACCTTTAACCCCTTTGGCGGCTTTGGTTTGAGTGGGGCTGCACCCCAACAGTGAAACGAGGTCAAAAACAAGGTCCCCGTCGAGGTGGCGCAAGACCCCTCCAATCCTTATCGGTTTGCCGTTTTACTCGTGCCAACGGCGGCCG TAACTATAACGGTCCTAAGGTAGCGAAATTCCTAGTCGGGTAAATTCCGTCCCGCTTGAATGGTGTAACCATCTCTTGACTGTCTCGGCTATAGACTCGGTGAAATCCAGGTACGGGTGAAGACACCCGTTAGGCGCAACGGGACGGAAAG A CCCCGTGAAGCTTTACTGTAGCTTAATAGGAAGGAAGGCTGGAAGAGTGCCTCAGGGCAGCGGAACCGCTCATTGCCAATGGTGATGACCTGGCCGTCAGGCAGCTCGTAGCTCTTCTCCAGG 4. Testing process (1) Nucleic acid extraction (PCR II room) Use the nucleic acid extraction or purification reagent (magnetic bead method) and follow the instructions to extract the sample to be tested and prepare nucleic acid.

[0042] (2) Preparation of reaction system (PCRⅠ room) The reaction system was prepared according to Table 5. After preparation, 20 μL / well was dispensed into PCR reaction wells and transferred to PCR II chamber.

[0043] Table 5 Preparation of reaction system

[0044] (3) Sample addition (PCR II chamber) The nucleic acid prepared in (1) was added into the reaction system at 5 μL / well. After the addition was completed, the sample was transferred to the PCR III chamber for on-machine detection.

[0045] (4) On-machine testing (PCR III room) Place the reaction tube in a fluorescent PCR detector and set the PCR reaction program for detection according to Table 6. The collection of fluorescent signals is set to FAM, HEX / VIC, and CY5, the data collection is set at 64°C, and the reaction volume of each well is set to 20 μL.

[0046] Table 6 PCR reaction program

[0047] 5. Results Analysis After the reaction is completed, the instrument automatically saves the results, analyzes the image, and adjusts the Start value, End value, and Threshold value of the Baseline (you can adjust it yourself, the Start value can be between 3-15, and the End value can be between 5-20).

[0048] The FAM fluorescence and HEX / VIC fluorescence channels of the negative quality control should be negative; the FAM fluorescence and HEX / VIC fluorescence Ct values ​​of the positive quality control should be ≤30.00; the HEX / VIC fluorescence Ct value of the wild-type quality control should be ≤30.00, and the FAM fluorescence should be negative. The details are as follows: (1) In general, the Ct value of the internal standard is ≤35.00; however, if the internal standard is not amplified due to the high concentration of the target gene in the FAM and HEX / VIC channels, the result can be determined directly or the sample can be diluted tenfold and re-measured.

[0049] (2) For samples to be tested, when the Ct value of Mycoplasma pneumoniae (HEX / VIC channel) is greater than 35.00, the Ct value of the A2067G mutation (FAM channel) and its amplification curve have no guiding significance and cannot be used to determine the A2067G mutation.

[0050] (3) For the sample to be tested, when the Ct value of Mycoplasma pneumoniae (HEX / VIC channel) is ≤35.00 and a typical S-shaped amplification curve is presented, the A2067G resistance mutation is determined. The determination requires calculating the CT difference between the FAM channel and the HEX / VIC channel, i.e., the △Ct value. The specific determination rules are shown in Table 7 below: Table 7 Result judgment table

[0051] Note: *ΔCt value = Ct value of ROX channel - Ct value of HEX / VIC channel.

[0052] Example 3 Minimum detection limit The Mycoplasma pneumoniae 2067 drug-resistant mutant plasmid sample was selected for the detection limit test. The specific scheme is as follows: the drug-resistant mutant plasmid with a known copy number was diluted with negative nucleic acid to 400 copies / mL, 200 copies / mL and 100 copies / mL respectively. Each sample was tested 20 times, and the lowest concentration with a 95% positive detection rate was taken as the minimum detection limit. The test results are shown in Table 8, and the results show that the minimum detection limit of the A2067G drug-resistant mutant is 200 copies / mL. The amplification curve of the minimum detection limit is shown in the figure below. Figure 2 shown.

[0053] Table 8 Minimum detection limit test results

[0054] Example 4 Mutation Detection Rate The wild-type Mycoplasma pneumoniae and Mycoplasma pneumoniae 2067 drug-resistant mutant plasmid samples were selected for mutation detection rate testing. The specific scheme is as follows: wild-type Mycoplasma pneumoniae plasmid and Mycoplasma pneumoniae 2067 drug-resistant mutant plasmid plasmid were mixed to prepare plasmid mixtures with different mutation ratios. The wild-type plasmid concentration was 5×10 6 copies / mL~10 8 The mutant plasmid mutation ratio was 1%, 0.1%, and 0.01%, and each plasmid mixture was tested 20 times. The test results should all be positive. The test results are shown in Table 9. When the wild-type plasmid concentration was 5×10 6 copies / mL~10 8 In the range of copies / mL, the mutation detection rate reached 0.1%, and the amplification curve is shown in Figure 3 shown.

[0055] Table 9 Mutation detection rate test results

[0056] Example 5 Detection of clinical samples Seven clinical samples and one positive plasmid sample were selected for detection using the present invention. The detection Ct values ​​are shown in Table 10, and the amplification curves are shown in Figure 4 shown.

[0057] Table 10 Clinical sample test results

[0058] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as references separately. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined in the present application.

Claims

1. A primer-probe combination for detecting Mycoplasma pneumoniae and its josamycin-resistant mutation site, characterized in that: The drug-resistant mutation site is the A2067G mutation site of the 23S rRNA gene; the primer-probe combination includes: (1) First primer-probe combination: The sequences of the first primer pair for targeted amplification of the Mycoplasma pneumoniae P1 gene are shown in SEQ ID No. 1 and SEQ ID No. 3, and the sequence of the first probe for detecting the Mycoplasma pneumoniae P1 gene is shown in SEQ ID No. 2; (2) Second primer-probe combination: The sequences of the second primer pair for targeted amplification of the A2067G mutation site of the 23S rRNA gene are shown in SEQ ID No. 4 and SEQ ID No. 6, and the sequence of the second probe for detecting the A2067G mutation site of the 23S rRNA gene is shown in SEQ ID No. 5; The first probe is labeled with a first fluorescent group at its 5' end and a first quencher group at its 3' end, and the second probe is labeled with a second fluorescent group at its 5' end and a second quencher group at its 3' end, wherein the first fluorescent group is different from the second fluorescent group, and the first quencher group and the second quencher group are the same or different.

2. The primer-probe combination for detecting Mycoplasma pneumoniae and its josamycin-resistant mutation site according to claim 1, characterized in that: It also includes a third primer-probe combination: the sequences of the third primer pair for targeted amplification of the β-actin gene are shown in SEQ ID No. 7 and SEQ ID No. 9 respectively, and the sequence of the third probe for detecting the β-actin gene is shown in SEQ ID No. 8, the 5' end of the third probe is labeled with a third fluorescent group, and the 3' end is labeled with a third quenching group, the third fluorescent group is different from the first fluorescent group and the second fluorescent group, and the third quenching group is the same as or different from the first quenching group or the second quenching group.

3. A kit for detecting Mycoplasma pneumoniae and its josamycin-resistant mutation sites, characterized in that: Comprising the primer-probe combination of claim 1 or 2.

4. The kit according to claim 3, characterized in that Also included are positive quality control products, negative quality control products and / or wild-type quality control products and PCR detection reagents.

5. A method for detecting Mycoplasma pneumoniae and its josamycin-resistant mutation site, characterized in that: The following steps are involved: S1, obtaining a nucleic acid sample of a biological sample to be tested; S2, using the first primer pair and the first probe as well as the second primer pair and the second probe as described in claim 1 to perform fluorescence quantitative PCR amplification detection on the nucleic acid sample obtained in step S1; S3, according to the Ct value of the test result, use the following table to determine whether Mycoplasma pneumoniae exists in the biological sample to be tested, and if so, whether the Mycoplasma pneumoniae has a drug-resistant mutation: Wherein, Ct1 represents the Ct value obtained by detecting the first primer-probe combination, Ct2 represents the Ct value obtained by detecting the second primer-probe combination, and ΔCt=Ct2-Ct1.

6. The method according to claim 5, characterized in that Step S2 also includes using the third primer pair and the third probe described in claim 2 to perform fluorescent quantitative PCR amplification detection on the nucleic acid sample obtained in step S1. If the Ct value obtained by the third primer-probe combination detection is not greater than 35, the judgment described in step S3 is performed.

7. The method according to claim 6, characterized in that The reaction system for fluorescence quantitative PCR amplification in step S2 is: TaqMan qPCR buffer 12-13 μL, 5 U / μL Hotstart D-Taq 0.5-0.6 μL, primer probe working solution 6.5-7.0 μL, and a total volume of 20 μL.

8. The method according to claim 7, characterized in that: In the primer-probe working solution: the final concentration of the first primer pair is twice that of the second primer pair and the third primer pair, the final concentration of the first probe is the same as that of the second primer pair, the final concentration of the second probe is the same as that of the first primer pair, and the final concentration of the third probe is 0.75 times that of the first probe.

9. The method according to any one of claims 5 to 8, characterized in that: The fluorescence quantitative PCR amplification program is: 50°C 2min; 95°C 2min; 91°C 15sec, 64°C 1min, 35-42 cycles.

10. The method according to claim 5, characterized in that: The biological sample to be tested is an oropharyngeal swab, a nasopharyngeal swab, a bronchoalveolar lavage fluid or a sputum sample.

Images