RPA-LFD primer pair probe combination for detecting mango colletotrichum gloeosporioides, detection method and application

Abstract

The invention relates to an RPA-LFD primer pair probe combination for detecting mango Asian colletotrichum gloeosporioides, a detection method and application of the RPA-LFD primer pair probe combination. The RPA-LFD primer pair probe combination comprises an upstream primer Ca-RPAP1, a downstream primer Ca-RPAP2 and a probe Ca-RPAT1, the nucleotide sequence of the upstream primer Ca-RPAP1 is as shown in SEQ ID No. 1; the nucleotide sequence of the downstream primer Ca-RPAP2 is as shown in SEQ ID No.2, and the 5'tail end of the downstream primer Ca-RPAP2 is marked with Biotin; the nucleotide sequence of the probe Ca-RPAT1 is as shown in SEQ ID No.3, a fluorophore 6-FAM is added to the 5'terminal, a modification group C3-Spacer for inhibiting extension or amplification of polymerase is added to the 3 'terminal, and tetrahydrofuran is connected between the 31st site and the 32nd site of the SEQ ID No.3. The special primer and the probe are designed aiming at the DNA template of the mango Asian colletotrichum, so that the mango Asian colletotrichum can be rapidly, simply, specifically and sensitively detected, and the problems that the existing detection is relatively tedious, time-consuming and labor-consuming are effectively solved.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to an RPA-LFD primer pair probe combination for detecting Asian anthracnose bacteria in mango, a detection method and an application thereof. Background Art

[0002] Mango anthracnose is one of the important diseases of mango during the growth period and post-harvest storage period. It mainly harms mango seedlings, tender shoots, leaves and fruits, especially having a fatal effect on post-harvest fruits, causing fruits to rot in the field or during storage and transportation, resulting in huge losses. Asian anthracnose (Colletotrichum asianum) is currently reported worldwide as a dominant pathogen that can cause mango anthracnose. Therefore, the establishment of a rapid detection system for Asian anthracnose will help the early diagnosis of mango anthracnose, and at the same time, it will be possible to formulate reasonable prevention and control strategies in a timely manner to promote the healthy development of the mango industry.

[0003] Specifically, the molecular biological methods used to detect mango anthracnose pathogens mainly include conventional polymerase chain reaction (PCR), quantitative real-time polymerase chain reaction (qPCR), loop-mediated isothermal amplification (LAMP), etc. However, due to the characteristics of the above methods such as cumbersome and time-consuming operation, expensive instruments and equipment, and high requirements on the technical level of detection personnel and instrument precision, there are certain limitations in the promotion and application at the grassroots level.

[0004] Recombinase Polymerase Amplification (RPA) is a new isothermal nucleic acid amplification technology. It is particularly suitable for rapid detection in grassroots laboratories and field sites due to its advantages such as strong specificity, short reaction time, high sensitivity, and diversified result reading. If RPA technology is combined with lateral flow immunochromatographic test strips (LFD), rapid and visual detection of target products can be achieved, further optimizing the detection process of pathogens.

[0005] At present, RPA-LFD technology has been widely used in the identification and detection of various plant pathogens such as bacteria, fungi, viruses, and protozoa, but there are no related reports on Asian anthracnose in mango. Summary of the invention

[0006] In view of this, the main purpose of the present invention is to provide an RPA-LFD primer pair probe combination, a detection method and an application for detecting Asian anthrax bacteria in mango, design special primers and probes for the DNA template of Asian anthrax bacteria in mango, which can quickly, simply, specifically and sensitively detect Asian anthrax bacteria in mango, and effectively solve the problem that the existing detection is cumbersome, time-consuming and labor-intensive.

[0007] In a first aspect, the present application provides an RPA-LFD primer pair probe combination for detecting Asian anthracnose fungi in mango, comprising:

[0008] Primer pairs and probe Ca-RPAT1;

[0009] The primer pair includes an upstream primer Ca-RPAP1 and a downstream primer Ca-RPAP2;

[0010] The nucleotide sequence of the upstream primer Ca-RPAP1 is shown in SEQ ID No. 1;

[0011] The nucleotide sequence of the downstream primer Ca-RPAP2 is shown in SEQ ID No. 2, and the 5' end of the downstream primer Ca-RPAP2 is labeled with Biotin;

[0012] The nucleotide sequence of the probe Ca-RPAT1 is shown in SEQ ID No.3, and the 5' end of the probe Ca-RPAT1 is added with a fluorescent group 6-FAM, the 3' end is added with a modification group C3-Spacer that inhibits polymerase extension or amplification, and tetrahydrofuran is connected between the 31st and 32nd positions of the SEQ ID No.3 sequence.

[0013] The nucleotide sequence of the upstream primer Ca-RPAP1, the nucleotide sequence of the downstream primer Ca-RPAP2 and the nucleotide sequence of the probe Ca-RPAT1 are designed based on the genome sequence of Colletotrichum asiaticum (Accession: WOWK01000023.1), and the length of the amplified target fragment is 242 bp, and the sequence of the target fragment is:

[0014] 5'-ACCTTCTATAATACTAAGGTAGATGCAGCCTAGGCCTAGGTATAAG CTAGTAGGGGAACATTAGTGAGTGCGCCTTACGCCGACTGTTACATAGAGAGCGTTGCTAACGATGGCATAGCTGCTGTAAAGGCGTCAGCCGACCTAATCAAATAAGAAGATAACGATAGTAACGAATAGTAGACGGCGAAGCAGTGATAGAGATGGTATTAGCGGCGTAGGTGATGCGCGAGAGAGAGGAT-3'.

[0015] In a second aspect, the present application embodiment provides a method for detecting Asian anthracnose fungi in mango based on RPA-LFD, comprising the following steps:

[0016] Using the genomic DNA of the sample to be tested as a template, the above-mentioned primer pair probe combination is used to establish a recombinase polymerase amplification system for RPA amplification to obtain an RPA amplification product;

[0017] The RPA amplification product is added to the lateral flow immunoassay paper, and the color reaction of the control line and the test line is observed to determine the test result.

[0018] In some embodiments, the recombinase polymerase amplification system comprises:

[0019] Sample DNA template, upstream primer Ca-RPAP1, downstream primer Ca-RPAP2, probe Ca-RPAT1, enzyme lyophilized powder, magnesium acetate and ddH2O.

[0020] In some embodiments, the enzyme lyophilized powder comprises:

[0021] It combines single-stranded nucleic acid recombinase, strand-displacing DNA polymerase, single-stranded DNA binding protein, dNTP and endonuclease, and is provided separately or in a premixed solution.

[0022] In some embodiments, the reaction conditions of the RPA amplification include:

[0023] The amplification temperature is 32-40°C and the amplification time is 10-40 minutes.

[0024] In some embodiments, the reaction conditions of the RPA amplification include:

[0025] The amplification temperature is 34-40°C and the amplification time is 20-40 minutes.

[0026] In some embodiments, the reaction conditions of the RPA amplification include:

[0027] The amplification temperature is 36-38°C and the amplification time is 25-30 minutes.

[0028] In some of the embodiments, when the RPA amplification product is loaded onto the lateral flow immunoassay paper, the RPA amplification product is diluted 20 times and the reaction time is 5-10 min.

[0029] In some of the embodiments, when observing the color reactions of the control line and the test line and determining the test result:

[0030] If the control line is visible and the test line is not colored, it is recorded as a negative result, indicating that the sample to be tested does not contain Asian anthrax;

[0031] If both the control line and the test line are visible, it is recorded as a positive result, indicating that the sample to be tested contains Asian anthrax;

[0032] If the control line does not show color, it is recorded as an invalid test result.

[0033] In a third aspect, an embodiment of the present application provides an application of the above-mentioned RPA-LFD primer pair probe combination for detecting Asian anthracnose fungus in mango in detecting Asian anthracnose fungus in mango.

[0034] Technical effects of the present invention:

[0035] The present invention designs special primers and probes for the DNA template of mango Asian anthracnose bacteria. Specifically, the upstream primer Ca-RPAP1, the downstream primer Ca-RPAP2 and the probe Ca-RPAT1 can be amplified by RPA, and only amplify the mango Asian anthracnose bacteria in combination with LFD, and the detection specificity is strong. At the same time, the detection method of the present invention can have the advantages of short detection time, high sensitivity and simple operation, and is particularly suitable for rapid detection at the grassroots or on-site, and has important practical application value.

[0036] Further features and aspects of the present disclosure will become apparent from the following detailed description of exemplary embodiments with reference to the attached drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate exemplary embodiments, features, and aspects of the disclosure and, together with the description, serve to explain the principles of the disclosure.

[0038] Figure 1The specific analysis result diagram of the method for detecting Asian anthracnose fungi in mango based on RPA-LFD according to the embodiment of the present application is shown, (A) agarose gel electrophoresis diagram of the basic RPA amplification reaction product, (B) detection result of the RPA-LFD amplification reaction product on the lateral flow immunochromatographic test strip; M in the two figures: DL2000 DNA marker; N: negative control; 1: Asian anthracnose fungi (C.asianum); 2: Gloeosporioides; 3: Siamese anthracnose fungi (C.siamense); 4: Fruit thorn disc spore (C.fructicola); 5: Botryosphaeria dothidea; 6: Neofusicoccum parvum; 7: Diaporthe passifloricola; 8: Botrytiscinerea; 9: Aspergillus niger; 10: Penicillium citrinum); 11: Saccharomyces cerevisiae;

[0039] Figure 2 The following are analysis diagrams showing the effects of different temperature conditions on the RPA-LFD detection results of mango Asian anthracnose fungi according to the embodiments of the present application, (A) agarose gel electrophoresis of basic RPA amplification products under different temperature conditions, (B) detection results of RPA-LFD amplification products on lateral flow immunochromatography test strips under different temperature conditions; in both figures, M: DL2000 DNA marker; N: negative control; 1: 30°C; 2: 32°C; 3: 34°C; 4: 36°C; 5: 38°C; 6: 40°C;

[0040] Figure 3 The following are analysis diagrams showing the effects of different reaction times on the RPA-LFD detection of Asian anthracnose fungi in mango according to the embodiments of the present application, (A) agarose gel electrophoresis of the basic RPA amplification reaction products under different reaction time conditions, (B) detection results of the RPA-LFD amplification reaction products on lateral flow immunochromatographic test strips under different reaction time conditions; in both figures, M: DL2000 DNA marker; N: negative control; 1: 10 min; 2: 15 min; 3: 20 min; 4: 25 min; 5: 30 min; 6: 35 min; 7: 40 min;

[0041] Figure 4Shown are the sensitivity analysis diagram of the RPA-LFD detection method for mango Asian anthracnose fungus of an embodiment of the present application, (B) the agarose gel electrophoresis diagram of the basic RPA amplification reaction products under different DNA concentration conditions, (B) the detection results of the RPA-LFD amplification reaction products under different DNA concentration conditions on the lateral flow immunochromatography test strip, and (C) the agarose gel electrophoresis diagram of the conventional PCR amplification reaction products under different DNA concentration conditions; in the three diagrams, M: DL2000 DNA marker; 1: 100 ng / μL; 2: 10 ng / μL; 3: 1 ng / μL; 4: 100 pg / μL; 5: 10 pg / μL; 6: 1 pg / μL; 7: 100 fg / μL; N: negative control. DETAILED DESCRIPTION

[0042] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0043] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0044] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0045] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0046] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0047] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials, reagents and instruments used in the following examples are purchased from commercial channels unless otherwise specified. The following are the test bacteria and reagents used in the examples, as follows:

[0048] 1. Test strains: C.asianum, C.gloeosporioides, C.siamense, C.fructicola, Botryosphaeriadothidea, Neofusicoccum parvum, Diaporthe passifloricola, Botrytiscinerea, Aspergillus niger, Penicilliumcitrinum, Saccharomyces cerevisiae; the above strains are provided by the Experimental Center of the School of Food Engineering, Beibu Gulf University;

[0049] 2. Main reagents: Fungal DNA Kit fungal genome extraction kit was purchased from Guangzhou Feiyang Bioengineering Co., Ltd. (catalog number D9930); TwistAmp nfo kit was purchased from TwistDx, UK (catalog number TANF002KIT); KODPlus Neo PCR kit (catalog number KOD-401) was purchased from Toyobo (Shanghai) Biotechnology Co., Ltd.; lateral flow immunochromatography test strips (catalog number B110202) were purchased from Shanghai Sangon Biotechnology Co., Ltd., and primers and probes were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0050] Example 1 Design of primers and probe sequences for RPA-LFD of Colletotrichum asiaticum

[0051] According to the genome sequence of Colletotrichum asiaticum (Accession: WOWK01000023.1), the RPA-LFD primer pair was designed, namely the upstream primer Ca-RPAP1 and the downstream primer Ca-RPAP2, as well as the probe Ca-RPAT1 sequence. The amplified target fragment length is 242 bp, and the specific target fragment sequence information is as follows:

[0052] 5'-ACCTTCTATAATACTAAGGTAGATGCAGCCTAGGCCTAGGTATAAG CTAGTAGGGGAACATTAGTGAGTGCGCCTTACGCCGACTGTTACATAGAGAGCGTTGCTAACGATGGCATAGCTGCTGTAAAGGCGTCAGCCGACCTAATCAAATAAGAAGATAACGATAGTAACGAATAGTAGACGGCGAAGCAGTGATAGAGATGGTATTAGCGGCGTAGGTGATGCGCGAGAGAGAGGAT-3';

[0053] It should be noted that the design of special primers and probes for RPA-LFD of Asian anthracnose fungi in mango was assisted by PrimerPremier 6.0 software and Snapgene 6.2.2. Specifically, the primer length is set to 30-35bp, the GC content is set to 40-60%, and the product length is set to 100-300bp. The probe design is based on the target sequence amplified by RPA special primers. The probe length is not less than 46nt, of which the 5' end is modified with 6-FAM (6-carboxyfluorescein), the 3' end is spaced with a C3-Spacer group, and an empty base THF (tetrahydrofuran) site is connected to the middle position of the probe. The THF site is before 32nt of the probe and after 15nt. The designed primers and probes are synthesized by Shanghai Shenggong Biotechnology Co., Ltd. According to the design principles of the above-mentioned special primers and probes, combined with the detection characteristics of RPA-LFD, the designed special primers and probe sequences are as follows:

[0054] Upstream primer Ca-RPAP1: 5′-CTCTAGCTATCCTAAGGAGTAGCCCTTCTTTAC G-3′ (SEQ ID No. 1);

[0055] Downstream primer Ca-RPAP2: 5′-(Biotin)ATCCTCTCTCTCGCGCATCACCTACG CCGCTA-3′ (SEQ ID No. 2);

[0056] Probe Ca-RPAT1: 5'-(6-FAM)ACCTTCTATAATACTAAGGTAGATGCAG CCT(THF)AGGCCTAGGTATAAG(C3-Spacer)-3' (SEQ ID No. 3).

[0057] Example 2 Specific detection of Colletotrichum asiaticum in mango by RPA-LFD

[0058] The genomic DNA of C.asianum, C.gloeosporioides, C.siamense, C.fructicola, Botryosphaeriadothidea, Neofusicoccum parvum, Diaporthe passifloricola, Botrytiscinerea, Aspergillus niger, Penicilliumcitrinum and Saccharomyces cerevisiae were extracted and used as templates for basic RPA amplification reaction and RPA-LFD amplification reaction;

[0059] Basic RPA amplification reaction:

[0060] Use the upstream primer Ca-RPAP1 and the downstream primer Ca-RPAP2. The specific reaction system equipment is 50 μL, including 29.5 μL of reaction buffer, 2.0 μL of upstream primer Ca-RPAP1 (10 μM), 2.0 μL of downstream primer Ca-RPAP2 (10 μM), 1.0 μL of DNA template, supplement ddH2O to 47.5 μL, add it to the reaction tube containing enzyme lyophilized powder and mix it thoroughly, then add 2.5 μL MgAc (280 μM) to start the reaction. Then quickly place it at 38°C for 30 minutes. After the reaction, the amplified product was purified and detected by electrophoresis on 1.5% agarose gel. Negative controls were set for the above tests. The negative controls did not add DNA templates and were supplemented with ddH2O.

[0061] RPA-LFD amplification reaction:

[0062] The specific reaction system components are basically the same as the basic RPA system components, except that 0.6μL Ca-RPAT1 probe (10μM) components need to be added, and ddH2O is adjusted to 47.5μL. After fully mixing with the enzyme-containing lyophilized powder, 2.5μL MgAc (280μM) is added to start the reaction. Also react at 38°C for 30 minutes. After the reaction is completed, 5μL of the amplified product is added to 95μL ddH2O for dilution. After fully mixing, 80μL of the dilution solution is injected into the sample well of the LFD (lateral flow immunochromatography test strip), and the test results are recorded after waiting for 5-10 minutes at room temperature.

[0063] It should be noted that the above detection methods all set up negative controls, which did not contain DNA template but were supplemented with ddH2O.

[0064] It should also be noted that the present invention adopts a method combining RPA with LFD (lateral flow immunochromatographic test strip), and its detection principle is that the DNA template of the sample to be tested is specifically amplified by a probe labeled with 6-FAM (6-hydroxyfluorescein) and a primer labeled with Biotin (biotin) to form a double-labeled nucleic acid amplification product. After the amplification product is added to the loading end of the LFD (lateral flow immunochromatographic test strip), the amplification product will bind to the anti-6-FAM (6-carboxyfluorescein) antibody on the LFD (lateral flow immunochromatographic test strip) to form a ternary complex, and then the ternary complex diffuses to the detection line end under the chromatographic action of the capillary effect, and binds to the biotin ligand fixed on the detection line to form a colored detection line. If the DNA template of the sample to be tested cannot amplify a double-labeled nucleic acid amplification product or the amount of the amplification product is less than the minimum detection limit of the LFD (lateral flow immunochromatographic test strip), the detection line does not show color. Regardless of whether the double-labeled nucleic acid amplification product is present, the control line should be colored. The color reaction of the control line is the standard for determining whether the sample volume is sufficient and whether the chromatography process is normal. It is also the internal control standard of the RPA-LFD detection method. Therefore, if the control line does not color, regardless of whether the detection line is colored, it will be judged as an invalid test result.

[0065] The results are as follows Figure 1 As shown by Figure 1 It can be seen that no matter it is the basic RPA amplification reaction or the RPA-LFD amplification reaction, only the Asian anthrax treatment is amplified, and there is no cross reaction with other bacteria. This shows that the special primers and probes designed in the present invention have strong specificity.

[0066] Example 3 Optimization of reaction conditions for RPA-LFD of Colletotrichum asiaticum

[0067] 1. Reaction temperature

[0068] The reaction system was configured based on the detection method shown in Example 2 to perform basic RPA amplification reaction and RPA-LFD amplification reaction on the genomic DNA of Asian anthrax. The reaction temperatures were set to 30°C, 32°C, 34°C, 36°C, 38°C, 40°C, and the reaction time was 30min, and 30°C, 32°C, 34°C, 36°C, 38°C, 40°C, and the reaction time was 30min;

[0069] The reaction results are as follows Figure 2 As shown by Figure 2It can be seen from (A) that in the basic RPA amplification reaction detection, a single bright band can be amplified under the reaction conditions of 32°C-40°C, and it can be intuitively seen that the amplification effect under 34°C, 36°C, and 38°C is better than the amplification effect under 32°C and 40°C, but the band amplified under 30°C is weaker. In the RPA-LFD amplification reaction detection, it is shown that under the reaction conditions of 32°C-40°C, the detection line (T position) in the test strips all show a darker color reaction, but the distinction between the treatments is not high. Only in the 30°C treatment does a weaker color reaction appear, which is consistent with the basic RPA amplification reaction results. Combined with the biological characteristics of various enzymes in RPA, the present invention selects 38°C as the optimal reaction temperature and uses it in subsequent experiments. The control line (C position) in all test strips shows a color reaction, indicating that the test results are valid.

[0070] 2. Response time

[0071] Similarly, the reaction system was configured according to the detection method shown in Example 2, and the basic RPA amplification reaction and RPA-LFD amplification reaction were performed on the genomic DNA of Asian anthrax. At 38° C., six different reaction times of 10 min, 15 min, 20 min, 25 min, 30 min, 35 min and 40 min were set;

[0072] The reaction results are as follows Figure 3 As shown by Figure 3 It can be seen that in the basic RPA amplification reaction detection, when the reaction time is 10min and 15min, the amplification band is shallow, and when the reaction time reaches 20min-40min, a bright and clear band appears, and the difference in the treatment of more than 25min of reaction is not obvious. The RPA-LFD amplification reaction detection results are similar to the basic RPA amplification reaction detection results. In the treatment of 15min-40min of reaction, obvious detection line (T position) color reaction can be seen. Only in the treatment of 10min of reaction time, the color of the detection line (T position) is weaker. Therefore, the present invention selects 25min as the optimal reaction time and uses it in subsequent experiments. The control line (C position) in all test strips shows a color reaction, indicating that the test results are valid.

[0073] Example 4 Sensitivity Detection of Colletotrichum asiaticum in Mango by RPA-LFD

[0074] Take 1 μL of 100 ng / μL Asian anthrax genomic DNA and dilute it by 10 times to obtain DNA templates with concentrations of 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 100 fg / μL, respectively. Prepare the reaction system according to the detection method shown in Example 2, perform basic RPA amplification reaction and RPA-LFD amplification reaction on different Asian anthrax genomic DNA concentrations, react at 38°C for 25 minutes, and compare the amplification results with those of conventional PCR primers. Among them, the nucleotide sequence of the primer pair of the PCR method is as follows:

[0075] Upstream primer F: 5′-ACCTTCTATAATACTAAGGTAGATGC-3′;

[0076] Downstream primer R: 5′-ATCCTCTCTCTCGCGCATCACC-3′;

[0077] The amplification conditions were pre-denaturation at 94°C for 3 min; denaturation at 98°C for 10 s, annealing at 56°C for 30 s, and extension at 68°C for 30 s, for a total of 30 cycles; and complete extension at 68°C for 5 min.

[0078] Test results such as Figure 4 As shown by Figure 4 It can be seen that the minimum detection concentration of basic RPA amplification reaction and RPA-LFD amplification reaction is 10pg / μL, while the minimum detection concentration of PCR amplification using conventional PCR primers is 100pg / μL. Therefore, the detection method based on RPA-LFD amplification reaction is more sensitive.

[0079] It can be seen that the effects of the present invention compared with the prior art mainly include:

[0080] 1. Strong detection specificity: The RPA-LFD special primers and probes designed by the present invention only undergo amplification reaction with the mango Asian anthracnose bacteria DNA template, and have a dual specificity guarantee, and have strong detection specificity. At present, there are no RPA-LFD special primers and probes designed for the Asian anthracnose bacteria genome;

[0081] 2. Short detection time: The RPA-LFD detection method of the present invention only takes 10-25 minutes in the RPA amplification process, plus 5-10 minutes for LFD detection reaction, and can determine the results within 15-35 minutes, which is much shorter than the conventional PCR method. In addition, no additional preparation procedures are required before and after the detection, and one-step amplification and one-step detection can be achieved;

[0082] 3. High detection sensitivity: The detection limit of the RPA-LFD detection method of the present invention can reach 10pg / μL, which is 10 times that of conventional PCR (100pg / μL) under the same amplification fragment conditions, and the detection sensitivity is higher;

[0083] 4. Low detection condition requirements: The RPA-LFD detection method of the present invention does not require thermal cycling equipment such as a PCR instrument, and the reaction can be carried out at a constant temperature of 32-40°C; the result detection does not require complex instruments such as gel electrophoresis and ultraviolet imaging systems, and only LFD (lateral flow immunochromatography test strips) is needed to complete the detection. It has low requirements on the technical level of the operator, is simple to operate, and has obvious results.

[0084] In the description of this specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0085] Unless otherwise defined, the technical terms or scientific terms involved in this application should be understood by people with ordinary skills in the technical field to which this application belongs. The words "one", "one", "the" and the like involved in this application do not indicate a quantitative limitation and may represent the singular or plural. The terms "include", "comprise", "have" and any of their variations involved in this application are intended to cover non-exclusive inclusions. The words "connect", "connected", "coupled" and the like involved in this application are not limited to physical or mechanical connections, but include electrical connections, whether direct or indirect. The "multiple" involved in this application refers to two or more, and "and / or" describes the association relationship of associated objects, indicating that three relationships may exist. The character " / " generally indicates that the objects associated before and after are in an "or" relationship. The terms "first", "second", "third" and the like involved in this application are merely to distinguish similar objects and do not represent a specific ordering of objects.

[0086] The above embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but the limitation of the scope of the invention patent cannot be understood as a result. It should be pointed out that, for a person of ordinary skill in the art, several variations or improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. An RPA-LFD primer pair probe combination for detecting Asian anthracnose bacteria in mango, characterized in that: include: Primer pairs and probe Ca-RPAT1; The primer pair includes an upstream primer Ca-RPAP1 and a downstream primer Ca-RPAP2; The nucleotide sequence of the upstream primer Ca-RPAP1 is shown in SEQ ID No. 1; The nucleotide sequence of the downstream primer Ca-RPAP2 is shown in SEQ ID No. 2, and the 5' end of the downstream primer Ca-RPAP2 is labeled with Biotin; The nucleotide sequence of the probe Ca-RPAT1 is shown in SEQ ID No.3, and the 5' end of the probe Ca-RPAT1 is added with a fluorescent group 6-FAM, the 3' end is added with a modification group C3-Spacer that inhibits polymerase extension or amplification, and tetrahydrofuran is connected between the 31st and 32nd positions of the SEQ ID No.3 sequence.

2. A method for detecting Asian anthracnose in mango based on RPA-LFD, characterized in that: The steps include: Using the genomic DNA of the sample to be tested as a template, using the primer pair probe combination of claim 1 to establish a recombinase polymerase amplification system for RPA amplification to obtain an RPA amplification product; The RPA amplification product is added to the lateral flow immunoassay paper, and the color reaction of the control line and the test line is observed to determine the test result.

3. The method for detecting Asian anthracnose in mango based on RPA-LFD according to claim 2, characterized in that, The recombinase polymerase amplification system comprises: Sample DNA template, upstream primer Ca-RPAP1, downstream primer Ca-RPAP2, probe Ca-RPAT1, enzyme lyophilized powder, magnesium acetate and ddH2O.

4. The method for detecting Asian anthracnose in mango based on RPA-LFD according to claim 3, characterized in that, The enzyme freeze-dried powder comprises: It combines single-stranded nucleic acid recombinase, strand-displacing DNA polymerase, single-stranded DNA binding protein, dNTP and endonuclease, and is provided separately or in a premixed solution.

5. The method for detecting Asian anthracnose in mango based on RPA-LFD according to claim 2, characterized in that, The reaction conditions of the RPA amplification include: The amplification temperature is 32-40°C and the amplification time is 10-40 minutes.

6. The method for detecting Asian anthracnose in mango based on RPA-LFD according to claim 5, characterized in that, The reaction conditions of the RPA amplification include: The amplification temperature is 34-40°C and the amplification time is 20-40 minutes.

7. The method for detecting Asian anthracnose in mango based on RPA-LFD according to claim 6, characterized in that, The reaction conditions of the RPA amplification include: The amplification temperature is 36-38°C and the amplification time is 25-30 minutes.

8. The method for detecting Asian anthracnose in mango based on RPA-LFD according to claim 2, characterized in that, When the RPA amplification product is loaded onto the lateral flow immunoassay paper, the RPA amplification product is diluted 20 times and the reaction time is 5-10 minutes.

9. The method for detecting Asian anthracnose in mango based on RPA-LFD according to claim 2, characterized in that, When observing the color reaction of the control line and the test line and judging the test results: If the control line is visible and the test line is not colored, it is recorded as a negative result, indicating that the sample to be tested does not contain Asian anthrax; If both the control line and the test line are visible, it is recorded as a positive result, indicating that the sample to be tested contains Asian anthrax; If the control line does not show color, it is recorded as an invalid test result.

10. Use of the RPA-LFD primer pair probe combination for detecting Colletotrichum asiatica in mango according to claim 1 in detecting Colletotrichum asiatica in mango.

Images