Anti-powdery mildew gene KASP marker based on wheat backbone parental week 8425B genetic background and application thereof

Abstract

The invention belongs to but not limited to the technical field of molecular genetic breeding, and discloses a powdery mildew resistance gene KASP marker based on a wheat backbone parental week 8425B genetic background and application. The KASP labeled primer group 4B1 is composed of an upstream primer Primer-F1 as shown in SEQ ID NO. 1, an upstream primer Primer-F2 as shown in SEQ ID NO. 2, and a downstream primer Primer-R as shown in SEQ ID NO. 3, and the KASP labeled primer group 4B1 is composed of an upstream primer Primer-F1 as shown in SEQ ID NO. 1, an upstream primer Primer-F2 as shown in SEQ ID NO. 2 and a downstream primer Primer-R as shown in SEQ ID NO. The primer combination can assist in identifying the powdery mildew resistance of plants or screening powdery mildew resistant plants. The powdery mildew resistant QTL QPm.caas-4BL. 2 closely linked molecular marker developed by the invention provides a good tool for wheat powdery mildew resistant molecular marker assisted breeding, and plays an important role in wheat powdery mildew resistant breeding.

Description

Technical Field

[0001] The invention belongs to but is not limited to the technical field of molecular genetic breeding, and in particular relates to a marker and application of a powdery mildew resistance gene KASP (Kompetitive allele-specific PCR) based on the genetic background of wheat backbone parent Zhou 8425B. Background Art

[0002] Powdery mildew is an important fungal disease of wheat worldwide, which seriously affects wheat yield and quality. The annual wheat yield loss caused by powdery mildew is as high as 7.6-19.9% ​​worldwide. At present, the resistance of the main wheat varieties in my country to powdery mildew is generally weak and the homogenization phenomenon is serious. The frequency of powdery mildew fungi mutation has increased, resulting in an average annual incidence area of ​​powdery mildew in my country of 8 million hectares in the past two years. Chemical agents have played an important role in the emergency prevention and control of wheat powdery mildew, but their large-scale use has increased production costs and polluted the environment, making wheat production, which has low comparative benefits, face a more severe situation. Therefore, exploring and utilizing excellent powdery mildew resistance gene resources and germplasm resources is an important means to break through the current bottleneck of wheat powdery mildew resistance breeding.

[0003] Zhou 8425B is an important germplasm and backbone parent of dwarf wheat with large spikelets and grains, and resistance to diseases and stresses, created by Professor Zheng Tiancun, a Chinese wheat breeder. By 2023, 966 new varieties have been bred and approved. Zhou 8425B has excellent agronomic traits and good combining ability, especially outstanding resistance to powdery mildew in the adult stage.

[0004] The wheat 90K SNP chip was used to scan the Zhou 8425B / Chinese Spring RIL (Recombinant inbred lines) population and construct a high-density genetic map. Combined with the two-year two-point powdery mildew resistance phenotype of adult plants, the major powdery mildew resistance QTL (Quantitative trait loci) QPm.caas-4BL.2 was located on chromosome 4B. The disease resistance allele came from Zhou 8425B, explaining 6.1-14.7% of the phenotypic variation.

[0005] In view of the above analysis, the technical problem that urgently needs to be solved in the prior art is: how to efficiently detect or assist in the detection of the major powdery mildew resistance QTL QPm.caas-4BL.2 in wheat for use in molecular marker-assisted selection breeding of powdery mildew resistant wheat. Summary of the invention

[0006] In view of the problems existing in the prior art, the present invention provides a primer set for high-throughput and low-cost detection or auxiliary detection of wheat powdery mildew resistance QTL QPm.caas-4BL.2.

[0007] The present invention is achieved by providing a powdery mildew resistance gene KASP marker primer set 4B1 based on the genetic background of wheat backbone parent Zhou 8425B, wherein the KASP marker primer set 4B1 consists of two upstream primers Primer-F1 and Primer-F2, and a downstream primer Primer-R; the nucleotide sequence of Primer-F1 is shown in SEQ ID NO.1, the nucleotide sequence of Primer-F2 is shown in SEQ ID NO.2, and the nucleotide sequence of Primer-R is shown in SEQ ID NO.3.

[0008] The sequences of the KASP marker primers are as follows:

[0009] Primer-F1: 5'- GAAGGTGACCAAGTTCATGCT ctggaagcaacgacggcg-3'(SEQ ID NO.1); the underlined part is the sequence of the fluorescent group FAM;

[0010] Primer-F2:5'- GAAGGTCGGAGTCAACGGATT ctggaagcaacgacggca-3'

[0011] (SEQ ID NO.2); the underlined part is the fluorescent group HEX sequence;

[0012] Primer-R: 5'-ggccatatcgtcctcgtca-3' (SEQ ID NO. 3).

[0013] The molar ratio of the primer Primer-F1, the primer Primer-F2 and the primer Primer-R is 1:1:2.5.

[0014] Another object of the present invention is to provide a kit for detecting or assisting in detecting the powdery mildew resistance QTL QPm.caas-4BL.2, comprising the KASP marker primer set 4B1.

[0015] Furthermore, the kit also contains fluorescent group A, fluorescent group B, fluorescent quenching group A and fluorescent quenching group B; the fluorescent group A is FAM, the fluorescent group B is HEX, and the fluorescent quenching group is BHQ; the fluorescent group A, fluorescent group B, fluorescent quenching group A and fluorescent quenching group B are present in HiGeno 2xProbe Mix B, which is a product of Beijing Jiacheng Biotechnology Co., Ltd., and the product catalog number is AQP-003B.

[0016] Another object of the present invention is to provide the use of the KASP labeling primer set or the kit in any of the following:

[0017] (1) Identifying or assisting in identifying the powdery mildew resistance of wheat to be tested;

[0018] (2) preparing a product for identifying or assisting in identifying the powdery mildew resistance trait of wheat to be tested;

[0019] (3) Detecting or assisting in detecting the allele of the wheat powdery mildew resistance QTL QPm.caas-4BL.2;

[0020] (4) Preparing a product for detecting or assisting in detecting the allele of the wheat powdery mildew resistance QTL QPm.caas-4BL.2.

[0021] Another object of the present invention is to provide the use of the KASP labeling primer set or the kit in any of the following:

[0022] (1) Breeding or assisting in breeding wheat resistant to powdery mildew;

[0023] (2) Preparing products for breeding or assisting in breeding of wheat resistant to powdery mildew.

[0024] Another object of the present invention is to provide a method for identifying or assisting in identifying the resistance of wheat to be tested to powdery mildew, the method comprising:

[0025] The genomic DNA of the wheat to be tested was used as a template, and the KASP labeled primer set 4B1 or the kit (the fluorescent group A was FAM, and the fluorescent group B was HEX) was used to perform PCR amplification to obtain an amplified product, and the fluorescent signal was collected using Phestar, and the genotyping was performed using Kluster caller software. The powdery mildew resistance of the wheat to be tested was determined according to the typing results of the PCR products:

[0026] If the fluorescence signal data of the amplified product of the wheat to be tested is blue light after analysis by the Kluster caller software, it means that the target genotype of the wheat to be tested is GG, and it has or is a candidate for the powdery mildew susceptible trait; if the fluorescence signal data of the amplified product of the wheat to be tested is red light after analysis by the Kluster caller software, it means that the target genotype of the wheat to be tested is AA, and it has or is a candidate for the powdery mildew resistant trait; if the fluorescence signal data of the amplified product of the wheat to be tested is green light after analysis by the Kluster caller software, it means that the target genotype of the wheat to be tested is heterozygous AG.

[0027] Another object of the present invention is to provide a method for detecting or assisting in detecting the powdery mildew resistance QTL QPm.caas-4BL.2 allele to be detected, the method comprising:

[0028] The genomic DNA of the wheat to be tested was used as a template, and PCR amplification was performed using the KASP marker primer set 4B1 or the kit (the fluorescent group A was FAM, and the fluorescent group B was HEX) to obtain an amplified product. The fluorescent signal was collected using Phestar, and the genotyping was performed using Kluster caller software. The allele of the powdery mildew resistance QTL QPm.caas-4BL.2 of the wheat to be tested was determined according to the PCR product typing results:

[0029] If the amplified product of the wheat to be tested is blue light, it means that the target genotype of the wheat to be tested is GG, and it has or is a candidate to have the QPm.caas-4BL.2 disease-susceptible allele; if the amplified product of the wheat to be tested is red light, it means that the target genotype of the wheat to be tested is AA, and it has or is a candidate to have the QPm.caas-4BL.2 disease-resistant allele; if the amplified product of the wheat to be tested is green light, it means that the target genotype of the wheat to be tested is heterozygous AG, and it is in a heterozygous state at the QPm.caas-4BL.2 site.

[0030] Another object of the present invention is to provide a method for breeding wheat resistant to powdery mildew. The method for breeding wheat varieties resistant to powdery mildew provided by the present invention is to select and genetically improve wheat materials containing the QPm.caas-4BL.2 disease resistance allele. In actual breeding applications, wheat varieties containing the QPm.caas-4BL.2 disease-susceptible allele with excellent agronomic traits can be hybridized with wheat varieties containing the QPm.caas-4BL.2 disease resistance allele, and the above-mentioned KASP primer set, kit and method can be used to select single plants containing the QPm.caas-4BL.2 disease resistance allele in the segregating generation, until a stable family with excellent agronomic and quality traits and homozygous QPm.caas-4BL.2 disease resistance allele is bred.

[0031] The wheat to be tested is wheat containing the powdery mildew resistance QTL QPm.caas-4BL.2 or a hybrid progeny thereof with other wheat.

[0032] The invention conducted two-year two-point powdery mildew resistance identification on 242 families of Zhou 8425B / Chinese Spring RIL population in Beijing and Zhengzhou, Henan in 2015-2016 and 2016-2017, used wheat 90KSNP chip to detect genotype of RIL population, and constructed high-density genetic map. Combining Zhou 8425B / Chinese Spring RIL population genotype and phenotypic data, the main effect powdery mildew resistance site QPm.caas-4BL.2 was located on chromosome 4B, explaining phenotypic variation of 6.1-14.7%, flanking markers IWB53740 and IWB62918, corresponding to a genetic interval of 3.4 cM, and corresponding to a physical interval of 7.5 Mb (Chr4B: 609.5-617.0 Mb) of the Chinese Spring reference genome.

[0033] In order to further narrow the QPm.caas-4BL.2 positioning interval, the present invention developed 17 high-throughput KASP markers based on Zhou 8425B resequencing data, combined with Zhou 8425B / Chinese Spring RIL population 90K SNP chip data, constructed a 4B chromosome integrated high-density genetic map, narrowed the QPm.caas-4BL.2 positioning interval to 1.2cM, corresponding to the Chinese Spring reference genome 2.1Mb (Chr4B: 611.6-613.7Mb), and the flanking markers were the newly developed KASP markers 4B1 and 4BJ76. The results of the KASP marker primer set 4B1 in the Zhou 8425B / Chinese Spring RIL population showed that the maximum severity (MDS) of powdery mildew in the family containing the Zhou 8425B allele was 5.5% lower than the average MDS of the family containing the Chinese Spring allele, and the difference was extremely significant (P=7×10 -7 ); In the Zhou 8425B derived offspring population, the MDS of the family containing the Zhou 8425B allele was 4.3% lower than that of the family containing the Chinese Spring allele, and the difference was significant (P=0.03). The experiment proved that the molecular marker 4B1 of the present invention can be used for molecular marker-assisted selection breeding of the major powdery mildew resistance QTL QPm.caas-4BL.2 based on the Zhou 8425B genetic background.

[0034] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0035] The main powdery mildew resistance QTL QPm.caas-4BL.2 located in the Zhou 8425B genetic background in the present invention exhibits a significant disease resistance effect. The test results show that this locus can effectively reduce the susceptibility of wheat varieties to powdery mildew, and its disease resistance effect is stable under a variety of environmental conditions. Compared with materials that do not carry the QPm.caas-4BL.2 locus, the incidence of wheat materials carrying this locus is significantly reduced, and the disease progression is significantly delayed, thereby providing an important functional locus for molecular breeding of powdery mildew resistance.

[0036] The high-throughput KASP marker 4B1 developed by the present invention is closely linked to the QPm.caas-4BL.2 locus, and the target locus can be quickly identified through molecular markers, greatly improving the screening efficiency of powdery mildew-resistant materials. The KASP marker has high sensitivity and specificity, and can achieve high-throughput screening in large-scale breeding projects, while significantly reducing the time and economic costs of molecular detection. Compared with traditional marker detection methods, this marker can screen a large number of samples in a short time, providing extremely high practical value for breeding work.

[0037] Through the application of high-throughput KASP markers, the present invention effectively solves the high cost and low efficiency problems existing in traditional powdery mildew resistance breeding methods. KASP marker technology does not need to rely on complex instruments and equipment, and the detection process is simple and can be operated in batches. In large-scale breeding material screening, the cost of single sample detection is significantly lower than other methods, which greatly reduces breeding investment for breeding companies and scientific research institutions, and accelerates the selection and breeding process of disease-resistant varieties.

[0038] The KASP marker developed by the present invention is not only applicable to the Zhou 8425B genetic background, but can also be extended to other wheat materials with the QPm.caas-4BL.2 locus. This efficient marker tool provides technical support for wheat powdery mildew resistance breeding in multiple environments and genetic backgrounds, and has wide adaptability and practical value. By combining marker-assisted selection technology, this marker is expected to promote the molecular breeding of wheat disease resistance in a more efficient and accurate direction, and improve the overall disease resistance level of wheat varieties and agricultural production benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a diagram showing the genotyping results of the KASP primer set 4B1 provided in the embodiment of the present invention in the disease-resistant parent Zhou 8425B, the disease-susceptible parent Chinese Spring and the RIL population;

[0040] Figure 2 It is a diagram showing the genotyping results of KASP primer set 4B1 provided in an embodiment of the present invention in 94 varieties derived from the disease-resistant parent Zhou 8425B, the disease-susceptible parent Chinese Spring and Zhou 8425B;

[0041] Figure 3 It is a genetic map of chromosome 4B of Zhou 8425B / Chinese Spring RIL population constructed based on 90K SNP chip and high-throughput KASP markers provided by an embodiment of the present invention. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0043] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged. Maximum severity (MDS): The percentage of the diseased area to the total leaf area.

[0044] The following are specific embodiments and implementation schemes provided by the present invention:

[0045] Example 1: Obtaining the powdery mildew resistance QTL (Quantitative trait loci) tightly linked marker 4B1 and its dedicated primer set.

[0046] Test materials: Zhou 8425B is the most important backbone parent in the southern part of the Huanghuai wheat region, with excellent characteristics such as short stalks, large spikelets and disease resistance. China Spring is a farm variety with tall stalks, small spikelets and low 1000-grain weight. It is a precious wheat germplasm resource in my country and enjoys a high reputation at home and abroad. In this study, Zhou 8425B was used as the female parent and China Spring was used as the male parent. A recombinant inbred line population was constructed using the single-seed transmission method, including 242 families.

[0047] Field resistance identification at the adult stage: Zhou 8425B / China Spring RIL (Recombinant inbred lines) population and parent materials were planted in Beijing and Zhengzhou, Henan in 2015-2016, and in Beijing and Zhengzhou, Henan in 2016-2017, for resistance identification at the adult stage of powdery mildew; the experiment adopted a completely randomized block design, three replications, single-row plot, row length 1.0m, row width 20cm, 50 seeds per row, and one row of diseased control Jingshuang 16 was added every 9 rows; in order to ensure sufficient disease, Jingshuang 16 was planted around the experiment as an induction row. When the control disease reached the maximum severity, the severity of the test material could be investigated.

[0048] Field data analysis: SAS statistical software PROC CORR model was used to calculate the Pearson correlation coefficient, and the PROCMIXED command was used for variance analysis to clarify the validity of the phenotypic data. The correlation coefficient between environments was 0.53-0.73, and the variance analysis showed that the differences between environments, genotypes, and the interaction between genotypes and environments were extremely significant (P<0.01). The broad heritability of the maximum severity of powdery mildew (MDS) was 0.80, indicating the validity of the field phenotypic data of this population.

[0049] Genetic map construction and QTL positioning: JoinMap was used to construct the genetic map, and Mapchart was used to draw the genetic map. The new map included 13 high-throughput KASP markers and 50 90K SNP markers. ICIM (Complete Interval Mapping) of IciMapping V4.0 was used for QTL positioning, and the LOD threshold was set to 2.5.

[0050] The partial genetic map of chromosome 4B of Zhou 8425B / Chinese Spring RIL population constructed based on 90K SNP chip and high-throughput KASP markers is shown in Figure 3The blue part is the QPm.caas-4BL.2 mapping interval, and the flanking markers are the high-throughput KASP markers 4B1 and 4BJ76 developed based on Zhou 8425B resequencing data.

[0051] The newly constructed map was used to locate QPm.caas-4BL.2 to the 1.2 cM interval, and the flanking markers were high-throughput KASP markers 4B1 and 4BJ76 developed based on Zhou 8425B resequencing data. Among them, 4B1 had significant differences in MDS between the families containing Zhou 8425B alleles and the families containing Chinese Spring alleles in the Zhou 8425B / Chinese Spring RIL population and the Zhou 8425B-derived progeny materials. Therefore, the developed high-throughput KASP marker 4B1 can be used for molecular marker-assisted selection breeding of wheat powdery mildew resistance.

[0052] Example 2: Establishment of a method for detecting wheat powdery mildew resistance genes using primer set 4B1

[0053] (1) Extract genomic DNA from Zhou 8425B / Chinese Spring RIL population and dilute the DNA concentration to 50 ng / μl;

[0054] (2) Using the genomic DNA extracted in step 1 as a template, PCR amplification was performed using KASP primer set 4B1 to obtain a PCR amplification product.

[0055] (3) The PCR amplification system of primer set 4B1 is 3 μl, including: 2 μl of 50 ng / μl template (placed in a 45°C constant temperature incubator for 1 hour until it becomes a dry powder), 1.5 μl of HiGeno 2x Probe Mix B, 0.0336 μl of primer mixture, and 1.5 μl of ddH2O. Primer mixture configuration: primer set 4B1 mixture (12 μl each of 100 μM Primer-F1 and Primer-F2, 30 μl of 100 μM Primer-R, and 46 μl of ddH2O);

[0056] (4) The PCR amplification program for primer set 4B1 was: 94°C for 15 min, 10 cycles (94°C for 20 s, 65-57°C for 1 min), and 41 cycles (94°C for 20 s, 57°C for 1 min);

[0057] The fluorescence value was read using a Phestar instrument, with an excitation wavelength of 485 nm for FAM and an emission wavelength of 520 nm; an excitation wavelength of 535 nm for HEX and an emission wavelength of 556 nm; the excitation wavelength of the system reference fluorescence ROX was 575 nm and an emission wavelength of 610 nm; the Kluster Caller software was used for genotyping detection, and the amplification product with a HEX adapter primer produced red fluorescence, and the amplification product with a FAM adapter primer produced blue fluorescence.

[0058] Determine whether the test material contains the disease-resistant allele at the QPm.caas-4BL.2 locus based on the genotyping results of the PCR product amplified in step 2. If the PCR product is blue light, it means that the target SNP genotype is GG, and it contains the disease-susceptible allele at the QPm.caas-4BL.2 locus; if the PCR product is red light, it means that the target SNP genotype is AA, and it contains the disease-resistant allele at the QPm.caas-4BL.2 locus.

[0059] The genotyping results of KASP primer set 4B1 in the resistant parent Zhou 8425B, the susceptible parent China Spring and the RIL population are shown in the figure. Figure 1 The red dots (genotype AA) indicate that the QPm.caas-4BL.2 locus is the disease-resistant parent Zhou 8425B allele type, the blue dots (GG) indicate that the QPm.caas-4BL.2 locus is the disease-susceptible parent Chinese Spring allele type, and the green dots (AG) indicate that the QPm.caas-4BL.2 locus is a heterozygous genotype.

[0060] Example 3: Validation of Primer Set 4B1 in a Secondary Mapping Population Derived from Zhou 8425B / Chinese Spring

[0061] Primer set 4B1 was used to detect 9 secondary mapping populations derived from Zhou 8425B / Chinese Spring, with Zhou 8425B and Chinese Spring as controls. Primer set 4B1 was used to detect Zhou 8425B / Chinese Spring RIL population, and three remaining heterozygous families ZB6041, ZB6082, and ZB6182 were screened out that showed heterozygosity at the QPm.caas-4BL.2 locus. Primer set 4B1 was used to screen out 9 single plants with heterozygous genotypes at the QPm.caas-4BL.2 locus from the remaining heterozygous families ZB6041, ZB6082, and ZB6182, and F2 populations were derived from them. The genotypes and phenotypes of the 9 F2 populations were investigated to verify the powdery mildew resistance effect of QPm.caas-4BL.2 in the secondary mapping population derived from Zhou 8425B / Chinese Spring.

[0062] Field phenotypic identification: Nine secondary mapping populations derived from the Zhou 8425B / China Spring RIL population were planted in Beijing and Xinxiang, Henan in 2023 for resistance identification to powdery mildew in the adult stage. The experiment adopted a completely randomized block design with three replications, a single row area, a row length of 1.5m, a row width of 20cm, 16 seeds were sown in each row, and one row of control was added every 9 rows. The control was the highly susceptible powdery mildew wheat variety Jingshuang 16; in order to ensure sufficient disease occurrence, Jingshuang 16 was planted in the experimental area as an induction row. About 6 weeks after inoculation, Jingshuang 16 reached its peak disease occurrence, and the maximum severity of the disease in the test material was investigated.

[0063] Genotype detection: DNA was extracted from 9 secondary mapping populations, and the genotypes of the test materials were detected using primer set 4B1. Red dots (genotype AA) indicate that the resistant parent Zhou 8425B allele type is at the QPm.caas-4BL.2 locus, blue dots (GG) indicate that the susceptible parent Chinese Spring allele type is at the QPm.caas-4BL.2 locus, and green dots (AG) indicate that the QPm.caas-4BL.2 locus is a heterozygous genotype. The MDS of the 9 secondary mapping population materials were subjected to t-test using the internationally general SAS9.2 statistical software PROC TTEST model, as shown in Table 1. The results showed that the average MDS of the AA homozygous plants in the 9 secondary mapping populations was 1.26-3.44% lower than that of the GG homozygous plants, and there were significant differences at the 0.001 level, indicating that the QPm.caas-4BL.2 locus can effectively reduce the incidence of powdery mildew in the test materials, and the developed high-throughput KASP marker 4B1 can quickly and efficiently screen the disease-resistant alleles of the QPm.caas-4BL.2 locus.

[0064] Table 1 Primer set 4B1 validates the effect of QPm.caas-4BL.2 in 9 secondary mapping populations

[0065]

[0066] Note: AA indicates that the QPm.caas-4BL.2 locus contains disease-resistant alleles, and GG indicates that the QPm.caas-4BL.2 locus contains disease-susceptible alleles; **, *** indicate significant differences at the P 0.01 and 0.001 levels.

[0067] Example 4: Application of primer set 4B1 to assist identification of resistance to powdery mildew in adult plants in breeding

[0068] Primer set 4B1 was used to detect 94 wheat varieties derived from Zhou 8425B, and Zhou 8425B and Chinese Spring were used as controls.

[0069] Field phenotypic identification: 94 wheat varieties derived from Zhou 8425B were planted in Beijing, Zhengzhou, Henan, and Xingyang in 2017 for phenotypic resistance identification of powdery mildew in adult stage. The experiment adopted a completely randomized block design, three replications, single-row plot, row length 1.0m, row width 20cm, 50 seeds per row, 1 row control every 9 rows, and the control was selected from the highly susceptible powdery mildew wheat variety Jingshuang 16; in order to ensure sufficient disease occurrence, Jingshuang 16 was planted in the test area as an induction row. About 6 weeks after inoculation, Jingshuang 16 reached the peak of disease occurrence, and the maximum severity of disease occurrence of the test material was investigated.

[0070] Genotyping:

[0071] DNA was extracted from 94 materials, and the genotypes of the 94 materials were detected using primer set 4B1. The genotyping results of KASP primer set 4B1 in 94 varieties derived from the disease-resistant parent Zhou 8425B, the disease-susceptible parent Chinese Spring, and Zhou 8425B are shown in the figure. Figure 2 As shown. The red dots (genotype AA) indicate the resistant parent Zhou 8425B allele type at the QPm.caas-4BL.2 locus, the blue dots (GG) indicate the susceptible parent Chinese Spring allele type at the QPm.caas-4BL.2 locus, and the green dots (AG) indicate the heterozygous genotype at the QPm.caas-4BL.2 locus. The genotypes and MDS averages of the 94 wheat varieties are shown in Table 2. The MDS of the 94 materials was tested using the internationally used SAS9.2 statistical software PROC TTEST model, as shown in Table 3. The results showed that the average MDS of the AA homozygous varieties was 4.3% lower than that of the GG homozygous varieties, which was significantly different at the 0.05 level.

[0072] Table 2 Genotypes and average MDS of 94 wheat varieties detected by primer set 4B1

[0073]

[0074]

[0075]

[0076] Note: AA indicates that the QPm.caas-4BL.2 locus contains disease-resistant alleles, and GG indicates that the QPm.caas-4BL.2 locus contains disease-susceptible alleles.

[0077] Table 3 T-test of the maximum severity of powdery mildew in 94 wheat varieties

[0078]

[0079] Note: AA indicates that the QPm.caas-4BL.2 locus contains disease-resistant alleles, and GG indicates that the QPm.caas-4BL.2 locus contains disease-susceptible alleles; * indicates significant difference at the P 0.05 level.

[0080] Example 5: High-throughput screening of wheat germplasm for resistance to powdery mildew

[0081] In the process of wheat germplasm screening, the KASP marker primer set of the present invention can be used to quickly and accurately detect the presence of the powdery mildew resistance QTL QPm.caas-4BL.2. The specific steps are as follows:

[0082] (1) Extract DNA samples from the wheat to be tested.

[0083] (2) Amplify the DNA sample in a PCR reaction using the KASP labeled primer set 4B1 of the present invention.

[0084] (3) Using fluorescence detection equipment, the presence of the powdery mildew resistance gene QPm.caas-4BL.2 was determined based on the fluorescence signal generated by the KASP labeled primer set in the PCR reaction.

[0085] Example 6: Breeding new wheat varieties resistant to stripe rust. In the wheat breeding process, the KASP marker primer set of the present invention can be used to track the inheritance of the powdery mildew resistance gene QPm.caas-4BL.2. The specific steps are as follows:

[0086] (1) Extract DNA samples from parent wheat.

[0087] (2) Using the KASP marker primer set of the present invention, the presence of the powdery mildew resistance gene QPm.caas-4BL.2 in the parent wheat was detected.

[0088] (3) Select genetic parents containing the powdery mildew resistance gene QPm.caas-4BL.2 for hybridization to obtain hybrid seeds.

[0089] (4) DNA samples were extracted from seedlings of the self-pollinated offspring of the hybrid seeds, and the KASP marker primer set of the present invention was used to detect the presence of the powdery mildew resistance gene QPm.caas-4BL.2 in the offspring materials.

[0090] (5) Select offspring materials containing the powdery mildew resistance gene QPm.caas-4BL.2, continue self-pollination and study agronomic traits, and finally obtain new wheat varieties resistant to powdery mildew.

[0091] The above Examples 3, 4, 5 and 6 all used the KASP marker primer set 4B1 of the present invention, achieving high-throughput, low-cost detection of the powdery mildew resistance QTL QPm.caas-4BL.2, thereby improving the efficiency and accuracy of wheat germplasm screening and breeding.

[0092] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modification, equivalent substitution and improvement made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered within the protection scope of the present invention.

Claims

1. A powdery mildew resistance gene KASP marker based on the genetic background of wheat backbone parent Zhou 8425B, characterized in that: The KASP-labeled primer set 4B1 consists of two upstream primers Primer-F1 and Primer-F2, and one downstream primer Primer-R; the nucleotide sequence of Primer-F1 is shown in SEQ ID NO.1, the nucleotide sequence of Primer-F2 is shown in SEQ ID NO.2, and the nucleotide sequence of Primer-R is shown in SEQ ID NO.

3.

2. A kit for detecting or assisting in detecting the powdery mildew resistance QTL QPm.caas-4BL.2, characterized in that: Comprising the KASP labeling primer set 4B1 described in claim 1.

3. The kit for detecting or assisting in detecting the powdery mildew resistance QTL QPm.caas-4BL.2 according to claim 2, characterized in that: The kit also contains fluorescent group A, fluorescent group B, fluorescent quenching group A and fluorescent quenching group B; the fluorescent group A is FAM, the fluorescent group B is HEX, and the fluorescent quenching group is BHQ; the fluorescent group A, fluorescent group B, fluorescent quenching group A, and fluorescent quenching group B are present in HiGeno 2xProbe Mix B.

4. Use of the KASP labeling primer set according to claim 1 or the kit according to any one of claims 2 to 3 in any of the following: (1) Identifying or assisting in identifying the powdery mildew resistance of wheat to be tested; (2) preparing a product for identifying or assisting in identifying the powdery mildew resistance trait of wheat to be tested; (3) Detecting or assisting in detecting the allele of the wheat powdery mildew resistance QTL QPm.caas-4BL.2; (4) Preparing a product for detecting or assisting in detecting the allele of the wheat powdery mildew resistance QTL QPm.caas-4BL.

2.

5. Use of the KASP labeling primer set according to claim 1 or the kit according to any one of claims 2 to 3 in any of the following: (1) Breeding or assisting in breeding wheat resistant to powdery mildew; (2) Preparing products for breeding or assisting in breeding of wheat resistant to powdery mildew.

6. A method for identifying or assisting in identifying the powdery mildew resistance of wheat to be tested, characterized in that: The method comprises: Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using the KASP marker primer set 4B1 described in claim 1 or the kit described in any one of claims 2 to 3 to obtain an amplified product, Phestar is used to collect fluorescent signals, and Kluster caller software is used for genotyping. The powdery mildew resistance of the wheat to be tested is determined according to the typing results of the PCR products: If the amplification product of the wheat to be tested is blue light, it means that the target genotype of the wheat to be tested is GG, and it has or is a candidate for powdery mildew susceptibility; if the amplification product of the wheat to be tested is red light, it means that the target genotype of the wheat to be tested is AA, and it has or is a candidate for powdery mildew resistance; if the amplification product of the wheat to be tested is green light, it means that the target genotype of the wheat to be tested is heterozygous AG.

7. A method for detecting or assisting in detecting the allele of the powdery mildew resistance QTL QPm.caas-4BL.2 to be tested, characterized in that: The method comprises: Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using the KASP marker primer set 4B1 described in claim 1 or the kit described in any one of claims 2 to 3 to obtain an amplified product, Phestar is used to collect fluorescent signals, and Kluster caller software is used for genotyping; the allele of the powdery mildew resistance QTL QPm.caas-4BL.2 of the wheat to be tested is determined according to the PCR product typing result: If the amplified product of the wheat to be tested is blue light, it means that the target genotype of the wheat to be tested is GG, and it has or is a candidate to have the QPm.caas-4BL.2 disease-susceptible allele; if the amplified product of the wheat to be tested is red light, it means that the target genotype of the wheat to be tested is AA, and it has or is a candidate to have the QPm.caas-4BL.2 disease-resistant allele; if the amplified product of the wheat to be tested is green light, it means that the target genotype of the wheat to be tested is heterozygous AG, and it is in a heterozygous state at the QPm.caas-4BL.2 site.

8. A method for breeding wheat resistant to powdery mildew, characterized in that: The method is (1) and / or (2): (1) Breeding wheat with resistance to powdery mildew according to the method of claim 6; (2) According to the method of claim 7, wheat containing the disease resistance allele of QTL QPm.caas-4BL.2 for resistance to powdery mildew is bred.

9. The use according to claim 4 or 5, or the method according to any one of claims 6 to 8, characterized in that: The wheat to be tested is wheat containing the powdery mildew resistance gene QPm.caas-4BL.2 or its hybrid progeny.

Images