Primer for rapidly identifying cotton seeds of brown cotton in diploid and tetraploid cotton and application of primer

Abstract

The invention discloses a primer for rapidly identifying cotton seeds of brown cotton in diploid and tetraploid cotton and application of the primer, and belongs to the field of molecular biology. According to the primer for rapidly identifying the cotton seeds of the yellow brown cotton in the diploid and tetraploid cotton, a specific 310bp nucleotide sequence can be amplified in PCR (Polymerase Chain Reaction) taking genome DNA (Deoxyribonucleic Acid) of the cotton seeds of the yellow brown cotton as a template, no product exists in PCR taking genome DNA of other diploid or tetraploid cotton seeds as a template, and the specificity is good, so that the cotton seeds of the yellow brown cotton can be rapidly identified; the problem that the cotton seed DNA of the yellow brown cotton is accidentally confused with other cotton seed DNA in experimental work is solved, and the method has important practical value.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, in particular to primers for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton and applications thereof. Background Art

[0002] Polymerase Chain Reaction (PCR) is a molecular biology technique that relies on specific primers to recognize complementary sites, relies on DNA polymerase catalysis, and amplifies specific DNA fragments based on the principle of DNA replication. It is a special DNA replication process that can be controlled by people outside the body. The purpose of PCR is to replicate a small amount of DNA thousands of times. The basic principle of PCR technology is similar to the natural replication process of DNA, and its specificity depends on oligonucleotide primers that are complementary to both ends of the target sequence.

[0003] PCR consists of three basic reaction steps: denaturation, annealing, and extension: ① Denaturation of template DNA: After the template DNA is heated to about 95°C for a certain period of time, the double-stranded template DNA or the double-stranded DNA formed by PCR amplification is dissociated to become a single strand so that it can bind to the primer and prepare for the next round of reaction; ② Annealing (renaturation) of template DNA and primer: After the template DNA is heated and denatured into a single strand, the temperature is reduced to about 55°C, and the primer and the complementary sequence of the template DNA single strand are paired and bound; ③ Extension of primer: DNA template-primer complex is at 72°C and under the action of DNA polymerase (such as TaqDNA polymerase), with dNTP as the reaction raw material and the target sequence as the template, a new semi-conservative replication chain complementary to the template DNA chain is synthesized according to the principle of base complementary pairing and semi-conservative replication. Repeating the three processes of denaturation, annealing, and extension can obtain more "semi-conservative replication chains", and this new chain can become the template for the next cycle. It takes 2 to 4 minutes to complete one cycle, and the target gene can be amplified millions of times in 2 to 3 hours.

[0004] Cotton is an important economic crop in the world. There are 52 cotton species in the genus Gossypium, including 5 tetraploid cotton species and 47 diploid cotton species. Yellow-brown cotton is one of the allotetraploid cottons and the earliest evolutionary differentiation lineage among tetraploid cotton species. However, yellow-brown cotton has a very strong ability to adapt to the environment and has many stress resistance genes. Yellow-brown cotton is the most salt-tolerant cotton species among all cotton species, and tetraploid cotton yellow-brown cotton is a common research object for scientific researchers. However, in actual experiments, we often encounter situations where the tissues or DNA of two or even more genomic cotton species are confused or there are other reasons for rapid identification. However, there is currently no method for rapid identification of yellow-brown cotton species. Summary of the invention

[0005] The purpose of the present invention is to provide a primer for quickly identifying yellow-brown cotton species in diploid and tetraploid cotton and its application.

[0006] In order to achieve the above object, the technical solution of the present invention is: In a first aspect, the present invention provides a primer for rapid identification of yellow-brown cotton species in diploid and tetraploid cotton.

[0007] In a second aspect, the present invention also provides the use of the above primers for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton in the preparation of yellow-brown cotton species identification products.

[0008] In a third aspect, the present invention also provides a kit for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton, comprising the above-mentioned primers for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton.

[0009] Compared with the prior art, the technical effects of the present invention are: The primers provided by the present invention for quickly identifying yellow-brown cotton species in diploid and tetraploid cotton can amplify a specific 310 bp nucleotide sequence in a PCR using genomic DNA of the yellow-brown cotton species as a template, but have no product in a PCR using genomic DNA of other diploid or tetraploid cotton species as a template, and have good specificity, so that yellow-brown cotton species can be quickly identified, and the problem of accidentally confusing yellow-brown cotton species DNA with other cotton species DNA in experimental work is solved, and the primers have important practical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.

[0011] Figure 1 The results are shown in the examples of the present invention, using β-Actin as the internal reference primer to perform PCR on the DNA of various cotton species.

[0012] Figure 2 The test results of PCR on the DNA of various cotton species using the specific primer "515-32" in the embodiment of the present invention are shown. DETAILED DESCRIPTION

[0013] In order to make those skilled in the art better understand the technical solution of the present invention, the present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods in the following embodiments are conventional methods unless otherwise specified. The test materials used in the following embodiments are purchased from conventional biochemical reagent companies unless otherwise specified.

[0014] Example 1

[0015] The primers for rapid identification of yellow-brown cotton species in diploid and tetraploid cotton (specific primers 515-32 for short) of the present invention were used to perform PCR verification using DNA of 34 cotton species as templates.

[0016] 1 Materials and Methods 1.1 Experimental Materials The experimental material was the nuclear genomic DNA of each cotton species shown in Table 1, with a concentration of 40 ng / μL; the primer was the specific primer 515-32: forward primer F: CCTCGTTCTGGTTTTTAGGAGTACTC (as shown in SEQ ID No.1); reverse primer R1: ACTCGGATCTTGACCCAGGGAATTA (as shown in SEQ ID No.2).

[0017] The specific primer 515-32 was synthesized by Jilin Kumei Company and purified by PAGE. Taq Mix is ​​Vazyme's 2× Taq Master Mix for PAGE. DNA loading buffer was produced by Vazyme.

[0018] 50 μL PCR tube; PCR instrument from Techne; agarose gel was made of TAE containing 1% agarose, and the electrophoresis solution was TAE; the electrophoresis instrument was produced by Junyi Company; and the gel imager was produced by Junyi Company.

[0019] 1.2 Experimental methods 1) DNA, specific primer 515-32, Taq Add the Mix according to the above system proportions into a 50 μL sterilized PCR tube; 2) Centrifuge the PCR tube, shake it, and after centrifugation, put it into the PCR instrument and run the above PCR process: The PCR reaction system is as follows:

[0020] The PCR reaction process is as follows: ① Preheat denaturation at 94°C for 10 min. ② Denaturation at 94°C for 45 seconds, ③ Annealing at 58 °C for 45 sec, ④Extension at 72℃ for 1 min; ⑤Go to step 2), 30 cycles; ⑥Extension at 72 °C for 10 min; ⑦Save at 4℃.

[0021] 30 cycles, 95 minutes.

[0022] 3) Take out the product, mix it with DNA loading buffer according to the proportion, and apply the gel; 4) Voltage: 110 V, current: 200 mA, electrophoresis time: 30 min; 5) Take the glue and read the tape.

[0023] 2 Experimental results The gel reading results showed that the specific primer 515-32 could produce the target band (310 bp) in yellow-brown cotton, and no product was detected in the other 33 cotton species (such as Figure 1 shown). Figure 1 The names of cotton species corresponding to each genome are shown in Table 1.

[0024]

[0025] Comparison Example The following uses the universal primer β-Actin (actin, an important skeletal protein of cells) as the internal reference primer of PCR to detect the availability of DNA of various cotton species. Except for the different primers, other experimental materials and methods are the same as those in Example 1.

[0026] The gel reading results showed that β-Actin could amplify a band of about 600 bp in length in 34 cotton species DNA (such as Figure 2 The test proved that the DNA of 34 cotton species were all usable and there was no problem with the PCR system. Figure 2 The names of cotton species corresponding to each genome are shown in Table 1.

[0027] In summary, the specific primer 515-32 of the present invention can amplify a specific nucleotide sequence of 310 bp in PCR using yellow-brown cotton species as a template, but has no product in PCR using other diploid or tetraploid cotton species as templates, and has good specificity. Therefore, it can quickly identify yellow-brown cotton species, solve the problem of accidentally confusing yellow-brown cotton DNA with other cotton species DNA in experimental work, and has important practical value.

[0028] The above description of the disclosed embodiments is intended to enable those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the above drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.

Claims

1. A primer for rapid identification of yellow-brown cotton species in diploid and tetraploid cotton, characterized in that: The forward primer nucleotide sequence of the primer is shown as SEQ ID No.1, and the reverse primer nucleotide sequence of the primer is shown as SEQ ID No.

2.

2. Use of the primers for rapid identification of yellow-brown cotton species in diploid and tetraploid cotton according to claim 1 in the preparation of yellow-brown cotton species identification products.

3. A kit for rapid identification of yellow-brown cotton species in diploid and tetraploid cotton, characterized in that: The invention comprises the primers for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton as described in claim 1.

Images