Affinity binding entities against CD70 and methods of use thereof

Abstract

Aspects of the present disclosure include compositions and methods for treating CD70-expressing tumors using engineered [gamma] [delta] T-cells. In embodiments, the [gamma] [delta] T-cell comprises a chimeric antigen receptor (CAR) construct. The CAR constructs may comprise a full-length CD27 receptor domain, a co-stimulatory domain, an intracellular signaling domain, a combination thereof, or all thereof. The CAR constructs may comprise a domain encoding an additional polypeptide that confers advantageous function to the [gamma] [delta] T cell.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Application Serial No. 63 / 393,787, filed on July 29, 2022, the disclosure of which is expressly incorporated herein by reference in its entirety. Technical Field

[0003] The present disclosure generally relates to chimeric antigen receptors (CARs) comprising antigen binding molecules that bind CD70, polynucleotides encoding the same, host cells comprising the polynucleotides and / or CARs, and methods of using the same to treat disorders associated with CD70 expression in patients. Background Art

[0004] In the past few years, T cell-engaging therapy using chimeric antigen receptor (CAR) T cells has opened up a new field of cancer immunotherapy (June et al., Science 2018; 359:1361–1365). An attractive target is human cluster of differentiation 70 (CD70). CD70 is a transmembrane glycoprotein and a member of the tumor necrosis factor (TNF) superfamily and the only known ligand for CD27. CD70 is constitutively expressed in a variety of cancers, including renal cell carcinoma, leukemia, non-small cell lung cancer, melanoma, glioblastoma, etc.

[0005] The first generation of CD70-targeted CARs used full-length CD27 proteins to target B cell malignancies (Shafer et al., Blood 2011; 117: 4304-4314). Subsequently, truncated CD27 proteins were used to demonstrate improved efficacy (Wang et al., Clin. Cancer Res. 2017; 23: 2267-2276). This CAR has entered a Phase I clinical trial for solid tumors (NCT02830724) and has been shown to be effective for head and neck cancer and gliomas expressing CD70. So far, CD70-targeted CARs have been examined in the context of alpha beta (αβ) T cells derived from peripheral blood T cells. Unfortunately, however, since αβ T cells generally have a high allogeneic reaction potential and are particularly susceptible to cytokine release syndrome (CRS), their effective use is very complicated.

[0006] Gamma delta (γδ) T cells are thymus-derived lymphocytes that differ from αβ T cells in their activation and functional mechanisms and anatomical distribution. Specifically, while αβ T cells play a role exclusively in adaptive immunity, γδ T cells are innate-like immune cells that recognize malignant cells in an MHC-independent manner through a series of activating receptors, similar to natural killer cells (NK cells) (Welsh et al., Immunol Rev. 1997; 159: 79-93). Therefore, and in contrast to αβ T cells, γδ T cells can potentially be used in an allogeneic setting without the risk of causing graft-versus-host disease (GvHD). In addition, recent studies have shown that engineered γδ-T cells can produce fewer proinflammatory cytokines than αβ-T cells, thereby reducing the risk of CRS in patients (Harrer et al., BMC Cancer 2017; 17(1):551).

[0007] Despite the rapid and robust development of CAR-T therapy, the optimal parameters of CAR-T cell-target interactions that will lead to efficacy in vivo and in humans are unclear. Given the differences in the mechanism of action and function of αβ T cells compared to γδ T cells, CAR function and efficacy demonstrated in the context of αβ T cells is not predictive of CAR function and efficacy in the context of γδ T cells. Therefore, the actual conversion of γδ T cells by CD70-targeted CAR T therapy is uncertain at best. Summary of the invention

[0008] The present disclosure provides CD70-targeted CAR T γδ T cells. In one aspect, a γδ T cell is provided, comprising a chimeric antigen receptor (CAR), wherein the CAR comprises a binding domain that recognizes the CD70 antigen, at least one co-stimulatory domain, and at least one intracellular signaling domain, and wherein the γδ T cell functionally expresses the binding domain of the CAR on the surface of the γδ T cell.

[0009] In an embodiment, the binding domain comprises a full-length CD27 receptor having an amino acid sequence as shown in SEQ ID NO: 33. In an embodiment, the binding domain comprises a full-length CD27 receptor having an amino acid sequence as shown in SEQ ID NO: 91.

[0010] In an embodiment, the binding domain comprises a truncated CD27 receptor having an amino acid sequence as shown in SEQ ID NO: 43. In an embodiment, the binding domain comprises a truncated CD27 receptor having an amino acid sequence as shown in SEQ ID NO: 92.

[0011] In embodiments, at least one co-stimulatory domain is selected from: TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, CD3C, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD70, CD80, CD83, CD86, CD134 (OX40), CD137 (4-1BB), CD278 (ICOS), FcR, LAT, NKD2C, SLP76, TRIM and ZAP70 or a combination thereof. In embodiments, at least one co-stimulatory domain is 4-1BB.

[0012] In embodiments, at least one intracellular signaling domain is selected from CD3 zeta, DAP12, LFA-1, and a repeat (2-5) DAP10 YINM motif. In embodiments, at least one intracellular signaling domain is CD3 zeta.

[0013] In some embodiments, the CAR comprises a binding domain that recognizes the CD70 antigen, followed by a 4-1BB co-stimulatory domain, followed by a CD3ζ signaling domain.

[0014] In an embodiment, the CAR is encoded by an isolated nucleic acid operably linked to a regulatable promoter.

[0015] In embodiments, the isolated nucleic acid encoding CAD encodes one or more additional polypeptides. In embodiments, the one or more additional polypeptides are selected from the group consisting of lymphotoxin beta receptor (LTBR), dominant negative (dn) receptors for TGF-β or Fas, a truncated form of human epidermal growth factor receptor (EGFRt), and membrane-bound IL-12 (mbIL-12).

[0016] In embodiments, the one or more additional polypeptides are lymphotoxin beta receptor (LTBR). In embodiments, the LTBR encoded by the isolated nucleic acid has an amino acid sequence as shown in SEQ ID NO: 27. In embodiments, the one or more additional polypeptides are dominant negative (dn) receptors for TGF-β. In embodiments, the dominant negative receptor for TGF-β is dnTGFβR2. In embodiments, the dnTGFβR2 encoded by the isolated nucleic acid has an amino acid sequence as shown in SEQ ID NO: 23. In embodiments, the one or more additional polypeptides are truncated forms of human epidermal growth factor receptor (EGFRt). In embodiments, the EGFRt encoded by the isolated nucleic acid has an amino acid sequence as shown in SEQ ID NO: 19. In embodiments, the one or more additional polypeptides are dominant negative Fas (dnFas). In embodiments, the one or more additional polypeptides are membrane-bound IL-12 (mbIL-12).

[0017] In an embodiment, the isolated nucleic acid encodes at least one cleavage polypeptide sequence. In an embodiment, the at least one cleavage polypeptide sequence is a 2A self-cleavage polypeptide sequence selected from T2A, P2A, E2A and F2A self-cleavage polypeptide sequences. In an embodiment, the 2A self-cleavage polypeptide sequence is a P2A self-cleavage polypeptide sequence. In an embodiment, the P2A self-cleavage polypeptide sequence encoded by the isolated nucleic acid has an amino acid sequence as shown in SEQ ID NO: 8, 77 or 78.

[0018] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, or 71. In embodiments, the isolated nucleic acid encodes SEQ ID NO: 57.

[0019] In embodiments, the γδ T cells comprise at least one disrupted endogenous gene. In embodiments, at least one disrupted endogenous gene is cytokine-induced SH2-containing protein (CISH). In embodiments, at least one disrupted endogenous gene is Cbl proto-oncogene B (CBL-B). In embodiments, at least one disrupted endogenous gene is zinc finger protein 91 (ZFP91). In embodiments, at least one disrupted endogenous gene is Roquin. In embodiments, at least one disrupted endogenous gene is CD58 and / or ICAM-1.

[0020] In embodiments, the γδ T cells exhibit in vitro and / or in vivo tumor cell killing activity against blood and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen.

[0021] In embodiments, the tumor cell killing activity of the γδ T cells is greater than the innate level of tumor cell killing activity in vitro and / or in vivo of a control γδ T cell that does not comprise a CAR.

[0022] In embodiments, the tumor cell killing activity persists, persists about, persists at least, or persists at least about 6 days to 180 days after first contact with blood and / or solid tumor cells exhibiting cell surface expression of the CD70 antigen.

[0023] In embodiments, the γδ T cells proliferate in response to contact with blood and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen.

[0024] In embodiments, the γδ T cells exhibit increased proliferation in response to contact with blood and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen, compared to a control γδ T cell that does not functionally express the binding domain of the CAR on the surface of the γδ T cell.

[0025] In embodiments, γδ T cells are proliferated in a host organism comprising blood and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen.

[0026] In embodiments, the γδ T cell proliferation or increased γδ T cell proliferation persists, persists about, persists at least, or persists at least about 6 days to 180 days after first contact with blood and / or solid tumor cells exhibiting cell surface expression of the CD70 antigen.

[0027] In embodiments, the γδ T cells express proinflammatory cytokines comprising tumor necrosis factor α or interferon γ upon contact with blood and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen.

[0028] In embodiments, the γδ T cells exhibit a reduced, substantially reduced, substantially no, or no graft-versus-host response when introduced into an allogeneic host, compared to the graft-versus-host response exhibited by the αβ T cells administered to an allogeneic host.

[0029] In an embodiment, the γδ T cell is a δ1, δ2, δ3, or δ4 γδ T cell, preferably a δ2-γδ T cell, more preferably a δ1 γδ T cell.

[0030] In one aspect of the invention, a plurality of γδ T cells according to the embodiments described herein are provided.

[0031] In an embodiment, the plurality comprises at least about 10 7 γδ T cells, preferably about 10 8from γδ T cells to about 10 11 γδ T cells.

[0032] In embodiments, the plurality is at least 60%, 80%, or about 60% to about 90% or 95% δ1, δ2, δ3, or δ4 γδ T cells, preferably δ1 or δ2 γδ T cells, more preferably δ2 - A composition of γδ T cells, most preferably δ1 γδ T cells.

[0033] In one aspect, a method of making a γδ T cell according to an embodiment of the present invention or making a plurality of γδ T cells according to an embodiment of the present invention is provided, wherein the method comprises transfecting the γδ T cell with a construct comprising an isolated nucleic acid according to an embodiment of the present invention. In embodiments, the method comprises retroviral transduction. In embodiments, the method comprises ex vivo expansion of the γδ T cell, wherein the ex vivo expansion is performed before and / or after transfection of the isolated nucleic acid.

[0034] In one aspect, a pharmaceutical composition is provided, comprising a pharmaceutically acceptable excipient and a γδ T cell according to an embodiment herein.

[0035] In one aspect, a method for killing blood and / or solid tumor cells that express cell surface expression of the CD70 antigen is provided, the method comprising contacting the blood and / or solid tumor cells with a tumor cell killing effective amount of a γδ T cell according to the embodiments herein, a plurality of γδ T cells according to the embodiments herein, or a pharmaceutical composition according to the embodiments herein.

[0036] In embodiments, the method comprises introducing a therapeutically effective amount of γδ T cells or a pharmaceutical composition into a host organism comprising blood and / or solid tumor cells.

[0037] In embodiments, the method comprises introducing a therapeutically effective amount of γδ T cells or a pharmaceutical composition into a host organism comprising blood and / or solid tumor cells, and simultaneously or sequentially administering one or more methods of elevating a common γ chain cytokine.

[0038] In an embodiment, the method of administering one or more methods of elevating common γ chain cytokines comprises administering an amount of common γ chain cytokines effective to increase proliferation, cytotoxic activity, persistence, or a combination thereof of the introduced γδ T cells simultaneously or sequentially with the introduction of γδ T cells, preferably wherein the method comprises administering IL-2, more preferably wherein the method comprises administering IL-15.

[0039] In embodiments, one or more methods of increasing common γ chain cytokines comprise administering an amount of common γ chain cytokines effective to increase proliferation, cytotoxic activity, persistence, or a combination thereof of the introduced γδ T cells before and / or after the introduction of γδ T cells.

[0040] In embodiments, one or more methods of elevating common gamma chain cytokines include lymphodepletion prior to introduction of gamma delta T cells.

[0041] In embodiments, one or more methods of elevating common γ chain cytokines comprise secretion of one or more common γ chain cytokines from introduced γδ T cells.

[0042] In embodiments, the methods reduce the in vivo tumor burden in a host organism, and / or increase the average survival time of a host organism, compared to a control organism, wherein the control organism has not been treated with γδ T cells or the pharmaceutical composition.

[0043] In embodiments, the method is a method of treating cancer in a subject in need thereof.

[0044] In one aspect, a method of treating cancer in a subject in need thereof is provided, the method comprising administering a therapeutically effective amount of γδ T cells, wherein the cancer comprises hematological tumor cells that exhibit cell surface expression of CD70.

[0045] In one aspect, a method of treating cancer in a subject in need thereof is provided, the method comprising administering a therapeutically effective amount of γδ T cells, wherein the cancer comprises solid tumor cells that exhibit cell surface expression of CD70.

[0046] In one aspect, a method of treating cancer in a subject in need thereof is provided, the method comprising administering a therapeutically effective amount of γδ T cells, wherein the cancer comprises blood and / or solid tumor cells that exhibit cell surface expression of CD70.

[0047] In some embodiments of any of the methods of treating cancer described herein, the method can include performing multiple administrations of γδ T cells, wherein the interval between multiple administrations is at least about one week, preferably at least about 2, 3, 4, 5, 6, 7, 8, or 12 weeks, and / or wherein the number of administrations does not exceed once every 6 or 12 months.

[0048] In one aspect, a method of reducing or inhibiting a graft-versus-host reaction of an immune cell administered to a subject in need thereof is provided, comprising administering a therapeutically effective amount of a γδ T cell according to the present invention. In an embodiment, the γδ T cell may include a dual CAR that binds to CD70 and another tumor-associated antigen, or the method may further include simultaneously or sequentially administering a γδ T cell according to the present invention and an immune cell (e.g., T cell or NK cell) comprising a CAR that binds to another tumor-associated antigen.

[0049] Incorporated by Reference

[0050] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each independent publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 is a graph illustrating CD70 expression in various cancer cell lines.

[0052] Figures 2A-2C Depicted is a graph illustrating the in vitro cytotoxicity of Vδ1 CD27 receptor CAR T cells against various cancer cell lines.

[0053] Figure 3 is a graph illustrating that the in vitro cytotoxicity of Vδ1 CD27 receptor CAR T cells against A498 cells is not affected by the presence of soluble CD27.

[0054] Figure 4 Depicted is a graph illustrating the in vivo therapeutic efficacy of Vδ1 CD27 receptor CAR T cells in a subcutaneous human xenograft A498 cell NOD scidγ (NSG) mouse model.

[0055] Figure 5 Depicted is a graph illustrating the in vivo therapeutic efficacy of Vδ1 CD27 receptor CAR T cells in a subcutaneous human xenograft ACHN cell NSG mouse model.

[0056] Figure 6 Depicted is a series of graphs illustrating the transduction efficiency of Vδ1 T cells by P2A staining as a method for CAR detection.

[0057] Figure 7 is a graph illustrating the gene knockdown efficiency of two different guide RNAs targeting cytokine-induced SH2-containing protein (CISH) in Vδ1 T cells.

[0058] Fig. 8Ais a graph illustrating the enrichment of Vδ1 T cells after knockdown of the CISH gene from two different guide RNAs.

[0059] Figure 8B is a graph illustrating the cell viability of Vδ1 T cells after knocking out the CISH gene from two different guide RNAs.

[0060] Fig. 9 The transduction efficiency of ADI-270 by P2A staining as a method for CAR detection is demonstrated.

[0061] Fig.10 The expression of CD70 in different cancer cell lines is illustrated.

[0062] Fig.11 The in vitro cytotoxicity of ADI-270 against various cancer cell lines is demonstrated.

[0063] Fig.12 The in vitro cytotoxicity of ADI-270 in the presence of TGFβ1 is demonstrated.

[0064] Fig.13 In vitro proliferation of ADI-270 in the presence of TGFβ1 is demonstrated.

[0065] Fig.14 Demonstrating intracellular SMAD2 / 3 phosphorylation by ADI-270 in the presence of TGFβ1

[0066] Fig.15 ADI-270 is shown to protect against TGF-β1-mediated transcriptional changes.

[0067] Figures 16A-16B The ADI-270 cytokine profile of pro-inflammatory and chemo-attractive cytokines is illustrated.

[0068] Figures 17A-17B The in vivo therapeutic efficacy of ADI-270 in a subcutaneous human xenograft A498 cell NSG mouse model was demonstrated.

[0069] Figures 18A-18B The in vivo therapeutic efficacy of ADI-270 in a subcutaneous human xenograft A498 cell NSG mouse model was demonstrated.

[0070] Figures 19A-19B The in vivo therapeutic efficacy of ADI-270 in a subcutaneous human xenograft HuT78 cell NSG mouse model is demonstrated.

[0071] Figures 20A-20C Ex vivo tissue analysis demonstrated that ADI-270 homed to tumors, proliferated, and expressed activation markers.

[0072] Fig.21 Improved persistence of ADI-270 supported by host-versus-graft (HvG) defense was demonstrated.

[0073] Fig. 22 CAR-mbIL-12 construct design is illustrated.

[0074] Figures 23A-23D The expansion and expression of CAR-mbIL-12 in Vδ1 T cells are illustrated.

[0075] Fig.24 The enhanced in vitro cytotoxicity of CAR-mbIL-12 in Vδ1 T cells was demonstrated.

[0076] Fig.25 The in vivo therapeutic efficacy of CAR-mbIL-12 in Vδ1 T cells in a subcutaneous human xenograft Raji cell NSG mouse model is demonstrated.

[0077] Figures 26A-26B It was shown that CISH KO enhanced the in vitro cytotoxicity of Vδ1 T cells.

[0078] Figures 27A-27B It was shown that CBL-B KO enhanced the in vitro cytotoxicity of Vδ1 T cells.

[0079] Figures 28A-28B It was shown that Roquin KO enhanced the in vitro cytotoxicity of Vδ1 T cells.

[0080] Figures 29A-29B It was demonstrated that CD58 or ICAM-1 KO enhanced the in vitro cell survival of Vδ1 T cells in an allogeneic MLR assay. DETAILED DESCRIPTION

[0081] I. Definitions

[0082] For the purpose of interpreting this specification, the following definitions will apply, and whenever appropriate, terms used in the singular will also include the plural form and vice versa. If any definition set forth conflicts with any document incorporated herein by reference, the definition set forth below shall prevail. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0083] As used herein, when referring to a measurable value such as an amount, duration, etc., "about" is intended to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% of the stated value, as such variations are suitable for performing the disclosed methods.

[0084] As used herein, "w / v" refers to the weight of a component in a given volume of a solution.

[0085] "Range": Throughout this disclosure, various aspects of the disclosure may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity, and should not be interpreted as an immutable limitation on the scope of the disclosure. Therefore, the description of a range should be considered to have explicitly disclosed all possible subranges and individual numerical values ​​within the range. For example, a range description such as 1 to 6 should be considered to have explicitly disclosed subranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within the range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0086] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0087] As used herein, the term "diagnosis" or "diagnosing" refers to the process of identifying a disease (such as cancer) through its signs, symptoms, and / or the results of various tests. The conclusion drawn through this process is the diagnosis. Common forms of testing performed include blood tests, medical imaging, urine analysis, biopsy, etc.

[0088] As used herein, the term "agent" refers to any protein, nucleic acid molecule (including chemically modified nucleic acids), chemical compound, antibody, small molecule, organic compound, inorganic compound, other molecule of interest, or cell (e.g., a cell engineered to express a chimeric antigen receptor). An agent may include a therapeutic agent, a diagnostic agent, or a pharmaceutical agent. A therapeutic agent or pharmaceutical agent is a therapeutic agent or pharmaceutical agent that, when administered to a subject (including treating a subject suffering from cancer or other disease / disorder), alone or with an additional agent, induces a desired response (such as inducing a therapeutic or preventive effect).

[0089] The term "therapeutically effective amount" (or simply "effective amount") refers to the amount of an agent or composition (e.g., a composition comprising an agent) that will elicit a biological or medical response in a tissue, system, or subject that is being sought by a researcher, veterinarian, medical doctor, or other clinician. The term "therapeutically effective amount" includes an amount of an agent or composition comprising an agent that, when administered, is sufficient to prevent the development of or alleviate to some extent one or more signs or symptoms of the condition or disease (e.g., tumor cells expressing CD70) being treated. The therapeutically effective amount will vary depending on the composition, the disease and its severity, and the age, weight, etc., of the subject to be treated.

[0090] As used herein, the term "γδ T cells (gamma T cells)" refers to a subset of T cells that express a different T cell receptor (TCR), namely a γδTCR, on its surface, which is composed of a γ chain and a δ chain. The term "γδ T cells" specifically includes all subsets of γδ T cells, including but not limited to Vδ1 and Vδ2, Vδ3 γδ T cells, as well as initial, effector memory, central memory and terminally differentiated γδ T cells. As another example, the term "γδ T cells" includes Vδ4, Vδ5, Vδ7 and Vδ8 γδ T cells, as well as Vγ2, Vγ3, Vγ5, Vγ8, Vγ9, Vγ10 and Vγ11 γδ T cells. In some embodiments, the γδ T cell is Vδ1 - 、Vδ2 - or Vδ1 - and Vδ2 - . Compositions and methods for making and using engineered and non-engineered γδ T cells and / or subtypes thereof include, but are not limited to, those described in US 2016 / 0175358; WO 2017 / 197347; US9499788; US 2018 / 0169147; US 9907820; US 2018 / 0125889 and US 2017 / 0196910, the contents of each of which are incorporated by reference for all purposes, including compositions and methods for making and using engineered and non-engineered γδ T cells and / or subtypes thereof. The present application further contemplates T cells or other engineered leukocytes or lymphocytes expressing one γ chain or one δ chain, optionally in combination with a second polypeptide to form a functional TCR. Such engineered leukocytes or lymphocytes expressing one γ chain or one δ chain can be used in the methods described herein or present in the compositions described herein.

[0091] As used herein, the term "T lymphocyte" or "T cell" refers to an immune cell that expresses or has expressed CD3 (CD3+) and T cell receptor (TCR+). T cells play a central role in cell-mediated immunity. T cells that "express" CD3 and TCR are engineered to eliminate CD3 and / or TCR cell surface expression.

[0092] As used herein, the term "TCR" or "T cell receptor" refers to a dimeric heterologous cell surface signaling protein that forms an α-β or γ-δ receptor or a combination thereof. αβTCR recognizes antigens presented by MHC molecules, while γδTCR can recognize antigens independent of MHC presentation.

[0093] As used herein, the term "CD70" refers to a molecule belonging to the tumor necrosis factor (TNF) ligand family, and is also referred to as CD27LG and TNFSF7. CD70 is a ligand for CD27 (TNFRSF27). The term CD70 may include, but is not limited to, native CD70, an isoform of CD70, or a cross-species CD70 homolog of CD70. The amino acid sequence of human CD70 (hCD70) is provided in NCBI accession number NP001243.1 (GI: 4507605) (SEQ ID NO: 1). Residues 1-17 of SEQ ID NO: 1 correspond to the cytoplasmic region of hCD70, residues 18-38 correspond to the transmembrane region of hCD70, and residues 39-193 correspond to the extracellular region of hCD70. At least one other hCD70 isoform is known and is identified by the UniProt identifier P32970-2. As used herein, CD70 includes human CD70 and non-human CD70 homologs, as well as variants, fragments or post-translationally modified forms thereof, including but not limited to N- and O-linked glycosylated forms of CD70. The CD70 protein may further include a fragment comprising all or part of SEQ ID NO: 1 (e.g., amino acids 39-193 of SEQ ID NO: 1, corresponding to the extracellular component of hCD70, amino acids 18-193, corresponding to the transmembrane and extracellular components of hCD70).

[0094] The term "MHC" (major histocompatibility complex) refers to a subset of genes that encode cell surface antigen presenting proteins. In humans, these genes are called human leukocyte antigen (HLA) genes. In this article, the abbreviations MHC or HLA are used interchangeably.

[0095] As used herein, "activation" refers to the state of a T cell that has been sufficiently stimulated to induce detectable cell proliferation. Activation can also be associated with induced cytokine production and detectable effector function. The term "activated T cell" refers, among other things, to a T cell that is undergoing cell division.

[0096] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. Antibodies can be complete immunoglobulins derived from natural or recombinant sources, and can be immunoreactive portions of complete immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. Antibodies in the present invention can exist in a variety of forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single-chain antibodies and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, NY; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

[0097] As used herein, the term "antigen" or "Ag" is defined as a molecule that causes an immune response. This immune response may involve antibody production, or activation of specific immune competent cells, or both. Those skilled in the art will appreciate that any macromolecule, including proteins or peptides, may be used as an antigen.

[0098] The term "epitope" includes any protein determinant, lipid or carbohydrate determinant that can specifically bind to an immunoglobulin or cell receptor (e.g., a CD27 binding domain). Epitope determinants are usually composed of active surface groups of molecules (such as amino acids, lipids or sugar side chains) and usually have specific three-dimensional structural characteristics as well as specific charge characteristics.

[0099] As used herein, the term "specific binding" refers to a receptor (e.g., full-length CD27) that recognizes a specific molecule / ligand (e.g., CD70) but does not substantially recognize or bind to other molecules in the sample. For example, a receptor that specifically binds to a molecule from one species may also bind to the molecule from one or more other species. However, this cross-species reactivity itself does not change the specific classification. In another example, a receptor that specifically binds to a molecule may also bind to different allelic forms of the molecule. However, this cross-reactivity itself does not change the specific classification. In some cases, the term "specific binding" or "specifically binding" may be used to refer to the interaction of a protein (or peptide) with a second chemical substance, meaning that the interaction depends on the presence of a specific structure (e.g., an antigenic determinant or epitope) on the chemical substance; for example, the receptor recognizes and binds to a specific structure rather than a common protein. If the receptor is specific for epitope "A", then in the reaction containing labeled "A" and the receptor, the presence of a molecule containing epitope A (or free unlabeled A) will reduce the amount of labeled A bound to the receptor.

[0100] In some embodiments, specific binding can be achieved by at least about 1×10 -8 The specific binding of a molecule may be characterized by an equilibrium dissociation constant of M or less (eg, a smaller KD indicates tighter binding). Methods for determining whether two molecules specifically bind are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, and the like.

[0101] The "costimulatory domain" in the context of the chimeric receptor of the present disclosure (also referred to herein as a chimeric antigen receptor (CAR)) enhances cell proliferation, cell survival and memory cell development of cytotoxic cells expressing chimeric receptors. The chimeric receptor of the present invention may include one or more costimulatory domains, which are selected from the costimulatory domains of proteins in the following TNFR superfamily: CD28, CD137 (4-1BB), CD134 (OX40), Dap10, CD27, CD2, CD7, CD5, ICAM-1, LFA-1 (CD11a / CD18), Lck, TNFR-I, PD-1, TNFR-II, Fas, CD30, CD40, ICOSLIGHT, NKG2C, B7-H3 or a combination thereof. If the chimeric receptor includes more than one costimulatory domain, these domains may be arranged in series, optionally separated by a linker. The costimulatory domain is an intracellular domain that may be located between (truncated or full-length) CD27 and the intracellular signaling domain within the chimeric receptor.

[0102] As used herein, the term "costimulatory domain" also encompasses any modifications thereof, examples of which are described in U.S. Patent Application No. 20200129554; U.S. Patent Application No. 20200317777; WO2019010383; Li, W., et al., (2020) Immunity 53: 456-470; and Li, G., et al., (2017) J Immunol 198(1 Supplement):198.4, the contents of each of which are incorporated herein in their entirety.

[0103] The "intracellular signaling domain" in the context of the chimeric receptors of the present disclosure converts effector function signals and directs cytotoxic cells to perform their specialized functions, i.e., to injure and / or destroy target cells. Examples of suitable intracellular signaling domains include, for example, the zeta chain of the T cell receptor complex or any homolog thereof, such as the eta chain, FcsRly and β chains, MB 1 (Iga) chain, B29 (Ig) chain, etc., human CD3 zeta chain, CD3 polypeptide (Δ, δ and ε), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.) and other molecules involved in T cell transduction, such as CD2, CD5 and CD28. In an embodiment, the intracellular signaling domain of the chimeric receptor can be the cytoplasmic tail of the human CD3 zeta chain, FcγRIII, FcsRI, Fc receptors, cytoplasmic receptors carrying immunoreceptor tyrosine activation motifs (ITAMs), and combinations thereof.

[0104] The intracellular signaling domain may include several types of intracellular signaling domains of various other immune signaling receptors, including but not limited to first, second, and third generation T cell signaling proteins, including CD3, B7 family co-stimulatory receptors, and tumor necrosis factor receptor (TNFR) superfamily receptors (Park et al., "Are all chimeric antigen receptors created equal?" J Clin Oncol., Vol. 33, pp. 651-653, 2015). Other intracellular signaling domains include signaling domains used by NK and NKT cells (Hermanson et al., "Utilizing chimeric antigen receptors to direct natural killer cell activity," Front Immunol., Vol. 6, p. 195, 2015), such as the signaling domain of NKp30 (B7-H6) (Zhang et al., "An NKp30-based chimeric antigen receptor promotes T cell effector functions and antitumor efficacy in vivo," JImmunol., Vol. 189, pp. 2290-2299, 2012) and DAP12 (Topfer et al., "DAP12-basedactivating chimeric antigen receptor for NK cell tumor immunotherapy," JImmunol., Vol. 194, pp. 3201-3212, 2015), NKG2D, NKp44, NKp46, DAP10, and CD3z. In addition, the intracellular signaling domain also includes the signaling domain of human immunoglobulin receptors containing immunoreceptor tyrosine-based activation motifs (ITAMs), such as FcgammaRI, FcgammaRIIA, FcgammaRIIC, FcgammaRIIIA, and FcRL5 (Gillis et al., "Contribution of Human Fc.gamma.Rs to Disease with Evidence from Human Polymorphisms and Transgenic Animal Studies," Front Immunol., Vol. 5, p. 254, 2014).

[0105] In an embodiment, the intracellular signaling domain comprises a cytoplasmic signaling domain of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, or CD66d. In an exemplary embodiment, the intracellular signaling domain in the chimeric receptor comprises a cytoplasmic signaling domain of human CD3 zeta. The term "intracellular signaling domain" as used herein also encompasses any modifications thereof, examples of which are described in U.S. Patent Application No. 2020 / 0317777 and Roda-Navarro, P., and Reyburn, HT., (2009) J Biol Chem 284(24): 16463-16472; Giurisato, E., et al., (2007) Mol Cell Biol 27(24): 8583-8599; and Wu, J., et al., (2000) J Exp Med 192(7): 1059-1068, the contents of each of which are incorporated herein in their entirety.

[0106] As used herein, the term "anti-tumor effect" refers to a biological effect that can be manifested by a reduction in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancerous conditions. "Anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies of the present invention to initially prevent tumorigenesis.

[0107] As used herein, the term "autologous" refers to any material derived from an individual that is subsequently reintroduced into the same individual.

[0108] As used herein, the term "allogeneic" refers to material derived from an animal that is subsequently introduced into a different animal of the same species.

[0109] As used herein, the term "treating" a disease means reducing the frequency or severity of at least one sign or symptom of a disease or condition experienced by a subject. In one example, therapy (e.g., administration of a therapeutic agent of the disclosure) treats a disease or condition by reducing one or more signs or symptoms associated with the disease or condition, e.g., compared to the response in the absence of therapy. For example, administration of a therapeutic agent may provide an anti-tumor effect that reduces one or more signs or symptoms associated with cancer.

[0110] As used herein, the term "administering" means providing or giving to a subject one or more agents, such as agents that treat one or more signs or symptoms associated with a disorder / condition or disease, including, but not limited to, cancer (e.g., lymphoma), viral infection, bacterial infection, etc., by any effective route. Exemplary routes of administration include, but are not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, sublingual, rectal, transdermal, intranasal, vaginal, and inhalation routes. Administration "in combination with one or more additional therapeutic agents" includes simultaneous (concurrent) administration and sequential administration in any order.

[0111] As used herein, the term "pharmaceutically acceptable" refers to a material (including but not limited to salt, carrier or diluent) that does not eliminate the biological activity or characteristics of a compound, and is relatively nontoxic, i.e., the material can be applied to an individual without causing an undesirable biological effect or interacting with any component contained in the composition in a harmful manner. Pharmaceutically acceptable carriers (vehicles) that can be used for the present disclosure are conventional. Remington's Pharmaceutical Sciences, by EWMartin, Mack Publishing Co., Easton, Pa., 19th edition (1995), describes compositions and preparations suitable for drug delivery of one or more agents (such as one or more regulators). Generally speaking, the property of the carrier depends on the specific mode of administration adopted. For example, parenteral preparations can include injectable fluids, which include pharmaceutically and physiologically acceptable fluids (such as water, saline, balanced salt solution, dextrose aqueous solution, glycerol, etc.) as vehicles. In addition to the biological neutral carrier, the medicament to be administered may contain a small amount of non-toxic auxiliary substances, such as wetting agents or emulsifiers, preservatives and pH buffers, etc., for example, sodium acetate or sorbitan monolaurate, sodium lactate, potassium chloride, calcium chloride and triethanolamine oleate. For example, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and, for example, γδ T cells as described herein, preferably γδ T cells engineered to express a CAR against CD70.

[0112] "Encoding" refers to the inherent properties and biological properties resulting from the specific sequence of nucleotides in a polynucleotide (such as a gene, cDNA or mRNA) that serves as a template for synthesizing other polymers and macromolecules with a defined nucleotide sequence (i.e., rRNA, tRNA and mRNA) or a defined amino acid sequence in a biological process. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, the gene encodes the protein. The coding strand of the nucleotide sequence that is identical to the mRNA sequence and is usually provided in the sequence table and the non-coding strand used as a transcription template for a gene or cDNA can both be referred to as encoding a protein or other product of the gene or cDNA.

[0113] "Isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide naturally occurring in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein may exist in a substantially pure form, or may exist in a non-natural environment such as, for example, a host cell.

[0114] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Nucleotide sequences encoding proteins and RNA may contain introns.

[0115] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0116] "Expression cassette" refers to a nucleic acid comprising an expression control sequence operably linked to a nucleic acid encoding a transcript or polypeptide to be expressed. The expression cassette comprises sufficient cis-acting expression elements; other expression elements may be provided by the host cell or in an in vitro expression system. The expression cassette may be a component of a vector such as a cosmid, a plasmid (e.g., naked or contained in a liposome), or a virus (e.g., a lentivirus, a retrovirus, an adenovirus, and an adeno-associated virus). The expression cassette may be in a host cell such as a γδ T cell.

[0117] II. Compositions and Methods of the Invention

[0118] Unless otherwise defined, the technical and scientific terms used herein have the same meaning as those of ordinary skill in the art generally understood. In particular, the disclosure utilizes the conventional techniques in recombinant genetics, immunology and biochemistry. The basic texts disclosing the general terms in molecular biology and genetics include, for example, Lackie, Dictionary of Cell and Molecular Biology, Elsevier (5th edition 2013). The basic texts disclosing the methods in recombinant genetics and molecular biology include, for example, Sambrook et al., Molecular Cloning— A Laboratory Manual, Cold Spring Harbor Press 4th edition (Cold Spring Harbor, NY2012) and Current Protocols in Molecular Biology Vol. 1-3, John Wiley & Sons, Inc. (1994-1998) and Supplementary Materials 1-115 (1987-2016). Basic texts disclosing general methods and terminology in biochemistry include, for example, Lehninger Principles of Biochemistry 6th edition, David L. Nelson and Michael M. Cox, ed. WH Freeman (2012). Basic texts disclosing general methods and terminology in immunology include Janeway's Immunobiology (9th edition) by Kenneth M. Murphy and Casey Weaver (2017) Garland Science; Fundamental Immunology (7th edition) by William E. Paul (2013) Lippincott, Williams and Wilkins.

[0119] A. Chimeric Antigen Receptor Constructs:

[0120] Aspects of the invention include nucleic acids encoding CARs, and constructs and vectors comprising such nucleic acids. In some cases, the nucleic acid is a heterologous component, such as an expression cassette. In some embodiments, the nucleic acid is a heterologous component, such as a retroviral vector. In some embodiments, the nucleic acid is a heterologous component, such as an αβ or γδ T cell, and preferably a γδ T cell. In some embodiments, the nucleic acid is a heterologous component, such as a γ + T cells and / or delta +In some embodiments, the nucleic acid is, for example, - T cells and / or β - Heterogeneous components of cells.

[0121] Described herein are nucleic acids encoding CAR binding domains that specifically bind to tumor-associated antigens (TAAs) expressed on the surface of tumor cells. In embodiments, TAA is CD70. CD70 belongs to the TNF superfamily and has an amino acid sequence of SEQ ID NO: 1. CD70 is involved in the proliferation and survival of lymphoid-derived cells when interacting with its receptor CD27.

[0122] One embodiment of the present invention provides a nucleic acid encoding a CAR, the CAR comprising an antigen binding transmembrane domain, the antigen binding transmembrane domain comprising a CD27 amino acid sequence. In this regard, the CAR may comprise a CD27 antigen binding domain and a CD27 transmembrane domain. The CD27 amino acid sequence may comprise or consist of any suitable human antigen binding and transmembrane domain CD27 amino acid sequence. In one embodiment of the present invention, the full-length CD27 (including a signal peptide, an antigen binding domain, a transmembrane domain, and a co-stimulatory signaling domain) has an amino acid sequence of SEQ ID NO: 33. In one embodiment of the present invention, the antigen binding domain of CD27 consists of amino acid residues 20-191 of SEQ ID NO: 33 and has an amino acid sequence of SEQ ID NO: 35; the transmembrane domain of CD27 consists of amino acid residues 192-212 of SEQ ID NO: 33 and has an amino acid sequence of SEQ ID NO: 37; and the costimulatory domain of CD27 consists of amino acid residues 213-260 and has an amino acid sequence of SEQ ID NO: 39. Therefore, in one embodiment of the present invention, CAR comprises an antigen binding-transmembrane domain comprising the amino acid sequences of SEQ ID NOs: 35 and 37. The antigen binding domain of CD27 specifically binds to CD70.

[0123] In one embodiment of the present invention, the antigen binding domain of CD27 has an amino acid sequence of SEQ ID NO: 41 (R58W), the transmembrane domain of CD27 has an amino acid sequence of SEQ ID NO: 37, and the intracellular signaling domain of CD27 has an amino acid sequence of SEQ ID NO: 39. Therefore, in one embodiment of the present invention, CAR comprises an antigen binding-transmembrane domain comprising the amino acid sequences of SEQ ID NOs: 41 and 37.

[0124] One embodiment of the present invention provides a nucleic acid encoding a CAR, wherein the CAR comprises an antigen binding-transmembrane domain, wherein the antigen binding-transmembrane domain comprises a CD27 amino acid sequence lacking all or part of a CD27 co-stimulatory domain, wherein the portion lacking the CAR is at least consecutive amino acid residues 238-260, at least consecutive amino acid residues 237-260, at least consecutive amino acid residues 236-260, at least consecutive amino acid residues 235-260, at least consecutive amino acid residues 234-260, at least consecutive amino acid residues 233-260, at least consecutive amino acid residues 232-260, at least consecutive amino acid residues 231-260, at least consecutive amino acid residues 230-260, at least consecutive amino acid residues 229-260, at least consecutive amino acid residues 228-260, at least consecutive amino acid residues 227-260, at least consecutive amino acid residues 226-260, at least consecutive amino acid residues 235-260, at least consecutive amino acid residues 234-260, at least consecutive amino acid residues 233-260, at least consecutive amino acid residues 232-260, at least consecutive amino acid residues 231-260, at least consecutive amino acid residues 230-260, at least consecutive amino acid residues 229-260, at least consecutive amino acid residues 228-260, at least consecutive amino acid residues 227-260, at least consecutive amino acid residues 226-260, at least consecutive amino acid residues 260, at least consecutive amino acid residues 214-260, at least consecutive amino acid residues 213-260, or at least consecutive amino acid residues 212-260.

[0125] In one embodiment, the antigen binding-transmembrane domain comprises consecutive amino acid residues 238-260, consecutive amino acid residues 237-260, consecutive amino acid residues 236-260, consecutive amino acid residues 235-260, consecutive amino acid residues 234-260, consecutive amino acid residues 233-260, consecutive amino acid residues 232-260, consecutive amino acid residues 231-260, consecutive amino acid residues 230-260, consecutive amino acid residues 229-260, consecutive amino acid residues 228-260, consecutive amino acid residues 227-260, consecutive amino acid residues 226-260, consecutive amino acid residues 225 -260, consecutive amino acid residues 224-260, consecutive amino acid residues 223-260, consecutive amino acid residues 222-260, consecutive amino acid residues 221-260, consecutive amino acid residues 220-260, consecutive amino acid residues 219-260, consecutive amino acid residues 218-260, consecutive amino acid residues 217-260, consecutive amino acid residues 216-260, consecutive amino acid residues 215-260, consecutive amino acid residues 214-260, consecutive amino acid residues 213-260 or consecutive amino acid residues 212-260 of the CD27 amino acid sequence.

[0126] A CD27 amino acid sequence lacking all or part of the CD27 co-stimulatory domain is also referred to herein as a "truncated CD27 amino acid sequence" or "truncated CD27." Thus, in an embodiment, a nucleic acid as disclosed herein encodes a truncated CD27 amino acid sequence.

[0127] In a preferred embodiment, the nucleic acid encodes a CAR comprising a CD27 amino acid sequence, wherein the CD27 amino acid sequence consists of at least an antigen binding domain comprising or consisting of SEQ ID NO: 35 or SEQ ID NO: 41, a transmembrane domain comprising or consisting of SEQ ID NO: 37, and a co-stimulatory domain comprising or consisting of SEQ ID NO: 39, and optionally further comprises a signal peptide, preferably wherein the signal peptide comprises or consists of SEQ ID NO: 2.

[0128] In an embodiment, the CAR encoded by the nucleic acid may further include at least one costimulatory domain, wherein the costimulatory domain includes a functional costimulatory signaling domain, and the functional costimulatory signaling domain is derived from, for example, MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), activated NK cell receptors, BTLA, Toll ligand receptors, etc. For example, within the scope of the present disclosure, CAR may include 2, 3, 4 or more costimulatory domains. Also within the scope of the present disclosure, when more than one costimulatory domain is included, the costimulatory domains may be the same, or they may be different.In embodiments, the costimulatory domain is derived from one or more of the following: TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, IL2Rβ, IL2γ, IL7Rα, IL4R, IL7R, IL15R, IL21R, CD18, CD19, CD19a, CD27, CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f, CD54 (ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96 (Tactile), CD100, CD111, CD112, CD113, CD114, CD115, CD116, CD117, CD118, CD119, CD119a, CD27, CD28, CD29, CD30, CD40, CD5 (SEMA4D), CD103, CD134 (OX40), CD137 (4-1BB), CD152 (CTLA-4), CD160 (BY55), CD162 (SELPLG), CD244 (2B4), CD270 (HVEM), CD226 (DNAM1), CD229(Ly9), CD278 (ICOS), ICAM-1, LFA-1 (CD11a / CD18), FcR, FcγRI, FcγRII, FcγRIII, LAT, NKG2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, ​​LAT, GADS, LIGHT, HVEM(LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1,ITGB2, ITGB7, NKG2C, NKG2D, IA4, VLA-1, VLA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, Ly108), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKp80(KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2 and TRANCE / RANKL or portions thereof and combinations thereof.

[0129] In some embodiments, the nucleic acid encoding CAR encodes at least one 4-1BB co-stimulatory domain, and optionally encodes a second co-stimulatory domain, which is selected from 4-1BB, 2B4, ICOS, CD28, OX40 and CD27 co-stimulatory domains or any of the above co-stimulatory domains. In some embodiments, the nucleic acid encodes at least two 4-1BB co-stimulatory domains, or at least two 4-1BB co-stimulatory domains and one, two, three, or four or more co-stimulatory domains selected from 4-1BB, ICOS, CD28, OX40 and CD27 or any of the above co-stimulatory domains. In some embodiments, the 4-1BB co-stimulatory domain comprises SEQ ID NO: 4. In some embodiments, the 4-1BB co-stimulatory domain comprises at least one, at least two or at least three or more modified amino acid sequences of the amino acid sequence of SEQ ID NO: 4. In the embodiment, the 4-1BB co-stimulatory domain is substantially similar to the 4-1BB co-stimulatory domain comprising SEQ ID NO: 4.

[0130] In some embodiments, the nucleic acid encoding CAR encodes at least one CD27 co-stimulatory domain, and optionally encodes at least one second co-stimulatory domain, the second co-stimulatory domain being selected from 4-1BB, ICOS, CD28, OX40, 2B4 and CD27 co-stimulatory domains, or any of the above co-stimulatory domains. In some embodiments, the nucleic acid encodes at least one CD27 co-stimulatory domain and a 4-IBB co-stimulatory domain. In some embodiments, the nucleic acid encodes two CD27 co-stimulatory domains, and at least one second co-stimulatory domain selected from 4-1BB, ICOS, CD28 and CD27. In some embodiments, the CD27 co-stimulatory domain comprises SEQ ID NO: 39. In some embodiments, the CD27 co-stimulatory domain comprises at least one, at least two, at least three or more modified amino acid sequences of the amino acid sequence of SEQ ID NO: 39. In the embodiment, the CD27 co-stimulatory domain is substantially similar to the CD27 co-stimulatory domain comprising SEQ ID NO: 39.

[0131] In some embodiments, the nucleic acid encoding CAR encodes at least one CD28 costimulatory domain, and optionally encodes a second costimulatory domain, which is selected from 4-1BB, 2B4, ICOS, CD28, OX40 and CD27 costimulatory domains or any of the above costimulatory domains. In some embodiments, the nucleic acid encodes at least two CD28 costimulatory domains, or at least two CD28 costimulatory domains and one, two, three, or four or more costimulatory domains selected from 4-1BB, ICOS, CD28, OX40 and CD27 or any of the above costimulatory domains. In some embodiments, the CD28 costimulatory domain comprises SEQ ID NO: 73. In the embodiment, the CD28 costimulatory domain comprises SEQ ID NO: 74. SEQ ID NO: 73 and SEQ ID NO: 74 include three subdomains YMNM, PRRP and PYAP, which can regulate signal transduction pathways. In embodiments, the disclosed CAR comprises a mutation or deletion of one or more of the subdomains (see, e.g., WO2019010383). In some embodiments, the CD28 costimulatory domain comprises an amino acid sequence having SEQ ID NO: 73 or an amino acid sequence of SEQ ID NO: 74, at least two, at least three or more modified amino acid sequences. In some embodiments, the CD28 costimulatory domain is substantially similar to the CD28 costimulatory domain comprising SEQ ID NO: 73. In some embodiments, the CD28 costimulatory domain is substantially similar to the CD28 costimulatory domain comprising SEQ ID NO: 74.

[0132] In some embodiments, the nucleic acid encoding CAR encodes at least one ICOS costimulatory domain, and optionally encodes a second costimulatory domain, which is selected from 4-1BB, 2B4, ICOS, CD28, OX40 and CD27 costimulatory domains or any of the above costimulatory domains. In some embodiments, the nucleic acid encodes at least two ICOS costimulatory domains, or at least two ICOS costimulatory domains and one, two, three, or four or more costimulatory domains selected from 4-1BB, ICOS, CD28, OX40 and CD27, or any of the above costimulatory domains. In some embodiments, the ICOS costimulatory domain comprises SEQ ID NO: 75. In some embodiments, the ICOS costimulatory domain comprises at least one, at least two, at least three or more modified amino acid sequences of the amino acid sequence of SEQ ID NO: 75 (see, e.g., US20170209492). In some embodiments, the ICOS costimulatory domain is substantially similar to the ICOS costimulatory domain comprising SEQ ID NO: 75.

[0133] In some embodiments, the nucleic acid encoding CAR encodes at least one OX40 costimulatory domain, and optionally encodes a second costimulatory domain, the second costimulatory domain being selected from 4-1BB, 2B4, ICOS, CD28, OX40 and CD27 costimulatory domains or any one of the above costimulatory domains. In some embodiments, the nucleic acid encodes at least two OX40 costimulatory domains, or at least two OX40 costimulatory domains and one, two, three, or four or more costimulatory domains selected from 4-1BB, ICOS, CD28, OX40 and CD27 or any one of the above costimulatory domains. In some embodiments, the OX40 costimulatory domain comprises SEQ ID NO: 76. In some embodiments, the OX40 costimulatory domain comprises at least one, at least two, at least three or more modified amino acid sequences of the amino acid sequence of SEQ ID NO: 76. In some embodiments, the OX40 costimulatory domain is substantially similar to the OX40 costimulatory domain comprising SEQ ID NO: 76.

[0134] In the embodiment, the nucleic acid encoding CAR encodes at least one intracellular signaling domain. In the embodiment, at least one intracellular signaling domain is outside one or more costimulatory domains. In the embodiment, one or more intracellular signaling domains are included to increase the proliferation, persistence and / or cytotoxic activity of host cells containing CAR as disclosed herein, preferably γδ cells. For example, in some embodiments, the intracellular signaling domain includes CD3ζ, repeats (e.g., 2-5) DAP10 YINM motifs, derived from LFA-1, DAP12, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD79a, CD79b, CD5, CD22, FcεRI, CD66d, etc. Signaling domains. Within the scope of this disclosure, the intracellular domain of the disclosed CAR may include multiple (e.g., 2, 3, 4 or more) intracellular signaling domains. In the case of including more than one intracellular signaling domain, the intracellular signaling domain may be the same, or it may be different.

[0135] In some embodiments, the intracellular signaling domain of the disclosed CAR is or comprises a CD3 zeta signaling domain. In some embodiments, the CD3 zeta signaling domain is or comprises an amino acid sequence as shown in SEQ ID NO: 10, 12 or 13.

[0136] In some embodiments, the nucleic acid encoding CAR encodes one or more costimulatory domains (e.g., 4-1BB costimulatory domain) and one or more intracellular signaling domains (e.g., CD3 ζ signaling domain). In some embodiments, the nucleic acid encodes at least one 4-1BB costimulatory domain, at least one CD27 or CD28 domain, and at least one CD3 ζ signaling domain. In other embodiments, the nucleic acid encodes one or more first costimulatory domains (e.g., 4-1BB, CD27, CD28, OX40, ICOS) and one or more second costimulatory domains (e.g., 4-1BB, CD27, CD28, OX40, ICOS) and one or more intracellular signaling domains (e.g., CD3 ζ). In embodiments, the CD3 ζ signaling domain is located downstream (C-terminal) of the costimulatory domain (e.g., 4-1BB). In some embodiments, the CD3 ζ signaling domain is located upstream (N-terminal) of the costimulatory domain (e.g., 4-1BB).

[0137] In embodiments, the nucleic acid encoding the separation of the CAR of the present invention may also encode one or more polycistronic joint regions, which are configured to promote the translation of CAR polypeptides and one or more additional polypeptides. In embodiments, the nucleic acid encoding one or more additional polypeptides and related joint regions may be located at the 3' end of the separated nucleic acid, or at the 5' end of the separated nucleic acid, or at the 5' end and 3' end of the separated nucleic acid in some examples. In some embodiments, the joint region may encode self-cutting and / or cutting polypeptide sequences. In some examples, the self-cutting sequence is a 2A self-cutting sequence (e.g., T2A, P2A, E2A, F2A), which may induce ribosome jumping during the translation of CAR. In embodiments, the cutting sequence is a furin protease (furin) sequence. In some examples, the cutting sequence (e.g., a furin protease cutting sequence as shown in SEQ ID NO: 79) is a self-cutting sequence such as the amino terminus of furin protease-P2A (FP2A). In some embodiments, the polycistronic joint region encodes an internal ribosome entry site. In some embodiments, the addition of an optional linker "GSG" or "SGSG" etc. can improve cleavage efficiency. In this way, one or more additional polypeptides can be released from the CAR and directed to the secretory pathway.

[0138] In some embodiments, the cleavage sequence is the FP2A amino acid sequence as shown in SEQ ID NO:6. In some embodiments, the cleavage sequence is the P2A amino acid sequence as shown in SEQ ID NO:8 or SEQ ID NOs: 77-78. In some embodiments, the cleavage sequence is the furin amino acid sequence as shown in SEQ ID NO:79. In some embodiments, the cleavage sequence is the F2A amino acid sequence as shown in SEQ ID NO:80. In some embodiments, the cleavage sequence is the E2A amino acid sequence as shown in SEQ ID NO:81. In some embodiments, the cleavage sequence is the T2A amino acid sequence as shown in SEQ ID NO:82. In some aspects, multiple cleavage and / or self-cleavage sequences can be encoded at the carboxyl terminus of the signaling and / or costimulatory domain and the amino terminus of the encoded one or more additional polypeptides. In some aspects, one or more self-cleavage sequences and one or more sequences cleaved by endogenous proteases are encoded in the constructs described herein. In some embodiments, the endogenous protease recognition site is encoded at the amino terminus of the self-cleavage sequence. Other suitable internal ribosome entry sites include, but are not limited to, those disclosed in Nucleic Acids Res. 2010 Jan;38(Database Issue):D131-6. doi:10.1093 / nar / gkp981. Epub 2009 Nov 16, those described at iresite.org, those described in WO2018 / 215787, the sequence described in GenBank Accession No. KP019382.1, and the IRES element disclosed in GenBank Accession No. LT727339.1. Additional polycistronic linker regions, including cleavage, self-cleavage, and IRES elements, are disclosed in US 2018 / 0360992 and US 8,865,467.

[0139] In some embodiments, the polycistronic linker region encodes an internal ribosome entry site. An exemplary internal ribosome entry site is encoded by the nucleotide sequence set forth in SEQ ID NO: 83. Another exemplary internal ribosome entry site is encoded by the nucleotide sequence set forth in SEQ ID NO: 84.

[0140] In embodiments, one or more additional polypeptides include one or more soluble γ chain cytokines expressed as isolated polypeptides from CAR. One or more soluble shared γ chain cytokines may include but are not limited to IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, IL-23. In some embodiments, shared γ chain cytokines are selected from IL-2, IL-7 and IL-15. In some embodiments, shared γ chain cytokines are IL-15. IL-15 sequences (including codon-optimized nucleic acid sequences encoding soluble IL-15 (sIL-15)) are disclosed herein and in WO 2007 / 037780.

[0141] In embodiments, one or more additional polypeptides include one or more tags or markers, for example, to facilitate the ability to monitor CAR expression levels, to serve as internal controls, etc. In some embodiments, the isolated nucleic acid encoding CAR encodes a fluorescent protein, examples of which include, but are not limited to, green fluorescent protein (GFP), red fluorescent protein (RFP), enhanced GFP (EGFP), enhanced cyan fluorescent protein (ECFP), enhanced yellow fluorescent protein (EYFP), etc. Other examples may include, but are not limited to, chloramphenicol acetyltransferase, β-galactosidase, β-glucuronidase, β-lactamase, luciferase, etc.

[0142] In embodiments, one or more additional polypeptides include proteins expressed on the cell surface to facilitate detection and / or separation of cells expressing the protein, such as via fluorescence activated cell sorting (FACS); or for enrichment by positive selection using antibodies specific for the encoded protein, such as using antibodies to purify or enrich cell products on a column or device; or for in vivo binding of antibodies to proteins to enhance or eliminate activity, for example, to facilitate the removal of cells expressing proteins in patients for safety reasons. Exemplary proteins for these purposes include, for example, CD19, CD20 (rituximab (Rituxumab) recognition domain), LNGFR, truncated forms of human epidermal growth factor receptor (EGFRt), etc. By way of example, EGFRt can be targeted by clinical stage antibodies, wherein the use of the antibodies to treat patients results in the elimination of cells containing isolated nucleic acids encoding CAR as disclosed herein and / or the CAR.

[0143] In an embodiment, one or more additional polypeptides include proteins that have the function of increasing resistance to exhaustion and activation-induced apoptosis and / or upregulating one or more proinflammatory cytokines, co-stimulatory molecules, and / or antigen presentation mechanisms. Representative examples include, but are not limited to, lymphotoxin beta receptor (LTBR). LTBR is typically expressed in a subset of myeloid cells but not in lymphocytes. When expressed in T cells, LTBR can induce transcriptional remodeling, conferring one or more of the above-mentioned beneficial functions to T cells (Legut et al., Blood. (2021); 138(1): 1726).

[0144] In some embodiments, one or more additional polypeptides include polypeptides that confer the ability of host cells to resist tumor antigen-specific cellular immunity (e.g., cellular immunity mediated by transforming growth factor β (TGF-β)). For example, the isolated nucleic acid may encode a dominant negative receptor (dnTGFβR2) of TGF-β, for example, Foster et al., J Immunother. (2008); 31: 500-505, WO2019 / 173324A1, WO2020 / 183131A1, and WO2020042647A1. In the presence of TGF-β-secreting tumors, incorporation of such a dominant negative receptor of TGF-β may provide functional advantages, including enhanced anti-tumor activity, relative to control cells lacking such a dominant negative receptor of TGF-β. In some embodiments, the isolated nucleic acid encodes a signal peptide that is operably connected to facilitate directing one or more additional polypeptides to the secretory pathway. Such one or more additional polypeptides may be polypeptides located inside certain organelles, polypeptides secreted from host cells, or polypeptides inserted into the cell membrane. In an embodiment, the signal peptide comprises or consists of the amino acid sequence shown in SEQ ID NO: 2. In an embodiment, the signal peptide comprises or consists of the amino acid sequence shown in SEQ ID NO: 17. In an embodiment, the signal peptide comprises or consists of the amino acid sequence shown in SEQ ID NO: 21. In an embodiment, the signal peptide comprises or consists of the amino acid sequence shown in SEQ ID NO: 25. In an embodiment, the signal peptide comprises or consists of the amino acid sequence shown in SEQ ID NO: 29. In an embodiment, the signal peptide comprises or consists of the amino acid sequence shown in SEQ ID NO: 85.

[0145] In some embodiments, the one or more additional polypeptides include the EGFRt amino acid sequence as shown in SEQ ID NO: 19. In an embodiment, a signal peptide comprising or consisting of the amino acid sequence as shown in SEQ ID NO: 17 is operably linked to SEQ ID NO: 19. In some embodiments, the one or more additional polypeptides include the dominant negative TGFβ receptor II (dnTGFβR2) amino acid sequence as shown in SEQ ID NO: 23. In an embodiment, a signal peptide comprising or consisting of the amino acid sequence as shown in SEQ ID NO: 21 is operably linked to SEQ ID NO: 23. In some embodiments, the one or more additional polypeptides include the full-length LTBR amino acid sequence as shown in SEQ ID NO: 27. In an embodiment, a signal peptide comprising or consisting of the amino acid sequence as shown in SEQ ID NO: 25 is operably linked to SEQ ID NO: 27. In some embodiments, the one or more additional polypeptides include the LNGFR amino acid sequence as shown in SEQ ID NO: 31. In an embodiment, a signal peptide comprising or consisting of the amino acid sequence as shown in SEQ ID NO: 29 is operably linked to SEQ ID NO: 31. In some embodiments, the one or more additional polypeptides include the sIL-15 amino acid sequence as shown in SEQ ID NO: 86. In embodiments, a signal peptide comprising or consisting of the amino acid sequence as shown in SEQ ID NO: 85 is operably linked to SEQ ID NO: 86.

[0146] In some embodiments, one or more additional polypeptides include a chimeric switch receptor comprising an extracellular domain of a TGFβ receptor for binding to TGFβ (e.g., TGFβRI and / or TGFβRII) and an intracellular domain of a cytokine receptor. The chimeric switch receptor can convert a TGFβ signal into a cytokine signal that promotes cytotoxicity. Examples of such chimeric switch receptors include those described in WO2012138858, WO2016122738, WO2018094244, WO2014172584, WO2019109980, and WO2022037562, which are incorporated by reference in their entirety.

[0147] In an embodiment, one or more additional polypeptides include dominant negative Fas (dnFas). Incorporation of such dominant negative Fas in T cells can provide functional advantages relative to control cells lacking such dominant negative Fas, can prevent Fas ligand-induced apoptosis and allow T cells to persist and have anti-tumor efficacy. Examples of dnFas include those described in Yamamoto TN et al., T cells genetically engineered to overcome death signalingenhance adoptive cancer immunotherapy, J Clin Invest. 2019 Feb 25; 129(4): 1551-1565, which is incorporated herein by reference in its entirety.

[0148] In an embodiment, the one or more additional polypeptides include membrane-bound IL-12 (mbIL-12). Incorporation of such mbIL-12 into T cells can provide functional advantages relative to control cells lacking such mbIL-12, can enhance effector function of T cells and / or limit systemic toxicity associated with IL-12. Examples of mbIL-12 include those described in Hu J. et al., Cellmembrane-anchored and tumor-targeted IL-12 (attIL12)-T cell therapy foreliminating large and heterogeneous solid tumors, J Immunother Cancer. 2022 Jan;10(1):e003633; Hombach A. et al., IL12 integrated into the CAR exodomainconverts CD8+ T cells to poly-functional NK-like cells with superior killingof antigen-loss tumors, Mol Ther. 2022 Feb 2;30(2):593-605; and Lee EH et al., Antigen-dependent IL-12 signaling in CAR T cells promotes regional tosystemic disease targeting, bioRxiv. 2023 Jan 7;2023.01.06.522784, each of which is incorporated herein by reference in its entirety.

[0149] The present disclosure provides a CAR with "substantial identity" or "substantial similarity" to a sequence provided herein. When referring to a nucleic acid or a fragment thereof, the term "substantial identity" or "substantially identical" indicates that when optimally aligned with another nucleic acid (or the complementary strand of another nucleic acid), there is a nucleotide sequence identity in %, for example, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% of nucleotide bases, as measured by any well-known sequence identity algorithm (such as FASTA, BLAST or GAP), as discussed below. In some cases, a nucleic acid molecule having substantial identity to a reference nucleic acid molecule can encode a polypeptide having the same or substantially similar amino acid sequence as a polypeptide encoded by a reference nucleic acid molecule.

[0150] When applied to polypeptides, the term "substantially similar" or "substantially similar" means that when performing optimal alignment (such as by using the program GAP or BESTFIT with default gap weights), two peptide sequences share at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% sequence identity. In some aspects, non-identical residue positions differ by conservative amino acid substitutions. "Conservative amino acid substitutions" are substitutions in which an amino acid residue is substituted by another amino acid residue with a side chain (R group) having similar chemical properties (e.g., charge or hydrophobicity). In general, conservative amino acid substitutions will not substantially change the functional properties of the protein. In the case where two or more amino acid sequences differ from each other in conservative substitutions, the percentage or degree of similarity can be adjusted upwards to correct the conservative nature of the substitution. Means for making such adjustments are well known to those skilled in the art. See, e.g., Pearson (1994) Methods Mol. Biol. 24: 307-331, which is incorporated herein by reference. Examples of amino acid groups with side chains of similar chemical properties include 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic-hydroxy side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: cysteine ​​and methionine. Preferred conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamic acid-aspartic acid, and asparagine-glutamine. Alternatively, a conservative substitution is any change with a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Science 256: 1443 45 (incorporated herein by reference). A "moderately conservative" substitution is any change with a non-negative value in the PAM250 log-likelihood matrix.

[0151] The sequence identity and / or similarity of polypeptide are measured using sequence analysis software usually. Protein analysis software uses the similarity measurement assigned to various replacements, disappearances and other modifications (comprising conservative amino acid substitutions) to match similar sequences. For example, GCG software contains programs such as GAP and BESTFIT, and the program can use default parameters to determine the sequence homology or sequence identity between closely related polypeptides (such as homologous polypeptides from different organism species), or between wild-type protein and its mutant protein. See, for example, GCG version 6.1. Peptide sequences can also be compared using FASTA (program in GCG version 6.1) utilizing default or recommended parameters. FASTA (for example, FASTA2 and FASTA3) provides comparison and sequence identity percentage (Pearson (2000) the same) of the best overlap region between query sequence and search sequence. Sequences can also be compared using the Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, a BLOSUM matrix of 62. When comparing the sequences disclosed herein to a database containing a large number of sequences from different organisms, another preferred algorithm is the computer program BLAST, particularly BLASTP or TBLASTN, using default parameters. See, e.g., Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and (1997) Nucleic Acids Res. 25: 3389-3402, each of which is incorporated herein by reference.

[0152] Additionally or alternatively, the parent CAR of the present disclosure may comprise at least one non-conservative amino acid substitution. In this case, the non-conservative amino acid substitution preferably does not interfere with or inhibit the biological activity of the parent CAR. The non-conservative amino acid substitution may enhance the biological activity of the modified CAR, so that the biological activity of the modified CAR is increased compared to the parent CAR.

[0153] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 45, a CAR polypeptide PL648 comprising the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, a FP2A cleavage domain, and an EGFP domain.

[0154] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 47, a CAR polypeptide PL1090 ​​comprising the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, a signal peptide, and an EGFRt domain.

[0155] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 49, a CAR polypeptide PL1093 comprising the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, a signal peptide, and a dnTGFβR2 domain.

[0156] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 51, a CAR polypeptide PL1106 comprising the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, a signal peptide, and a LTBR domain.

[0157] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 53, a CAR polypeptide PL1107 comprising the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0158] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 55, a CAR polypeptide PL1110 comprising the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, a FP2A signaling domain, and a LNGFRt domain.

[0159] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 57, a CAR polypeptide PL1179 comprising the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, a P2A cleavage domain, a signal peptide, and a dnTGFβR2 domain.

[0160] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 59, a CAR polypeptide PL1099 comprising the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, a P2A cleavage domain, a signal peptide, and a LNGFRt domain.

[0161] In any of the above-mentioned CAR polypeptides encoded by the isolated nucleic acid, the FP2A cleavage domain can be replaced by the P2A cleavage domain (or other cleavage domains), and vice versa. Additionally or alternatively, any of the above-mentioned CAR polypeptides may include R58W modifications.

[0162] In some embodiments, the nucleic acid encoding the PL648 CAR comprises the sequence of SEQ ID NO: 46.

[0163] In some embodiments, the nucleic acid encoding the PL1090 ​​CAR comprises the sequence of SEQ ID NO: 48.

[0164] In some embodiments, the nucleic acid encoding the PL1093 CAR comprises the sequence of SEQ ID NO: 50.

[0165] In some embodiments, the nucleic acid encoding the PL1106 CAR comprises the sequence of SEQ ID NO: 52.

[0166] In some embodiments, the nucleic acid encoding the PL1107 CAR comprises the sequence of SEQ ID NO: 54.

[0167] In some embodiments, the nucleic acid encoding the PL1110 CAR comprises the sequence of SEQ ID NO: 56.

[0168] In some embodiments, the nucleic acid encoding the PL1179 CAR comprises the sequence of SEQ ID NO: 58.

[0169] In some embodiments, the nucleic acid encoding the PL1099 CAR comprises the sequence of SEQ ID NO: 60.

[0170] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 61, a CAR polypeptide PL1092 comprising the following domains in order: a full-length CD27 domain comprising an R58W modification, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, and an EGFRt domain.

[0171] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 63, a CAR polypeptide PL1095 comprising the following domains in order: a full-length CD27 domain comprising an R58W modification, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, and an EGFP domain.

[0172] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 65, a CAR polypeptide 1109 comprising the following domains in order: a full-length CD27 domain comprising an R58W modification, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain.

[0173] In any of the above CAR polypeptides comprising R58W modification, the FP2A cleavage domain may be replaced by the P2A cleavage domain (or other cleavage domain). Additionally or alternatively, another additional polypeptide, such as dnTGFβR2, may replace EGFP or EGFRt.

[0174] In some embodiments, the nucleic acid encoding the PL1092 CAR comprises the sequence of SEQ ID NO: 62.

[0175] In some embodiments, the nucleic acid encoding the PL1095 CAR comprises the sequence of SEQ ID NO: 64.

[0176] In some embodiments, the nucleic acid encoding the PL1109 CAR comprises the sequence of SEQ ID NO: 66.

[0177] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 67, a CAR polypeptide PL1091 comprising the following domains in order: a truncated CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, a FP2A cleavage domain, and an EGFRt domain.

[0178] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 69, a CAR polypeptide PL1094 comprising the following domains in order: a truncated CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, a FP2A cleavage domain, and an EGFP domain.

[0179] In some embodiments, the isolated nucleic acid encodes SEQ ID NO: 71, a CAR polypeptide PL1108 comprising the following domains in order: a truncated CD27 domain, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain.

[0180] In any of the above CAR polypeptides comprising truncated CD27, the FP2A cleavage domain may be substituted with the P2A cleavage domain (or other cleavage domain). Additionally or alternatively, another additional polypeptide, such as dnTGFβR2, may replace EGFP or EGFRt.

[0181] In some embodiments, the nucleic acid encoding the PL1091 CAR comprises the sequence of SEQ ID NO: 68.

[0182] In some embodiments, the nucleic acid encoding the PL1094 CAR comprises the sequence of SEQ ID NO: 70.

[0183] In some embodiments, the nucleic acid encoding the PL1108 CAR comprises the sequence of SEQ ID NO: 72.

[0184] Table 1 summarizes representative CARs of the present disclosure and the associated SEQ ID NOs corresponding to the CAR amino acid sequences. Table 1 below summarizes additional sequences associated with the present disclosure.

[0185]

[0186] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide comprising the following domains in order: a protease-resistant CD27 comprising a CD8α hinge and a transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ intracellular signaling domain, as described in Leick et al., Cancer Cell (2022); 40: 1-15, the contents of which are incorporated herein by reference in their entirety). Other co-stimulatory and / or intracellular signaling domains as disclosed herein may additionally or alternatively be included in such a CAR polypeptide. In addition, other hinges and / or transmembrane domains are within the scope of the present disclosure for use in generating a CAR polypeptide comprising a protease-resistant CD27.

[0187] For example and not limited to, transmembrane domain can be derived from natural or synthetic sources. In the case of natural sources, domain can be derived from any membrane-bound protein or transmembrane protein. The transmembrane region used particularly in the present invention can be derived from (i.e. at least including the following transmembrane region) 4-1BB / CD137, activated NK cell receptors, immunoglobulins, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 or CD154, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3δ, CD3ε, CD3γ, CD3ζ, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8, CD8α, CD8β, CD96 (Tactile), CD11a, CD11b, CD11c, CD11d, CDS, CEACAM1, CRT AM, cytokine receptor, DAP10, DNAM1 (CD226), Fcγ receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Igα(CD79a), IL-2Rβ, IL-2Rγ, IL-7R α, inducible T cell co-stimulator (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGBl, KIRDS2, LAT, LFA-1, ligand that specifically binds to CD83, LIGHT, LTBR, ​​Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD11a / CD18), MHC class 1 molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signaling lymphocyte activation molecule (SLAM protein), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Ly108), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6 or fragments, truncations or combinations thereof.Alternatively, the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. Preferably, a triplet of phenylalanine, tryptophan and valine will be present at each end of the synthetic transmembrane domain.

[0188] For example and without limitation, hinge regions relevant to the present disclosure may be derived from the extracellular region of type 1 membrane proteins such as CD8α, CD8β, CD4, CD28, CD28T, 4-1BB and CD7, which may be the wild-type hinge region from these molecules or may be altered.

[0189] B. Expression of CAR Constructs

[0190] As used herein, isolated nucleic acid is intended to mean a DNA molecule that can be transformed or introduced into a host cell (preferably γδ T- cells) and transcribed and translated to produce a product (such as CAR as described herein). In the isolated nucleic acid of the present invention, the promoter is operably connected to the nucleic acid sequence encoding the CAR of the present invention, that is, their position promotes messenger RNA to be transcribed from the DNA encoding CAR. The term "operably connected" refers to the juxtaposition of the components described in this way in a relationship that allows them to function in their intended manner.

[0191] The promoter may be genomic or synthetically produced. A variety of promoters used in host cells related to the present disclosure are well known in the art (e.g., Marodon et al. (2003) Blood 101 (9): CD4 promoter disclosed in 3416-23). ​​The promoter may be constitutive or inducible, wherein induction is associated with a specific cell type or a specific maturity level. Alternatively, many well-known viral promoters may also be suitable. Promoters of interest include β-actin promoters, SV40 early and late promoters, immunoglobulin promoters, human cytomegalovirus promoters, retroviral promoters, and Friend spleen lesion formation virus promoters. The promoter may be associated or not associated with an enhancer, wherein the enhancer may be naturally associated with a specific promoter or associated with a different promoter. In an embodiment, the expression of the CAR polypeptide is controlled by an inducible promoter (e.g., a promoter induced by a molecule (e.g., TGFβ) present in the tumor microenvironment).

[0192] The open reading frame sequences encoding the various segments of the CAR of the present disclosure may be obtained from a genomic DNA source, a cDNA source, or may be synthesized (e.g., via PCR), or a combination thereof.

[0193] In embodiments, to express the CAR of the present invention, the naturally occurring or endogenous transcription initiation region of the nucleic acid sequence encoding the N-terminal component of CD27 can be used to produce CAR in a host cell. Alternatively, an exogenous transcription initiation region allowing constitutive or inducible expression can be used, wherein expression can be optionally controlled according to the host cell, the desired expression level, the properties of the host cell, etc.

[0194] A termination region encoding the C-terminal component of the CAR may be included. In general, the source of the termination region is considered unimportant for the expression of the recombinant protein, and a variety of termination regions may be used without adversely affecting expression.

[0195] The nucleic acid encoding the separation of CAR according to the present invention can be prepared in a conventional manner. The sequence (natural or synthetic) is separated and operated as needed to allow each component to be correctly joined. Therefore, various nucleic acid sequences encoding each segment of CAR can be separated, for example, by using polymerase chain reaction (PCR), using appropriate primers. If necessary, specific primers can be designed, which lead to the deletion of undesirable parts in the nucleic acid sequence used as a template. Additionally or alternatively, the restriction digestion of cloned genes can be used to generate the isolated nucleic acid construct disclosed herein. In either case, the sequence can be selected to provide a restriction site with a flat end, or the sequence can have a complementary overlap to facilitate incorporation into various vectors. In an example, the nucleic acid sequence is modified (for example, one or more point mutations, insertions or deletions are introduced). In one embodiment of CAR disclosed herein, the modification may, for example, include SEQ ID NO: 35 R58 position amino acid changes. Methods for introducing modifications into nucleic acid sequences are known in the art, and may include the use of various commercially available kits (for example, QuickChange site-directed mutagenesis kits, Agilent, Santa Clara, CA).

[0196] Various operations for preparing isolated nucleic acids encoding the CAR disclosed herein can be performed in vitro. In a specific embodiment, a sequence encoding CAR is introduced into a vector using a standard transformation or transfection method so as to be cloned and expressed in an appropriate host cell. Therefore, after each operation, the construct obtained by joining the DNA sequence is cloned, the vector is separated, and the sequence is screened to ensure that the sequence encodes the desired CAR. The sequence can be screened by restriction analysis, sequencing, and the like.

[0197] It is contemplated that the isolated nucleic acid can be introduced into a host cell as naked DNA or in a suitable vector. Many suitable vectors are known to molecular biologists, and the selection of the vector depends on the desired function, and includes other vectors conventionally used in plasmids, cosmids, viruses, phages, and genetic engineering. Methods well known to those skilled in the art can be used to construct various plasmids and vectors; see, for example, Sambrook et al. (1989) and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NY (1989), (1994) described in technology. Alternatively, the polynucleotides and vectors of the present disclosure can be reconstructed into liposomes for delivery to target cells.

[0198] Methods for stably transfecting host cells using naked DNA by electroporation are known in the art (see, e.g., U.S. Patent No. 6,410,319, which discloses T cell transfection). Naked DNA generally refers to the DNA encoding the CAR of the present invention contained in a plasmid expression vector in an orientation suitable for expression. Advantageously, the use of naked DNA reduces the time required to produce host cells expressing the CAR of the present invention.

[0199] Alternatively, a viral vector (e.g., a retroviral vector, an adenoviral vector, an adeno-associated viral vector or a lentiviral vector) can be used to introduce the isolated nucleic acid encoding the CAR of the present invention into a host cell. Suitable vectors used according to the method of the present invention cannot replicate in T cells. A variety of viral-based vectors are known, wherein the viral copy number maintained in the cell is low enough to maintain the viability of the cell. Illustrative vectors include pFB novel vectors (STRATAGENE®) and vectors based on HIV, SV40, EBV, HSV or BPV.

[0200] Therefore, it is understood that in some embodiments, the isolated nucleic acid is a circular nucleic acid. In some embodiments, the isolated nucleic acid is a vector, such as a plasmid vector, an adenoviral vector, an adeno-associated viral vector, a viral vector, a retroviral vector (e.g., a γ retroviral vector) or a lentiviral vector. In some embodiments, the isolated nucleic acid or, for example, a continuous portion thereof, is integrated into the genome of a host cell (such as a host γδT cell). In an exemplary embodiment, the isolated nucleic acid is a retroviral vector.

[0201] C. γδ T cells

[0202] Aspects of the invention include γδ T cells that functionally express the isolated nucleic acid described herein and thereby express a CAR on the surface of said γδ T cells.

[0203] Aspects of the present invention may additionally or alternatively include γδ T cells with in vitro or in vivo cytotoxic activity for blood and / or solid tumor cells expressing cell surface of CD70. In some cases, cytotoxic activity is innate activity. In some cases, cytotoxicity is at least partially, significantly (> about 25%) or completely due to the presence of a CAR construct with a binding domain that specifically binds to CD70 expressed on the surface of blood and / or solid tumor cells. In some cases, the blood and / or solid tumor cell killing activity exhibited by γδ T cells is greater than the innate level of in vitro and / or in vivo blood and / or solid tumor cell killing activity in control γδ T cells. In some cases, the control γδ T cells do not include a CAR construct. In some cases, the control γδ T cells include a CAR construct lacking one or more binding domains described herein, a hinge region described herein, a transmembrane domain described herein, an intracellular signaling domain described herein, and / or a co-stimulatory domain described herein.

[0204] In some cases, the cytotoxicity is at least partially, significantly (> about 25%), or entirely due to the presence of a CAR construct having a binding domain that specifically binds to CD70 or an epitope within CD70. In some cases, the γδ T cells functionally express a CD70-specific CAR encoded by an isolated nucleic acid described herein.

[0205] γδ T cells described herein may exhibit robust and / or sustained blood and / or solid tumor cell killing activity. In some cases, blood and / or solid tumor cell killing activity may be sustained for at least about 6 days to about 120 days, or for at least about 6 days to about 180 days, from the first contact with blood and / or solid tumor cells, or from the administration of γδ T cells described herein, the blood and / or solid tumor cell killing activity of γδ T cells described herein or their progeny may be sustained for at least about 6 days to about 120 days, or for at least about 6 days to about 180 days. This sustained blood and / or solid tumor cell killing activity may be performed in vitro, in vivo, or in vitro and in vivo simultaneously.

[0206] Aspects of the invention may additionally or alternatively include γδ T cells that proliferate in response to contact with cells that exhibit cell surface expression or overexpression of CD70. Cells that exhibit cell surface expression of CD70 may be activated immune cells (Bowman et al., J. Immunol. (1994); 152: 1756-1761; Nolte et al., Immunol Rev. (2009); 229: 216-231), thymic medullary stromal cells, and antigen presenting cells (Keller et al., Proc Nat Acad Sci USA. (2007); 104: 5989–94; Borst et al., Curr Opin Immunol. (2005); 17: 275-81; Hendriks et al., J. Immunol. (2005); 175: 1665-76). Cells that exhibit cell surface expression or overexpression of CD70 can be blood (Flieswasser et al., Cancers. (2019); 11) and / or solid tumor cells (Pahl et al., Cancer Cell Int. (2015); 15: 31; Jilaveanu et al., Hum Pathol. (2012); 43: 1394–9; Hishima et al., Int J Cancer. (2002); 98: 352–6; Burvenich et al., Theranostics. (2018); 8: 4199–209). In some cases, proliferation is an innate activity. In some cases, proliferation is at least partially, significantly (> about 20% or > about 25%), or entirely due to the presence of a CAR construct having a binding domain that specifically binds to CD70 expressed on the surface of a cell, such as a blood and / or solid tumor cell. In some cases, the γδ T cells exhibit a higher level of proliferation in vitro and / or in vivo compared to control γδ T cells. In some cases, the control γδ T cells do not comprise a CAR construct. In some cases, the control γδ T cells comprise a CAR construct lacking a binding domain as described herein, a hinge region as described herein, a transmembrane domain as described herein, an intracellular signaling domain as described herein, and / or a co-stimulatory domain as described herein.

[0207] In some cases, the proliferation is at least partially, significantly (> about 20 or > about 25%), or entirely due to the presence of a CAR construct having a binding domain that specifically binds to CD70 or an epitope within CD70. In some cases, the γδ T cells that exhibit proliferation in response to contact with cells (e.g., blood and / or solid tumor cells that exhibit cell surface expression of CD70) functionally express a CD70-specific CAR encoded by an isolated nucleic acid described herein.

[0208] The γδ T cells described herein exhibit robust and / or sustained proliferation in a host organism comprising cells (e.g., blood and / or solid tumor cells) that exhibit cell surface expression or overexpression of CD70. In some cases, proliferation can last for at least about 6 days to about 120 days, or for at least about 6 days to about 180 days, from the first contact with CD70-expressing cells (e.g., blood and / or solid tumor cells), or from the date of administration of the γδ T cells to the host organism. In some cases, proliferation of the γδ T cells described herein or their progeny in a host organism comprising blood and / or solid tumor cells that exhibit cell surface expression or overexpression of CD70 can last for at least about 6 days to about 120 days, or for at least about 6 days to about 180 days, from the first contact with CD70-expressing cells (e.g., blood and / or solid tumor cells), or from the first administration of the γδ T cells to the host organism. In some cases, the proliferation in the host organism is at least partially, significantly (> about 20% or > about 25%), or entirely due to the presence of a CAR construct having a binding domain that specifically binds to CD20 or an epitope within CD20. In some cases, the γδ T cells that exhibit proliferation in a host organism comprising cells (e.g., blood and / or solid tumor cells that exhibit cell surface expression of CD70) functionally express a CD70-specific CAR encoded by an isolated nucleic acid described herein.

[0209] In some embodiments, the γδ T cells described herein express or continue to express proinflammatory cytokines such as, but not limited to, tumor necrosis factor alpha or interferon gamma after contact with CD70-expressing cells (e.g., blood and / or solid tumor cells). In some embodiments, the γδ T cells described herein, or their progeny, express or continue to express proinflammatory cytokines such as tumor necrosis factor alpha or interferon gamma after contact with CD70-expressing cells (e.g., in a host organism comprising CD70-expressing blood and / or solid tumor cells).

[0210] In some embodiments, when introduced into an allogeneic host, γδ T cells or a pharmaceutical composition containing γδ T cells do not substantially show or do not show a graft-versus-host reaction. In some embodiments, when introduced into an allogeneic host, the γδ T cells or a pharmaceutical composition containing the γδ T cells show a clinically acceptable level of graft-versus-host reaction. In some embodiments, a clinically acceptable level is the amount of graft-versus-host reaction that does not require stopping γδ T cell therapy to achieve therapeutically effective treatment. In some embodiments, according to the applicable International Bone Marrow Transplant Registry (IBMTR) grading scale, a clinically acceptable level of graft-versus-host reaction (GvHD) is an acute reaction that is less severe than grade C. The severity of the acute graft-versus-host reaction is determined by assessing the extent of involvement of the skin, liver, and gastrointestinal tract. The stages of involvement of each organ are combined to produce an overall score, which has prognostic significance. Grade I (A) GvHD is characterized as mild disease, grade II (B) GvHD is characterized as moderate, grade III (C) is characterized as severe, and grade IV (D) is life-threatening. The IBMTR grading system defines the severity of acute GvHD as follows (Rowlings et al., Br J Haematol 1997;97:855):

[0211] ● Grade A – Stage 1 skin involvement only (maculopapular rash on <25% of the body), without liver or gastrointestinal involvement

[0212] ● Grade B – Stage 2 skin involvement; Stage 1 to 2 intestinal or liver involvement

[0213] ● Grade C – Stage 3 with involvement of any organ system (generalized erythroderma; bilirubin 6.1 to 15.0 mg / dL; diarrhea 1500 to 2000 mL / day)

[0214] ● Grade D – Stage 4 with involvement of any organ system (generalized erythroderma with bullous formation; bilirubin >15 mg / dL; diarrhea >2000 mL / day or pain or intestinal obstruction).

[0215] See also Schoemans et al., Bone Marrow Transplantation Vol. 53, pp. 1401–1415 (2018), e.g., at Tables 1 and 2, which reference discloses criteria for assessing and grading acute GvHD.

[0216] In some embodiments, the γδ T cells or pharmaceutical compositions containing the γδ T cells exhibit a reduced or significantly reduced graft-versus-host reaction when introduced into an allogeneic host compared to a graft-versus-host reaction exhibited by a control αβ T cell or a control pharmaceutical composition comprising the control αβ T cell administered to an allogeneic host. In some cases, the control αβ T cell is an allogeneic non-engineered control αβ T cell. In some cases, the control αβ T cell does not comprise a CAR or does not comprise the same CAR as the reference γδ T cell.

[0217] The γδ T cells described herein can be δ1, δ2, δ3, or δ4 γδ T cells, or a combination thereof. In some cases, the γδ T cells are predominantly (>50%), substantially (>90%), essentially all, or completely δ2 - γδ T cells. In some cases, the γδ T cells are predominantly (>50%), substantially (>90%), substantially all, or completely δ1 γδ T cells.

[0218] In some embodiments, the γδ T cells described herein may be modified to include one or more gene editing. The gene editing discussed herein is a genetic engineering in which nucleotides / nucleic acids are inserted, deleted, and / or replaced in a DNA sequence (such as the genome of γδ T cells). Targeted gene editing can be inserted, deleted, and / or replaced at a pre-selected site in the target cell genome. When the endogenous gene sequence is edited, for example, by deleting, inserting, or replacing nucleotides / nucleic acids, the endogenous gene containing the affected sequence can be knocked out or knocked down due to sequence changes. Therefore, targeted editing can be used to destroy endogenous gene expression. The "destroyed gene" discussed herein refers to a gene that includes insertion, deletion, or substitution relative to an endogenous gene, so that the expression of a functional protein from an endogenous gene is reduced or suppressed. As used herein, "destroying a gene" refers to inserting, deleting, or replacing at least one nucleotide / nucleic acid in an endogenous gene, so that the expression of a functional protein from an endogenous gene is reduced or suppressed. The method of destroying a gene is known to those skilled in the art, and is described in, for example, U.S. Patent No. 11254912, which is incorporated herein by reference as a whole.

[0219] In embodiments, the targeted gene editing of T cells can be performed using a nuclease-dependent method. This nuclease-dependent method can achieve targeted editing by introducing double-strand breaks (DSBs) by specific endonucleases. This nuclease-dependent targeted editing utilizes DNA repair mechanisms, such as non-homologous end joining (NHEJ), which occurs in response to DSBs. Repairing DNA by NHEJ usually results in random insertion or deletion (indel) of a small amount of endogenous nucleotides. In contrast to the repair mediated by NHEJ, repair can also occur by homology-directed repair (HDR). When containing exogenous genetic material, a donor template with a pair of homologous arms on both sides exists, exogenous genetic material can be introduced into the genome by HDR, which results in targeted integration of exogenous genetic material. Available endonucleases that can introduce specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided CRISPR-Cas9 nucleases (CRISPR / Cas9; Clustered Regularly Interspaced Short Palindromic Repeats Related to 9). It is discussed herein that a CRISPR system or CRISPR nuclease system may include a non-coding RNA molecule that binds DNA (e.g., a guide RNA) and a Cas protein (e.g., Cas9) that has nuclease functionality (Sander et al., Nature Biotechnology (2014); 32:347-355; Hsu et al., Cell (2014); 157(6):1262-1278).

[0220] In embodiments, the γδ T cells comprise one or more disrupted genes. For example, the one or more genes whose expression is disrupted may include adenosine A2a receptor (ADORA), CD276, V-group domain containing inhibitor of T cell activation 1 (VTCN1), B and T lymphocyte-associated (BTLA), cytotoxic T lymphocyte-associated protein 4 (CTLA4), indoleamine 2,3-dioxygenase 1 (IDO1), killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail,1 (KIR3DL1), lymphocyte activation gene 3 (LAG3), programmed cell death 1 (PD-1), hepatitis A virus cell receptor 2 (HAVCR2), V-domain immunoglobulin inhibitor of T cell activation (VISTA), natural killer cell receptor 2B4 (CD244), cytokine-induced SH2-containing protein (CISH), hypoxanthine phosphoribosyltransferase 1 (HPRT), adeno-associated virus integration site (AAVSSITE (e.g., AAVS1, AAVS2, etc.)), or chemokine (C—C motif) receptor 5 (gene / pseudogene) (CCR5), CD160 molecule (CD160), T cell immune receptor with Ig and ITIM domains (TIGIT), CD96 molecule (CD96), cytotoxic and regulatory T cell molecule (CRTAM), leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), sialic acid-binding Ig-like lectin 7 (SIGLEC7), sialic acid-binding Ig-like lectin 9 (SIGLEC9), tumor necrosis factor receptor superfamily member 10b (TNFRSF10B), tumor necrosis factor receptor superfamily member 10a (TNFRSF10A), caspase 8 (CASP8), caspase 10 (CASP10), caspase 3 (CASP3), caspase 6 (CASP6), caspase 7 (CASP7), Fas-associated death domain (FADD), Fas cell surface death receptor (FAS), transforming growth factor beta receptor II (TGFBRII), transforming growth factor beta receptor I (TGFBR1), SMAD family member 2 (SMAD2), SMAD family member 3 (SMAD3), SMAD family member 4 (SMAD4), SKI proto-oncogene (SKI), SKI-like proto-oncogene (SKIL), TGFB-inducing factor homeobox 1 (TGIF1), interleukin 10 receptor subunit alpha (IL10RA), interleukin 10 receptor subunit beta (IL10RB), heme oxygenase 2 (HMOX2), interleukin 6 receptor (IL6R), interleukin 6 signal transducer (IL6ST), c-src tyrosine kinase (CSK), phosphoprotein membrane anchor with glycosphingolipid microdomain 1 (PAG1), signaling threshold regulatory transmembrane adaptor 1 (SIT1), forkhead box P3 (FOXP3), PR domain 1 (PRDM1), basic leucine zipper transcription factor,ATF-like (BATF), soluble guanylate cyclase 1 alpha 2 (GUCY1A2), soluble guanylate cyclase 1 alpha 3 (GUCY1A3), soluble guanylate cyclase 1 beta 2 (GUCY1B2), soluble guanylate cyclase 1 beta 3 (GUCY1B3), cytokine-induced SH2-containing protein (CISH), prolyl hydroxylase domain (PHD1, PHD2, PHD3) protein family, Cbl proto-oncogene B (CBL-B), zinc finger protein 91 (ZFP91), Roquin, CD58, ICAM-1, or any combination thereof. ,

[0221] In a preferred embodiment, the gene whose expression is destroyed is CISH, i.e., a negative regulator of TCR signaling. Destruction of the CISH gene can provide functional advantages relative to control cells with a complete CISH gene, improve sensitivity to certain cytokines (e.g., IL-2 / IL-15), increase T cell proliferation and / or limit T cell exhaustion. In some examples, the CISH gene can be destroyed by the method described in Daher M et al., Targeting a cytokine checkpoint enhances the fitness of armored cord blood CAR-NK cells, Blood. February 4, 2021; 137 (5): 624-636, which is incorporated herein by reference as a whole. In one example, the CISH gene is destroyed by gene editing using a CRISPR-Cas system, the CRISPR-Cas system comprising one or more guide RNAs comprising a sequence of any one of SEQ ID NOs: 87-90. In another example, the CISH gene is disrupted by gene editing using a CRISPR-Cas system comprising one or more guide RNAs comprising a sequence of any one of SEQ ID NOs: 96-97.

[0222] In embodiments, the gene whose expression is disrupted is CBL-B, a negative regulator of T cell activation. Disruption of the CBL-B gene can provide a functional advantage in enhancing T cell activation relative to control cells with an intact CBL-B gene. In some examples, the CBL-B gene can be disrupted by the methods described in Augustin R. et al., Targeting Cbl-b in cancer immunotherapy, J Immunother Cancer. 2023 Feb;11(2):e006007; Hooper K. et al., Knockout of CBLB Greatly Enhances Anti-Tumor Activity of CAR T Cells, Blood (2018) 132 (Supplement 1): 338; and Guo X. et al., CBLB ablation with CRISPR / Cas9 enhances cytotoxicity of human placental stem cell-derived NK cells for cancer immunotherapy, J Immunother Cancer. 2021 May;9(3):e001975, which are incorporated herein by reference in their entirety. In one example, the CBL-B gene is disrupted by gene editing using a CRISPR-Cas system comprising one or more guide RNAs comprising a sequence of any one of SEQ ID NOs: 93-95.

[0223] In an embodiment, the gene whose expression is disrupted is Roquin (e.g., Roquin-1). The disruption of the Roquin gene can provide functional advantages in increasing T cell proliferation and enhancing antitumor activity relative to control cells with intact Roquin genes. In some examples, the Roquin gene can be disrupted by the method described in Mai D et al., Combined disruption of T cell inflammatory regulators Regnase-1 and Roquin-1 enhances antitumor activity of engineered human T cells, Proc Natl Acad Sci USA. 2023 May 21; 120(12): e2218632120, which is incorporated herein by reference in its entirety.

[0224] In embodiments, the gene whose expression is disrupted is ZFP91. The destruction of the ZFP91 gene can provide functional advantages in improving T glycolysis adaptability and effector function relative to control cells with intact ZFP91 genes. In some examples, the ZFP91 gene can be destroyed by the method described in Wang F. et al., J Clin Invest. October 1, 2021; 131 (19): e144318, which is incorporated herein by reference as a whole. In embodiments, the gene whose expression is disrupted is CD58. In embodiments, the gene whose expression is disrupted is ICAM-1. In some embodiments, both CD58 and ICAM-1 are disrupted. The destruction of CD58 and / or ICAM-1 genes can provide functional advantages in destroying T cell adhesion and costimulatory interactions to reduce host-versus-graft allogeneic cytotoxicity relative to control cells with intact CD58 and / or ICAM-1 genes. In one example, the ICAM-1 gene can be destroyed as described in Teo HY et al. IL12 / 18 / 21 Preactivation Enhances theAntitumor Efficacy of Expanded γδT Cells and Overcomes Resistance to Anti-PD-L1 Treatment, Cancer Immunol Res. 2023 July 5; 11(7): 978-999, which is incorporated herein by reference in its entirety. In one example, the ICAM-1 gene is destroyed by gene editing using an RNA-guided nuclease system (e.g., CRISPR-Cas or CRISPR-Mad7 system), wherein the RNA-guided nuclease system comprises one or more guide RNAs comprising a sequence of any one of SEQ ID NOs: 103-104. In one example, the CD58 gene is disrupted by gene editing using an RNA-guided nuclease system (e.g., a CRISPR-Cas or CRISPR-Mad7 system), wherein the RNA-guided nuclease system comprises one or more guide RNAs comprising a sequence of any one of SEQ ID NOs: 105-106.

[0225] γδ T cells can be obtained from allogeneic or autologous donors. γδ T cells can be partially or completely purified, or not purified, and expanded in vitro. Methods and compositions for ex vivo expansion include, but are not limited to, those described in WO 2017 / 197347. Amplification can be performed before or after, or before and after, the CAR construct is introduced into the γδ T cells.

[0226] In some embodiments, γδ T cells may be modified to include a nucleic acid construct encoding a protein that confers the desired function of the γδ T cells of the present disclosure. For example and without limitation, such nucleic acids may encode chimeric DAP10 adapter polypeptides, such as described in U.S. Provisional Application No. 63 / 272,613 and U.S. Provisional Application No. 63 / 347,194, the contents of each of which are hereby expressly incorporated herein by reference in their entirety. In some embodiments, chimeric DAP10 adapter polypeptides are capable of associating with chimeric antigen receptors of the present disclosure, such as CARs of the present disclosure may include DAP10 interaction domains. In additional or alternative examples, chimeric DAP10 adapter polypeptides may not associate with CARs of the present disclosure, but may interact with endogenous or exogenous polypeptides including DAP10 interaction domains.

[0227] The γδ T cells described herein can be stored, e.g., cryopreserved, for use in adoptive cell transfer.

[0228] D. Methods of Inhibiting or Killing CD70-Expressing Cells

[0229] In a broad sense, the cells targeted by the CAR disclosed herein can be various cells comprising CD70 antigens, including cancer cells. In a specific embodiment, the cancer cell is a blood malignant cell. In a specific embodiment, the cancer cell is a solid malignant cell. In certain aspects, the cancer cell is, for example, a lymphoma cell, a renal cell carcinoma cell, or a glioblastoma cell. In some aspects, the cancer cell is, for example, a HTLV-1-related malignant cell or an EBV-related malignant cell. In a specific embodiment, the cancer cell is CD70 positive. In a specific embodiment, the cancer treated is renal cell carcinoma, thymic carcinoma, nasopharyngeal carcinoma, brain tumor, Hodgkin's lymphoma and non-Hodgkin's lymphoma, Waldenstrom'smacroglobulinemia, chronic lymphocytic leukemia, T-cell leukemia, multiple myeloma, EBV and HTLV-I related malignancies, renal cancer, pancreatic cancer, laryngeal cancer, pharyngeal cancer, melanoma, ovarian cancer, lung cancer (including lung adenocarcinoma), colon cancer, breast cancer or brain cancer.

[0230] In specific embodiments of the invention, T cells comprising a chimeric receptor target any cell comprising the CD70 antigen, whether or not the targeted cell is cancerous. For example, in some embodiments, CD70 is expressed on cells associated with an autoimmune disorder, such as in certain aspects related to the invention, where there is a CD70-CD27 costimulatory disorder that leads to autoimmunity. In specific embodiments, CD70 cells are present in individuals with autoimmune disorders such as rheumatoid arthritis (RA), arthritis (including psoriatic arthritis), inflammation, autoimmune encephalitis, inflammatory bowel disease, colitis, and lupus.

[0231] One or more non-engineered γδ T cell populations, engineered γδ T cell populations, and / or mixtures thereof having toxic activity against CD70-expressing cells (e.g., blood and / or solid tumor cells expressing CD70) can be administered to a subject in any order or simultaneously. If administered simultaneously, the various non-engineered γδ T cell populations, engineered γδ T cell populations, and / or mixtures thereof of the present invention can be provided in a single, unified form (such as intravenous injection), or in multiple forms (e.g., as multiple intravenous infusions, subcutaneous injections, or pills). The non-engineered γδ T cell populations, engineered γδ T cell populations, and / or mixtures thereof of the present invention can be packaged together in a single package or separately in multiple packages. One or all of the non-engineered γδ T cell populations, engineered γδ T cell populations, and / or mixtures thereof of the present invention can be administered in multiple doses. If not administered simultaneously, the timing between multiple doses can vary up to about one week, one month, two months, three months, four months, five months, six months, or about one year. In some cases, after being administered to a subject, the non-engineered enriched γδ T cell populations, engineered enriched γδ T cell populations, and / or mixtures thereof of the present invention may be propagated in vivo in the subject's body. One or more non-engineered γδ T cell populations, one or more engineered γδ T cell populations, and / or mixtures thereof may be frozen to provide cells for multiple treatments using the same cell preparation. One or more non-engineered γδ T cell populations, one or more engineered γδ T cell populations, and / or mixtures thereof of the present disclosure, and pharmaceutical compositions comprising them may be packaged as a kit. The kit may include non-engineered γδ T cell populations, engineered γδ T cell populations, and / or mixtures thereof, and instructions for use (e.g., written instructions) for compositions comprising them.

[0232] In some cases, a method of treating a CD70-expressing disorder comprises administering to a subject a therapeutically effective amount of a non-engineered γδ T cell population, an engineered γδ T cell population, and / or a mixture thereof, wherein the administration treats a CD70-expressing disease or disorder (e.g., cancer). In some embodiments, a therapeutically effective amount of a non-engineered γδ T cell population, an engineered γδ T cell population, and / or a mixture thereof is administered for at least about 10 seconds, 30 seconds, 1 minute, 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, δ hours, 12 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, δ days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or 1 year. In some embodiments, a therapeutically effective amount of a non-engineered γδ T cell population, an engineered γδ T cell population, and / or a mixture thereof is administered for at least one week. In some embodiments, a therapeutically effective amount of a non-engineered γδ T cell population, an engineered γδ T cell population, and / or a mixture thereof is administered for at least two weeks.

[0233] The non-engineered γδ T cell populations, engineered γδ T cell populations, and / or mixtures thereof described herein can be administered before, during, or after the onset of a disease or condition, and the timing of administering a pharmaceutical composition containing the γδ T cell population can vary. For example, the γδ T cell population can be used as a prophylactic and can be continuously administered to a subject with a condition or disease tendency in order to reduce the likelihood of the disease or condition occurring. The initial administration can be performed via any practical route, such as using any formulation described herein by any route described herein. In some examples, the administration of the γδ T cell population of the present disclosure is intravenous administration. For example, one or more doses of the γδ T cell population can be administered as soon as feasible after the onset of a CD70-expressing cancer, and continue to treat the disease for the length of time required, such as, for example, about 24 hours to about 48 hours, about 48 hours to about 1 week, about 1 week to about 2 weeks, about 2 weeks to about 1 month, about 1 month to about 3 months. In some embodiments, one or more doses of the γδ T cell population can be administered several years after the onset of the cancer and before or after other treatments.

[0234] In some embodiments, the γδ T cell population is administered simultaneously or sequentially with one or more methods for increasing shared γ chain cytokines. As used herein, "one or more methods for increasing shared γ chain cytokines" refers to a method or combination of methods for changing the physiological state of a subject so that at least one shared γ chain cytokine level in a subject is increased. In some embodiments, the method increases the level of one or more shared γ chain cytokines selected from the group consisting of IL-2, IL-7 and IL-15, preferably wherein the method increases the level of IL-15 in the subject. In some embodiments, the method includes lymphocyte depletion. In some embodiments, the method includes administering one or more shared γ chain cytokines to the subject. In some cases, IL-2, IL-7 and / or IL-15, preferably IL-15, are administered. In some embodiments, the method includes secreting shared γ chain cytokines from, for example, γδ T cells administered. In some cases, IL-2, IL-7 and / or IL-15, preferably IL-15, are secreted.

[0235] In some embodiments, the method of administering one or more methods of increasing shared γ chain cytokines includes lymphocyte depletion before the introduction of the γδ T cells. In some embodiments, the method of administering one or more methods of increasing shared γ chain cytokines includes administering a shared γ chain cytokine in an amount that effectively increases the proliferation, cytotoxic activity, persistence, or a combination thereof of the introduced γδ T cells simultaneously or sequentially with the introduction of the γδ T cells, preferably wherein the method includes administering IL-2 or one or more mimetics thereof, more preferably wherein the method includes administering IL-15 or one or more mimetics thereof. The amount of shared γ chain cytokine administered can be an amount that effectively increases the proliferation, cytotoxic activity, persistence, or a combination thereof of the introduced γδ T cells before and / or after the introduction of the γδ T cells. Exemplary amounts of IL-15 include, but are not limited to, IL-15 between 0.01-10 µg / kg / dose per 24 hours. Exemplary amounts of IL-2 include, but are not limited to, about 3x10 6 and about 22x10 6 For example, the dosing regimen for IL2 in RCC is 600,000 International Units / kg (0.037 mg / kg) IV q8hr infused over 15 minutes for a maximum of 14 doses.

[0236] In some embodiments, the method of administering one or more methods of elevating common γ chain cytokines comprises administering lymphodepletion of common γ chain cytokines in an amount effective to increase proliferation, cytotoxic activity, persistence, or a combination thereof of the introduced γδ T cells prior to administering the γδ T cells and concurrently or sequentially with the introduction of the γδ T cells.

[0237] The γδ T cells of the present invention may also be advantageously administered to a subject in combination with (e.g., before, simultaneously with, or after) any number of related treatment modalities (including, e.g., chemotherapy, radiotherapy, or immunotherapy) (e.g., for the treatment of cancer). Patients may also be preconditioned with a therapeutically effective amount of γδ T cells prior to receiving chemotherapy, radiotherapy, or immunotherapy (e.g., cell therapy). Immunotherapies suitable for use in combination with γδ T cells include autologous and allogeneic cell therapies, engineered T and NK cells, immunoconjugates, fusion proteins, or other immuno-oncology agents.

[0238] In some embodiments, γδ T cells may be co-administered with appropriate cellular immunotherapy (e.g., CAR T or CAR NK cells or Treg therapy) for treating diseases such as cancer. For example, a treatment method according to the present invention (e.g., for treating cancer) may include administering a therapeutically effective amount of γδ T cells to a subject simultaneously or sequentially while administering a cellular immunotherapy for a disease (e.g., cancer), such as a pre-conditioning step. In embodiments, cellular immunotherapy may include further administering an engineered T cell or NK cell therapy comprising a CAR bound to any tumor-associated antigen of interest. In embodiments, a subject's γδ T cells may include a dual CAR bound to CD70 and another tumor-associated antigen.

[0239] In an embodiment, the γδ T cells of the present invention may be advantageously administered in combination with adoptive cell therapy (ACT) (for reviews of HSCT and adoptive cell therapy approaches, see Rager and Porter, Ther Adv Hematol (2011) 2(6) 409-428; Roddie and Peggs, Expert Opin. Biol. Ther. (2011) 11(4):473-487; Wang et al. Int. J. Cancer: (2015)136, 1751-1768; and Chang, YJ and XJ Huang, Blood Rev, 2013. 27(1): 55-62), each of which is incorporated herein by reference in its entirety. Such adoptive cell therapy includes, but is not limited to, allogeneic and autologous hematopoietic stem cell transplantation, donor leukocyte (or lymphocyte) infusion (DLI), adoptive transfer of tumor-infiltrating lymphocytes, or adoptive transfer of T cells or NK cells (including recombinant cells, e.g., CAR T, CAR NK). In addition to the necessity of donor-derived cells to reconstruct hematopoiesis after radiotherapy and chemotherapy, immune reconstruction of transferred cells is very important for eliminating residual tumor cells. The efficacy of ACT as a curative choice for malignant tumors is affected by a variety of factors, including the source, composition and phenotype (lymphocyte subsets, activation state) of donor cells, underlying diseases, pre-transplant conditioning regimens and post-transplant immune support (e.g., IL-2 therapy), and graft-versus-tumor (GVT) effects mediated by donor cells in the transplant. In addition, these factors can be balanced with transplant-related mortality, usually caused by conditioning regimens and / or excessive immune activity of donor cells in the host (i.e., graft-versus-host disease, cytokine release syndrome, etc.).

[0240] E. CAR detection method

[0241] The quantification of CAR transgenic levels in the host cells of the present disclosure can be achieved in a variety of ways. Examples include, but are not limited to, genome detection (e.g., quantitative PCR, digital PCR), transcriptome detection (e.g., RNA sequencing, RNA in situ hybridization), proteome detection (e.g., fluorescence microscopy) and organism detection (e.g., positron emission tomography (PET) scanning, two-photon microscopy) and various combinations thereof.

[0242] As described above, in embodiments, the isolated nucleic acid encoding the CAR polypeptide may include one or more tags or markers to facilitate the ability to monitor CAR expression levels. However, it is recognized herein that, considering the increased molecular weight of the resulting CAR, including a tag or marker (e.g., LNGFR) may have an adverse effect on viral titer levels, especially when other polypeptides are also associated with CAR (e.g., dnTGFβR2). Other additional or alternative methods, such as those that rely on vector copy number (VCN), also have disadvantages, including but not limited to the ratio of VCN to CAR, which may require a lot of process development time and may change during scale-up / process improvement.

[0243] In one embodiment, the quantification of CAR can be determined via immunological detection of the joint region (e.g., T2A, P2A, E2A, F2A), such as coupling the CD27 domain followed by one or more costimulatory and / or intracellular domains to the cleavage joint region of an additional polypeptide (e.g., dnTGFβR2). The advantage of this method is that the joint region is directly coupled to the CAR, and intracellular C-terminal detection of the CAR can be achieved. For example and without limitation, antibodies that can be used to detect 2A peptides include anti-2A (3H4) (Novus Biologicals, Littleton, CO).

[0244] For 2A peptides, the self-cleavage mechanism is the result of the ribosome skipping the formation of the glycyl-prolyl peptide bond at the C-terminus of the 2A peptide. Due to the effective cleavage, the P2A peptide is used in a preferred embodiment. Effective cleavage of the P2A peptide can reduce or eliminate exogenous epitopes associated with the gene of interest, thereby reducing immunogenicity, and patients treated with CAR-engineered host cells will show a reduced likelihood of an immune response to the engineered host cells (see WO 2020 / 223478).

[0245] F. Dosage

[0246] One or more engineered host cell populations, non-engineered cells and / or mixtures thereof disclosed herein can be formulated into unit dosage forms suitable for single administration of precise doses. In some cases, the unit dosage form comprises additional lymphocytes. In the unit dosage form, the preparation is divided into unit doses containing an appropriate amount of one or more compounds. The unit dose can be a packaged form containing a discrete amount of preparation. Non-limiting examples are packaged tablets or capsules, and powders in vials or ampoules. The aqueous suspension composition can be packaged in a single dose non-resealable container. For example, a multi-dose resealable container can be used in combination with a preservative or not. In some instances, the pharmaceutical composition does not include a preservative. Preparations for parenteral injection can be present in a unit dosage form together with a preservative, such as in an ampoule or in a multi-dose container.

[0247] The amount of one or more engineered host cell populations, non-engineered cells, and / or mixtures thereof present in the composition can be at least 5 cells, at least 10 cells, at least 20 cells, at least 30 cells, at least 40 cells, at least 50 cells, at least 60 cells, at least 70 cells, at least 80 cells, at least 90 cells, at least 100 cells, at least 200 cells, at least 300 cells, at least 400 cells, at least 500 cells, at least 600 cells, at least 700 cells, at least 800 cells, at least 900 cells, at least 100 cells, at least 200 cells, at least 300 cells, at least 400 cells, at least 500 cells, at least 600 cells, at least 700 cells, at least 800 cells, at least 900 cells, at least 1 x 10 3 cells, at least 2 x 10 3 cells, at least 3 x 10 3 cells, at least 4 x 10 3 cells, at least 5 x 10 3 cells, at least 6 x 10 3 cells, at least 7 x10 3 cells, at least 8 x 10 3 cells, at least 9 x 10 3 cells, at least 1 x 10 4 cells, at least 2 x 10 4 cells, at least 3 x 10 4 cells, at least 4 x 10 4 cells, at least 5 x 10 4 cells, at least 6 x 10 4 cells, at least 7 x 10 4 cells, at least 8 x 10 4 cells, at least 9 x 10 4 cells, at least 1 x 10 5 cells, at least 2 x10 5 cells, at least 3 x 10 5 cells, at least 4 x 10 5 cells, at least 5 x 10 5 cells, at least 6 x 10 5 cells, at least 7 x 10 5 cells, at least 8 x 10 5 cells, at least 9 x 10 5 cells, at least 1 x 10 6 cells, at least 2 x 10 6 cells, at least 3 x 10 6 cells, at least 4 x 10 6cells, at least 5 x 10 6 cells, at least 6 x10 6 cells, at least 7 x 10 6 cells, at least 8 x 10 6 cells, at least 9 x 10 6 cells, at least 1 x 10 7 cells, at least 2 x 10 7 cells, at least 3 x 10 7 cells, at least 4 x 10 7 cells, at least 5 x 10 7 cells, at least 6 x 10 7 cells, at least 7 x 10 7 cells, at least 8 x 10 7 cells, at least 9 x 10 7 cells, at least 1 x10 8 cells, at least 2 x 10 8 cells, at least 3 x 10 8 cells, at least 4 x 10 8 cells, at least 5 x 10 8 cells, at least 6 x 10 8 cells, at least 7 x 10 8 cells, at least 8 x 10 8 cells, at least 9 x 10 8 cells, at least 1 x 10 9 cells or more.

[0248] The therapeutically effective dose of one or more engineered host cell populations, non-engineered cells, and / or mixtures thereof of the invention can be about 1 cell to about 10 cells, about 1 cell to about 100 cells, about 1 cell to about 10 cells, about 1 cell to about 20 cells, about 1 cell to about 30 cells, about 1 cell to about 40 cells, about 1 cell to about 50 cells, about 1 cell to about 60 cells, about 1 cell to about 70 cells, about 1 cell to about 80 cells, about 1 cell to about 90 cells, about 1 cell to about 100 cells, about 1 cell to about 1 x 10 3 cells, about 1 cell to about 2 x 10 3 cells, about 1 cell to about 3 x 10 3 cells, about 1 cell to about 4 x 10 3 cells, about 1 cell to about 5 x 10 3 cells, about 1 cell to about 6 x 103 cells, about 1 cell to about 7 x 10 3 cells, about 1 cell to about 8 x 10 3 cells, about 1 cell to about 9 x 10 3 cells, about 1 cell to about 1 x10 4 cells, about 1 cell to about 2 x 10 4 cells, about 1 cell to about 3 x 10 4 cells, about 1 cell to about 4 x 10 4 cells, about 1 cell to about 5 x 10 4 cells, about 1 cell to about 6 x 10 4 cells, about 1 cell to about 7 x 10 4 cells, about 1 cell to about 8 x 10 4 cells, about 1 cell to about 9 x 10 4 cells, about 1 cell to about 1 x 10 5 cells, about 1 cell to about 2 x 10 5 cells, about 1 cell to about 3 x 10 5 cells, about 1 cell to about 4 x 10 5 cells, about 1 cell to about 5 x 10 5 cells, about 1 cell to about 6 x 10 5 cells, about 1 cell to about 7 x 10 5 cells, about 1 cell to about 8 x 10 5 cells, about 1 cell to about 9 x 10 5 cells, about 1 cell to about 1 x 10 6 cells, about 1 cell to about 2 x 10 6 cells, about 1 cell to about 3 x 10 6 cells, about 1 cell to about 4 x 10 6 cells, about 1 cell to about 5 x 10 6 cells, about 1 cell to about 6 x10 6 cells, about 1 cell to about 7 x 10 6 cells, about 1 cell to about 8 x 10 6 cells, about 1 cell to about 9 x 10 6 cells, about 1 cell to about 1 x 10 7 cells, about 1 cell to about 2 x 10 7 cells, about 1 cell to about 3 x 10 7cells, about 1 cell to about 4 x 10 7 cells, about 1 cell to about 5 x 10 7 cells, about 1 cell to about 6 x 10 7 cells, about 1 cell to about 7 x 10 7 cells, about 1 cell to about 8 x 10 7 cells, about 1 cell to about 9 x 10 7 cells, about 1 cell to about 1 x 10 8 cells, about 1 cell to about 2 x 10 8 cells, about 1 cell to about 3 x 10 8 cells, about 1 cell to about 4 x 10 8 cells, about 1 cell to about 5 x 10 8 cells, about 1 cell to about 6 x 10 8 cells, about 1 cell to about 7 x 10 8 cells, about 1 cell to about 8 x 10 8 cells, about 1 cell to about 9 x 10 8 cells, or about 1 cell to about 1 x 10 9 cells.

[0249] In some cases, a therapeutically effective dose of one or more engineered host cell populations, non-engineered cells, and / or mixtures thereof of the invention may be about 1 x 10 3 cells to about 2 x 10 3 cells, about 1 x 10 3 cells to about 3x 10 3 cells, about 1 x 10 3 cells to about 4 x 10 3 cells, about 1 x 10 3 cells to about 5 x 10 3 cells, about 1 x 10 3 cells to about 6 x 10 3 cells, about 1 x 10 3 cells to about 7 x 10 3 cells, about 1 x 10 3 cells to about 8 x 10 3 cells, about 1 x 10 cells to about 9 x 10 3 cells, about 1 x 10 cells to about 1 x 10 4 cells, about 1 x 10 3 cells to about 2 x 104 cells, about 1 x 10 3 cells to about 3 x 10 4 cells, about 1 x10 3 cells to about 4 x 10 4 cells, about 1 x 10 3 cells to about 5 x 10 4 cells, about 1 x 10 3 cells to about 6 x 10 4 cells, about 1 x 10 3 cells to about 7 x 10 4 cells, about 1 x 10 3 cells to about 8 x 10 4 cells, about 1 x 10 3 cells to about 9 x 10 4 cells, about 1 x 10 3 cells to about 1 x 10 5 cells, about 1 x 10 3 cells to about 2 x 10 5 cells, about 1 x 10 3 cells to about 3 x 10 5 cells, about 1 x 10 3 cells to about 4 x 10 5 cells, about 1 x 10 3 cells to about 5 x 10 5 cells, about 1 x 10 3 cells to about 6 x 10 5 cells, about 1 x 10 3 cells to about 7 x 10 5 cells, about 1 x 10 3 cells to about 8 x 10 5 cells, about 1 x 10 3 cells to about 9 x 10 5 cells, about 1 x 10 3 cells to about 1 x 10 6 cells, about 1 x 10 3 cells to about 2 x 10 6 cells, about 1 x 10 3 cells to about 3 x 10 6 cells, about 1 x 10 3 cells to about 4 x 10 6 cells, about 1 x10 3cells to about 5 x 10 6 cells, about 1 x 10 3 cells to about 6 x 10 6 cells, about 1 x 10 3 cells to about 7 x 10 6 cells, about 1 x 10 3 cells to about 8 x 10 6 cells, about 1 x 10 3 cells to about 9 x 10 6 cells, about 1 x 10 3 cells to about 1 x 10 7 cells, about 1 x 10 3 cells to about 2 x 10 7 cells, about 1 x 10 3 cells to about 3 x 10 7 cells, about 1 x 10 3 cells to about 4 x 10 7 cells, about 1 x 10 3 cells to about 5 x 10 7 cells, about 1 x 10 3 cells to about 6 x 10 7 cells, about 1 x 10 3 cells to about 7 x 10 7 cells, about 1 x 10 3 cells to about 8 x 10 7 cells, about 1 x 10 3 cells to about 9 x 10 7 cells, about 1 x 10 3 cells to about 1 x 10 8 cells, about 1 x 10 3 cells to about 2 x 10 8 cells, about 1 x 10 3 cells to about 3 x 10 8 cells, about 1 x 10 3 cells to about 4 x 10 8 cells, about 1 x 10 3 cells to about 5 x 10 8 cells, about 1 x 10 cells to about 6 x 10 8 cells, about 1 x 10 cells to about 7 x 10 8 cells, about 1 x 10 3 cells to about 8 x 10 8cells, about 1 x 10 3 cells to about 9 x 10 8 cells or about 1 x 10 3 cells to about 1 x 10 9 cells.

[0250] In some cases, a therapeutically effective dose of one or more engineered host cell populations, non-engineered cells, and / or mixtures thereof of the invention may be about 1 x 10 6 cells to about 2 x 10 6 cells, about 1 x 10 6 cells to about 3x 10 6 cells, about 1 x 10 6 cells to about 4 x 10 6 cells, about 1 x 10 6 cells to about 5 x 10 6 cells, about 1 x 10 6 cells to about 6 x 10 6 cells, about 1 x 10 6 cells to about 7 x 10 6 cells, about 1 x 10 6 cells to about 8 x 10 6 cells, about 1 x 10 6 cells to about 9 x 10 6 cells, about 1 x 10 6 cells to about 1 x 10 7 cells, about 1 x 10 6 cells to about 2 x 10 7 cells, about 1 x 10 6 cells to about 3 x 10 7 cells, about 1 x10 6 cells to about 4 x 10 7 cells, about 1 x 10 6 cells to about 5 x 10 7 cells, about 1 x 10 6 cells to about 6 x 10 7 cells, about 1 x 10 6 cells to about 7 x 10 7 cells, about 1 x 10 6 cells to about 8 x 10 7 cells, about 1 x 10 6 cells to about 9 x 10 7 cells, about 1 x 106 cells to about 1 x 10 8 cells, about 1 x 10 6 cells to about 2 x 10 8 cells, about 1 x 10 6 cells to about 3 x 10 8 cells, about 1 x 10 6 cells to about 4 x 10 8 cells, about 1 x 10 6 cells to about 5 x 10 8 cells, about 1 x 10 6 cells to about 6 x 10 8 cells, about 1 x 10 6 cells to about 7 x 10 8 cells, about 1 x 10 6 cells to about 8 x 10 8 cells, about 1 x 10 6 cells to about 9 x 10 8 cells, about 1 x 10 6 cells to about 1 x 10 9 cells, about 1 x 10 6 cells to about 2 x 10 9 cells, about 1 x 10 6 cells to about 3 x 10 9 cells, about 1 x 10 6 cells to about 4 x 10 9 cells, about 1 x10 6 cells to about 5 x 10 9 cells, about 1 x 10 6 cells to about 6 x 10 9 cells, about 1 x 10 6 cells to about 7 x 10 9 cells, about 1 x 10 6 cells to about 8 x 10 9 cells, about 1 x 10 6 cells to about 9 x 10 9 cells, about 1 x 10 7 cells to about 1 x 10 9 cells, about 1 x 10 7 cells to about 2 x 10 9 cells, about 1 x 10 7 cells to about 3 x 10 9cells, about 1 x 10 7 cells to about 4 x 10 9 cells, about 1 x 10 7 cells to about 5 x 10 9 cells, about 1 x 10 7 cells to about 6 x 10 9 cells, about 1 x 10 7 cells to about 7 x 10 9 cells, about 1 x 10 7 cells to about 8 x 10 9 cells, about 1 x 10 7 cells to about 9 x 10 9 cells, about 1 x 10 8 cells to about 1 x 10 9 cells, about 1 x 10 8 cells to about 2 x 10 9 cells, about 1 x 10 8 cells to about 3 x10 9 cells, about 1 x 10 8 cells to about 4 x 10 9 cells, about 1 x 10 8 cells to about 5 x 10 9 cells, about 1x 10 8 cells to about 6 x 10 9 cells, about 1 x 10 8 cells to about 7 x 10 9 cells, about 1 x 10 8 cells to about 8 x 10 9 cells, about 1 x 10 8 cells to about 9 x 10 9 cells or about 1 x 10 8 cells to about 1 x 10 10 cells.

[0251] G. Save

[0252] In some embodiments, one or more engineered host cell populations, non-engineered cells, and / or mixtures thereof of the invention may be formulated in a freezing medium and placed in a cryogenic storage device, such as a liquid nitrogen freezer (-195C) or an ultra-low temperature freezer (-65C, -80C, or -120C) for long-term storage of at least about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year, 2 years, 3 years, or at least 5 years. The freezing medium may contain dimethyl sulfoxide (DMSO) and / or sodium chloride (NaCl) and / or dextrose and / or dextran sulfate and / or hydroxyethyl starch (HES) and a physiological pH buffer to maintain the pH at about 6.0 to about 6.5, about 6.5 to about 7.0, about 7.0 to about 7.5, about 7.5 to about 8.0, or about 6.5 to about 7.5. In embodiments, cryopreserved cells may be thawed and further processed, for example by stimulation with antibodies, proteins, peptides, and / or cytokines mentioned herein. Cryopreserved cells can be thawed and genetically modified with viral vectors (including retroviral and lentiviral vectors) or non-viral means (including RNA, DNA and proteins) as described herein. Alternatively, host cells as described herein can be, for example, optionally amplified by the methods described herein, genetically modified, and then cryopreserved.

[0253] Thus, genetically engineered and / or non-engineered cells as disclosed herein can be cryopreserved to generate a bank of cells in the amount of at least about 1, 5, 10, 100, 150, 200, 500 vials in a freezing medium for approximately at least 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 or at least about 10 10In some embodiments, the cell bank of cryopreservation can retain its function, and can thaw, and optionally can activate / stimulate and / or amplify. In some aspects, the thawed cell can be stimulated and amplified in a suitable closed container (such as a cell culture bag and / or a bioreactor) to generate a large amount of cells as an allogeneic cell product. In other examples, the cell of cryopreservation includes an autologous cell product. The cell of cryopreservation can maintain its biological function at least about 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 15 months, 18 months, 20 months, 24 months, 30 months, 36 months, 40 months, 50 months or at least about 60 months under low temperature storage conditions. In some aspects, preservative is not used in the preparation. In some embodiments, the cell of cryopreservation can be thawed and infused into multiple patients as an allogeneic ready-made cell product.

[0254] Example

[0255] The following examples are presented to provide a person of ordinary skill in the art with a complete disclosure and description of how to make and use the methods and compositions of the present invention, and are not intended to limit the scope of what the inventors regard as their inventions. Efforts have been made to ensure accuracy with respect to the numerals used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be considered. Unless otherwise noted, parts are parts by weight, molecular weight is average molecular weight, temperature is degrees Celsius, and pressure is atmospheric pressure or near atmospheric pressure.

[0256] Example 1. In vitro activity of Vδ1 CD27 receptor CAR T cells

[0257] This example demonstrates that Vδ1 CD27 CAR T cells exhibit robust activity against CD70-expressing cells in vitro.

[0258] like Figure 1 As shown, target cell lines Raji, HeLa, ACHN, A498 and 786-O (ATCC) were stained with anti-CD70 antibodies (Biolegend) or isotypes (R&D Systems). Cells were analyzed on Novocyte (Agilent). CD70 expression in different cell lines was plotted as MFI (mean fluorescence intensity) ratios. The resulting ratio of antibody MFI to isotype MFI was plotted. CD70 low expression: HeLa and ACHN, CD70 medium expression: Raji, CD70 high expression: A498 and 786-O.

[0259] For long-term cytotoxicity assays, Vδ1 CD27 receptor CAR T cells were co-cultured with target cell lines (HeLa, Figure 2A ;Raji, Figure 2B;A498, Figure 2C ) were co-cultured for 120 hours with an effector to target ratio (E:T) of 2:1. Target cells were transduced with Incucyte®Nuclight NIR lentivirus (Sartorius) and modified to express Nuc-NIR. Live target cells expressing Nuc-NIR were quantified by Incucyte®SX5 (Sartorius) every 4 hours. The cytotoxicity index was calculated by dividing the total NIR object area (object area) at each time point by the value of time 0 hours. Vδ1 CD27 receptor CAR T cells showed strong cytotoxic activity against different cancer cell lines such as HeLa (cervix), Raji (lymphoma) and A498 (renal cells). The lower cytotoxicity index indicates that Vδ1 CD27 receptor CAR T cells (box) have better cytotoxic potential than target cells (circles) alone.

[0260] It was evaluated whether soluble CD27 could affect the cytotoxic potential of Vδ1 CD27 receptor CAR T cells. Briefly, Vδ1 CD27 receptor CAR T cells were co-cultured with the Nuc-NIR expressing A498 target cell line at an E:T ratio of 1:2. At time 0 hours, soluble CD27 (Acro Biosystems) was added to the co-culture at different concentrations ranging from 0-8 µg / mL. Live target cells expressing Nuc-NIR were quantified every 2 hours by Incucyte® SX5 (Sartorius). The cytotoxicity index at the 18-hour and 36-hour time points was calculated by dividing the total NIR object area at each time point by the value at time 0 hours. There was no difference in the cytotoxicity index between the co-cultures with 0µg and 0.25-8µg / mL of soluble CD27, indicating that the presence of soluble CD27 did not interfere with the cytotoxic potential of Vδ1 CD27 receptor CAR T cells ( Figure 3 ).

[0261] Example 2. In vivo control of renal cell carcinoma by Vδ1 CD27 receptor CAR T cells

[0262] This example demonstrates that a full-length CD27 CAR having a 4-1BB co-stimulatory domain and a CD3 ζ signaling domain exhibits improved in vivo tumor control compared to a truncated CD27 CAR having a CD8 hinge / TM domain, a 4-1BB co-stimulatory domain, and a CD3 ζ signaling domain.

[0263] The in vivo efficacy of Vδ1 CD27 receptor CAR T cells was evaluated in a subcutaneous renal carcinoma model using A498 cells. Female NSG mice (The Jackson Laboratory) were subcutaneously implanted with 4 x 10 6 A498 cells (ATCC). When the tumor volume reached an average of 100 mm 3 The animals were randomly divided into 5 groups and treated with 2.5 x 10 6 , 5 x 10 6 or 10 x 10 6 The negative control group was treated with non-functional Vδ1 CD27 truncated receptor CAR T cells at a dose of 5 x 10 6 CAR+ cells (E group) and single tumor group (A group, untreated) treatment. Human IL-2 (Proleukin) was administered intraperitoneally before treatment, and then three times a week. Tumor volume was measured twice a week with a caliper. Compared with the control group (single tumor and group treated with non-functional Vδ1 CD27 truncated receptor CAR T cells), the tumor response of Vδ1 CD27 receptor CAR T cells (BD group) at all three dose levels was persistent. These data support the cytotoxic potential of Vδ1 CD27 receptor CAR T cells in human renal cancer cell xenograft models.

[0264] The in vivo efficacy of Vδ1 CD27 receptor CAR T cells was also evaluated in a subcutaneous renal cancer model using ACHN cells. Female NSG mice (The Jackson Laboratory) were subcutaneously implanted with 5 x 10 6 ACHN cells (ATCC). When the tumor volume reached an average of 120 mm 3 The animals were randomly divided into 5 groups and treated with 2.5 x 10 6 , 5 x 10 6 or 10 x 10 6 The negative control group was treated with 5 x 10 Vδ1 CD27 receptor CAR T cells. 6The dose of CAR+ cells was treated (Group E) or not treated (Group A). ​​Human IL-2 was administered intraperitoneally before treatment, and then three times a week. Tumor volume was measured twice a week with a caliper. Compared with the control group (single tumor and group treated with non-functional Vδ1 CD27 truncated receptor CAR T cells), the tumor response of Vδ1 CD27 receptor CAR T cells (Group C, Group D) at higher dose levels was persistent. These data support the cytotoxic potential of Vδ1 CD27 receptor CAR-T cells in human renal cancer cell xenograft models with low CD70 expression.

[0265] Example 3. Identification of CD27 CAR Expression

[0266] This example demonstrates that antibodies to the 2A peptide included as part of the CD27 CAR can be used to determine CD27 CAR surface expression.

[0267] Vδ1 T cells modified with three different CD20 CAR constructs (two containing P2A and one without) were thawed and counted by Annexin-Dapi on Novocyte (Agilent). Approximately 5 x10 5 The cells were stained with Zombie Aqua (Biolegend), a cell viability dye. The cells were surface stained with Vδ1 (Biolegend) and anti-CAR idiotype antibody (Adicet Bio) and fixed with fixation buffer (Biolegend). The cells were then permeabilized with permeabilization buffer (BD Biosciences). After permeabilization, the cells were stained with anti-P2A antibody (Novus Biosciences) and acquired on Novocyte (Agilent). For samples CD20 CAR-P2A-DAP10.7 and CD20 CAR-P2A-DAP10.9, the P2A positive population was co-stained with CAR surface staining ( Figure 6 ). The results showed that intracellular staining of P2A can be used for CAR detection.

[0268] Example 4. Gene Editing of γδ T Cells

[0269] This example demonstrates the use of the CRISPR / Cas9 system to generate CISH knockout in γδ T cells.

[0270] To knock out the CISH gene in Vδ1 T cells, a ribonucleoprotein (RNP) complex consisting of CRISPR-Cas9 (Integrated DNA Technologies) and CISH sgRNA (Synthego Corporation) was combined with activated Vδ1 T cells from PBMC (P3 primary cell 4D-Nucleofector X kit L, Lonza). The RNP complex was delivered to Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, the cells were transferred to a T bottle (Corning) containing X-Vivo15 (Lonza) for cell recovery and expansion in a 37°C CO2 incubator (ThermoFisher). To evaluate the CISH KO efficiency, cell pellets were collected after αβ T cell depletion (StemCell Technologies) on day 7 after gene editing, and genomic DNA was extracted using the NucleoSpin tissue kit (MACHEREY-NAGEL). The edited region of the CISH gene was amplified by PCR and subjected to Sanger sequencing (Sequetech). The gene knockout efficiency was determined using the ICE analysis tool (Synthego). High knockout efficiency of the CISH gene was observed in Vδ1 T cells ( Figure 7 ).

[0271] Vδ1 T cell enrichment in PBMCs was monitored over time by flow cytometry (anti-Vδ1, BioLegend) after CISH knockout. CISH knockout did not affect Vδ1 T cell enrichment compared to unedited mock control cells. After TCRαβ depletion (StemCell Technologies), CISH-edited Vδ1 T cells achieved similar purity compared to mock control cells ( Fig. 8A ).

[0272] The cell viability of Vδ1 T cell-enriched PBMCs was monitored after CISH knockout (Countess II, ThermoFisher). CISH KO cells maintained high cell viability similar to that of unedited mock control cells ( Figure 8B ).

[0273] Example 5. Identification of CAR expression

[0274] ADI-270 cells (cells expressing PL1179, SEQ ID NO: 57) were thawed and counted by Annexin-Dapi on Novocyte (Agilent). Approximately 2 x 10 5 The cells were stained with the cell viability dye Zombie Aqua (Biolegend). The cells were fixed with fixation buffer (Biolegend). The cells were then permeabilized with permeabilization buffer (BD Biosciences). After permeabilization, the cells were stained with anti-P2A antibody (Novus Biosciences) and acquired on Novocyte. The P2A positive population represents the transduction efficiency of CAR. The results are shown in Fig. 9 As shown, this suggests that P2A intracellular staining can be used for CAR detection of ADI-270.

[0275] Example 6. In vitro activity of ADI-270

[0276] Target cell lines Caki-1, Caki-2, 769-P, ACHN, A498, 786-O, H1792, H1975, H460, and HuT78 (ATCC) were stained with anti-CD70 antibody conjugated to PE (Biolegend) or isotype control conjugated to PE (R&D Systems). Cells were analyzed on Novocyte. The number of CD70 molecules per cell was quantified using a flow cytometry BD Quantibrite™ microbead kit (BD Biosciences). Fig.10 Several tumor cell lines expressing broad CD70 levels were identified for subsequent in vitro functional evaluation of ADI-270.

[0277] For long-term cytotoxicity assays, ADI-270 was co-cultured with target cells at effector to target ratios (E:T) of 2:1, 1:1, and 1:2 for 120 hours. Target cells were modified to express Nuc-NIR by transducing them with Incucyte® Nuclight NIR lentivirus (Sartorius). Live target cells expressing Nuc-NIR were quantified every 4 hours by Incucyte® SX5 (Sartorius). The cytotoxicity index was calculated by dividing the total NIR object area at each time point by the value at time 0 hours. A lower cytotoxicity index indicates increased tumor cell killing. Fig.11As shown, ADI-270 exhibited potent cytotoxic activity against multiple RCC cell lines expressing a range of CD70 levels (A498, 769-P, Caki-2) as well as against CD70-positive NSCLC (H1945) and T-cell lymphoma (HuT78) cell lines. No cytotoxicity was observed against the CD70 knockout A498 cell line at the E:T ratios tested, indicating that the cytolytic activity of ADI-270 is specific and dependent on CD70 expression.

[0278] ADI-270 is equipped with dnTGFβRII defense to alleviate the immunosuppressive effect of TGFβ1 that may exist in the tumor microenvironment (TME). In order to prove the function of dnTGFβRII expressed by ADI-270, the cytolytic activity of CD70 positive cell lines was compared with anti-CD70 CAR Vδ1 γδ T cells (without dnTGFβRII) (PL1107, SEQ ID NO: 53) in the absence and presence of exogenously added TGFβ1 (R&D Systems) using in vitro repeated stimulation assays. A498 and ACHN-Nuc NIR fluorescently labeled RCC tumor cell lines and effector cells were added to 96-well plates at an E:T ratio of 5:1. TGFβ1 was added to the corresponding co-culture conditions at a final concentration of 20ng / mL. The first stimulation was monitored for 2 days, and then fresh target cells were planted in another 96-well plate. The effector cells produced by the first stimulation were then transferred to a plate with fresh target cells. The second stimulation was additionally monitored for 2 days. Co-cultures were monitored every 4 hours using an Incucyte® SX5. The cytotoxicity index was calculated based on the remaining viable target tumor cells by dividing the total NIR object area at each time point by the value at time 0 for each stimulation. Results are presented in Fig.12 In the presence of TGFβ1, after a second stimulation with tumor cells, ADI-270 maintained cytolytic activity against A498 and ACHN compared to the no TGFβ1 condition. In the presence of TGFβ1, after a second stimulation, anti-CD70 CAR Vδ1 γδ T cells were associated with minimal tumor control due to the lack of defense to relieve the inhibitory effect of TGFβ1. The data demonstrate that in the presence of TGFβ1, ADI-270 maintains its potent in vitro cytotoxicity against RCC cell lines, demonstrating the functionality of the dnTGFβRII defense in Vδ1 γδ T cells.

[0279] TGFβ1 is known to directly inhibit T cell proliferation. To further evaluate the function of dnTGFβR2 defense, the in vitro proliferation of ADI-270 was evaluated in the absence and presence of exogenously added TGFβ1 (R&D Systems). ADI-270 and anti-CD70 CAR Vδ1 γδ T cells (effector cells) were labeled with Cell Tracer Violet (CTV) (ThermoFisher) to measure their proliferation capacity. CTV-labeled effector cells were co-cultured with A498 target cells at an E:T ratio of 1:2 for 7 days. The co-cultures were harvested and the proliferation of effector cells was assessed using flow cytometry (Novocyte) by determining the % of cell divisions with reduced CTV fluorescence intensity using FlowJo™ Proliferation Modeling Software (FlowJo). The results are shown in Figure 2. Fig.13 Shown in . In the presence of TGFβ1, ADI-270 maintained in vitro proliferation after stimulation with A498 tumor cells, based on similar cell division % detected when compared to without added TGFβ1. In contrast, in the presence of TGFβ1, a decrease in the % of cell division of anti-CD70 CAR Vδ1 γδ T cells was detected when stimulated with A498 cells compared to the no TGFβ1 condition. The results indicate that dnTGFβRII defense reduced the effect of TGFβ1 in inhibiting the proliferation of Vδ1 γδ T cells. The data represent 4 different donors. The numbers represent the % of cells within each gated cell division.

[0280] Binding of TGFβ1 to a heterocomplex of TGFβ type II and type I receptors induces a signaling cascade that phosphorylates SMAD2 and SMAD3 (pSMAD2 / 3). To investigate whether dnTGFβRII defense in ADI-270 can reduce SMAD2 / 3 phosphorylation, ADI-270 and anti-CD70 CAR Vδ1 γδ T cells were serum starved for 2 hours and cultured for 15 minutes in the presence and absence of exogenous TGFβ1 (R&D Systems). The cells were then fixed, permeabilized, and stained for anti-pSMAD2 / 3 and analyzed using flow cytometry (Novocyte). The results are shown in Fig.14Shown in. After exposure to TGFβ1, ADI-270 was associated with lower levels of pSMAD2 / 3 compared to anti-CD70CAR Vδ1 γδ T cells, which further supports the function of dnTGFβRII. Compared with the condition without TGFβ1, pSMAD2 / 3 was moderately increased using ADI-270, which may be due to the presence of untransduced CAR Vδ1 γδ T cells in the total population without dnTGFβR2 defense. The data shown are the average geometric mean (Geo Mean) from 3 different donors. Statistical analysis was performed using a paired t-test, ** p < 0.005.

[0281] To determine whether dnTGFβRII defense of ADI-270 could minimize changes in transcript levels associated with T cell effector function, ADI-270 and anti-CD70 CAR Vδ1 γδ T cells were activated with rhuCD70 (AcroBio) in the presence and absence of TGF-β1 (R&D Systems) for 24 h. RNA was extracted from cells using the RNeasy Plus kit (Qiagen). T cell-related transcripts from samples were quantified using the nCounter® CAR-T Signature Panel (Nanostring) and the nCounter® SPRINT Analyzer (Nanostring). Differentially expressed genes (DEGs) were identified using the nCounter® Advanced Analysis Software (Nanostring). Results are presented in Fig.15 Figure 4. Volcano plots represent DEGs of ADI-270 vs. anti-CD70 CAR Vδ1 γδ T cells (undefended) from 2 different donors activated with rhuCD70 (5µg / mL) in the presence or absence of TGF-β1 (20ng / mL) for 24 hours. Blue (upward pointing) triangles represent DEGs that were upregulated in TGF-β1 treated conditions versus untreated conditions. Red (downward pointing) triangles represent DEGs that were downregulated in TGF-β1 treated conditions versus untreated conditions. Stimulated anti-CD70 CAR Vδ1 γδ T cells were associated with increased transcript changes when compared to + / - TGF-β1 conditions. Minimal transcript changes were observed from stimulated ADI-270 in + / - TGF-β1 conditions, further supporting that dnTGFβRII defense minimizes TGF-β1-induced transcript changes in Vδ1 γδ T cells.

[0282] ADI-270 has multiple effector functions, such as production of soluble mediators and recognition and killing of CD70+ tumor cells, which contribute to the effective anti-tumor activity. To study the cytokine and chemokine production of ADI-270 and anti-CD70 CAR Vδ1 γδ T cells, A498 and ACHN target cell lines were co-cultured at an E:T ratio of 1:1, and supernatants were collected 24 hours after stimulation. The supernatants were analyzed using the Milliplex Immunology Multiplex Assay Panel on the Luminex® FLEXMAP 3D instrument. Supernatant analysis revealed similar measured levels of IFN-γ, GM-CSF, TNF-α, MIP-1α, MIP-1β, IL-17A, and IL-10 for ADI-270 and anti-CD70 CAR Vδ1 γδ T cells after stimulation with A498 and ACHN cell lines. The results were Figures 16A-16B The data show that dnTGFβRII defense in ADI-270 does not alter cytokine and chemokine release profiles when compared to anti-CD70 CAR Vδ1 γδ T cells. Minimal cytokine and chemokine secretion was observed when using ADI-270 and target alone. The data shown are the average concentrations (pg / mL) of cytokines and chemokines derived from two different donors.

[0283] Example 7. In vivo control of human tumor xenografts in NSG mice using ADI-270 treatment

[0284] ADI-270 is designed with a dnTGFβRII defense against the immunosuppressive factor TGF-β1. Research-grade ADI-270 and anti-CD70 CAR Vδ1 γδ T cells (without dnTGFβRII) were made by three different donors. The activity of ADI-270 with or without defense was then tested in female NSG mice (Charles River) (n=5 per group) implanted subcutaneously with the CD70-expressing human renal cell carcinoma (RCC) cell line A498. When the tumor volume was approximately 150mm 3 Mice were randomized into study cohorts at 4 hr. 5E6 ADI-270, 5E6 anti-CD70 CAR Vδ1 γδ T cells, and 5E6 untransduced γδ1 T cells were administered as a single bolus dose on day 0. Human IL-2 was supplemented three times per week during the study. Tumor volume and mouse weight were monitored throughout the experiment. Results were Figures 17A-17B . Fig.17A ) shows the mean tumor volume (MTV) and standard error bars for each group during the study period until the endpoint at day 40, when the mean tumor volume of the individual tumor cohorts reached approximately 2000 mm 3 . ( Fig. 17B ) Statistical analysis of tumor volume data at day 40 (end of study) was performed using one-way ANOVA and Tukey's multiple comparison test. ADI-270 did not cause adverse health effects and showed significant tumor control compared to untreated controls or mice treated with non-transduced γδ T cells. In addition, ADI-270 demonstrated a functional advantage of significantly enhanced efficacy compared to defenseless anti-CD70 CAR Vδ1 γδ T cells.

[0285] Technical grade ADI-270 material was evaluated in the A498 human RCC subcutaneous xenograft tumor model at three dose levels (5e6, 10e6, and 15e6 CAR+ viable cells). Human renal cell carcinoma A498 subcutaneous xenografts were established by inoculating 4E6 cells / mouse in the right hind flank of female NSG mice. When the tumor volume was approximately 150 mm 3 Mice were randomized into study cohorts (N=5 mice per group) at 4 pm. ADI-270 was administered as a single bolus dose on day 0. Human IL-2 was supplemented three times per week during the study. Tumor volume and mouse weight were monitored throughout the experiment. Results Figures 18A-18B . Fig.18A ) were used to determine the mean tumor volume during the study period and ( Fig.18B Statistical comparisons (Tukey's multiple comparison test) between treatment groups and vehicle control group at the end of the study (day 39), when the mean tumor volume of the individual tumor cohorts reached approximately 2000 mm 3 **** indicates p-value ≤ 0.0001. Technical-grade ADI-270 did not cause adverse health effects and showed similar potency to research-grade material previously tested in this model. Higher dose levels of ADI-270 (10e6 and 15e6) resulted in complete eradication of tumors in this RCC solid tumor model.

[0286] The activity of ADI-270 was evaluated in different indications with low CD70 expression levels. HuT78 (a CD70-low expressing human T-cell lymphoma cell line) was subcutaneously implanted into the right hind flank of female NSG mice by inoculating 2E6 HuT78 cells. When the tumor volume reached approximately 200 mm 3 Mice were randomized into study cohorts (N=5 per group) at 4 pm. ADI-270 was administered as a single bolus dose on day 0. Human IL-2 was supplemented three times per week to the appropriate groups during the study. Figures 19A-19B . Fig.19A ) shows the mean tumor volume (MTV) and standard error bars for each group during the study period until the endpoint on day 21, when the mean tumor volume of the individual tumor cohorts reached approximately 2000 mm3 . ( Fig.19B ) Statistical analysis of tumor volume data on day 21 (end of study) was performed using one-way ANOVA and Dunnett's multiple comparison test. **** indicates p value ≤ 0.0001. ADI-270 showed significant control in a dose-dependent manner with or without IL-2 supplementation.

[0287] Example 8. Ex vivo tissue analysis of ADI-270-treated NSG mice implanted with human tumor xenografts

[0288] Based on robust in vivo tumor control without xenogeneic GvHD in A498 tumor-bearing NSG mice, ADI-270 was confirmed to proliferate and activate specifically within tumors with little or no accumulation in normal tissues. Tissues from A498-bearing NSG mice that received a single IV dose of Cell Tracker Violet (CTV) (ThermoFisher)-labeled ADI-270 were harvested on days 7 and 14. Results Figures 20A-20C . Fig. 20A ) CTV-labeled ADI-270 showed increased cell proliferation in tumors compared to day 0 controls, as indicated by the dilution of CTV dye (histogram). Fig. 20B ) The harvested ADI-270 was stained for activation-related markers, and ( Fig. 20C ) ADI-270 was observed to specifically home to the tumor compared to the lung, spleen, blood, and bone marrow on days 7 and 14.

[0289] Example 9. Host versus graft (HvG) defense of ADI-270

[0290] ADI-270 and unrelated CAR (target CD20) Vδ1 γδ T cells (target cells) were co-cultured with T cells (effectors) isolated from autologous and allogeneic (donor A and B) PBMC donors using EasySep™ human T cell enrichment kit (StemCell Technologies), with a fixed ratio E:T ratio of 5:1 and 10:1 and supplemented with IL-2. Half of the culture medium (10% FBS RPMI-1640) was replaced with fresh IL-2 every 2-3 days. On the 5th day, cells were harvested and analyzed by flow cytometry (Novocyte), to quantify the absolute counts of ADI-270 and unrelated CAR Vδ1 γδ T cells in the co-cultures with autologous and allogeneic T cells. % HvG susceptibility was determined by comparing absolute counts of ADI-270 and irrelevant CAR Vδ1 γδ T cell effector cells in T cell autologous co-cultures (control for minimal cell killing) versus T cell allogeneic co-cultures. Fig.21 The results are shown in Figure 2. ADI-270 showed reduced HvG susceptibility compared to Vδ1 T cells expressing an irrelevant CAR, suggesting that ADI-270 potentially targets CD70+ activated alloreactive host T cells and can limit HvG Vδ1 T cell rejection to contribute to persistence. Statistical comparisons between the ADI-270 and irrelevant CAR groups were determined using two-way ANOVA. The results suggest that the use of dual CARs that bind to CD70 and another tumor-associated antigen, or co-administration of a CAR that binds to CD70 and a CAR that binds to another tumor-associated antigen, can reduce alloreactivity compared to the use of a CAR that binds to another tumor-associated antigen alone.

[0291] Example 10: Enhancing CAR Vδ1 T cell effector function using membrane-bound IL-12 (mbIL-12)

[0292] It consists of an anti-CD19 (clone FMC63) scFv (as described in Kochendefer JN et al., Adoptive transfer of syngeneic T cells transduced with a chimeric antigen receptor that recognizes murine CD19 can eradicate lymphoma and normal B cells, Blood. 2010 Nov 11;116(19):3875-86), the CD8α hinge and transmembrane domains, and the 4-1BB and CD3ζ signaling domains, followed by a self-cleaving P2A sequence for isolating the mbIL-12 molecule (as described in Lee et al., Antigen-dependent IL-12 signaling in CAR T cells promotes regional to systemic disease targeting, bioRxiv. 2023-01-07; 2023.01.06.522784) is a CAR vector composed of a DNA fragment containing all CAR domains cloned (integrating DNA technology) into a self-inactivating (SIN) Moloney Murine Leukemia Virus (MMLV) gamma retroviral plasmid. Construct design as Fig. 22 Shown are: (Construct A) CAR (FMC63) construct, (Construct B) CAR-mbIL-12 construct, and (Construct C) mbIL-12 construct.

[0293] Healthy donor peripheral blood mononuclear cells (PBMCs) were used to activate, expand, and engineer Vδ1 γδ T cells to express the CD19 CAR-mbIL-12 transgene. Figures 23A-23D . Fig.23A ) Vδ1 γδ T cells (after transduction) were sampled at different time points during the expansion process to determine cell counts. There was no difference in total Vδ1 γδ T cell counts between CAR and CAR-mbIL-12, indicating that mbIL-12 had no negative effect on the expansion of Vδ1 γδ T cells. The cells were harvested, stained for CAR and mbIL-12 using anti-FMC63 antibodies conjugated to PE (Acrobio Systems, Newark, DE) and anti-IL12 conjugated to APC (Miltenyi Biotec), respectively, and acquired on a Novocyte flow cytometer (Agilent Technologies) to determine the percentage of CAR and mbIL-12 positive Vδ1 γδ T cells. ( Fig. 23B ) At the end of the process, no difference in % CAR was observed between Vδ1 γδ T cells expressing CAR and CAR-mbIL-12 to further support that mbIL-12 does not affect CAR surface expression. ( Fig.23C ) During the expansion process, the %mbIL-12 expressed on the cell surface of Vδ1 γδ T cells decreased over time. ( Fig.23D ) CAR-mbIL-12 Vδ1γδ T cells were co-cultured with and without CD19+ Raji cells for 18 hours. After stimulation with target cells, mbIL-12 increased on the cell surface of Vδ1γδ T cells compared to unstimulated conditions, indicating that the surface expression of mbIL-12 is dependent on CAR activation.

[0294] In order to prove the function of CAR-mbIL-12, the cytolytic activity of Vδ1 γδ T cells transduced with CAR, CAR-mbIL-12 and mbIL-12 for CD19 positive cell lines was evaluated in an in vitro repeated stimulation assay. Raji-NucNIR fluorescently labeled cell lines and effector cells were added to 96-well plates with an E:T ratio of 5:1, 2.5:1 and 1.25:1. Monitor the first stimulation for 3 days, and then plant fresh target cells in another 96-well plate. Then the effector cells produced by the first stimulation are transferred to a plate with fresh target cells. Additional monitoring of the second stimulation for 3 days and the third stimulation performed the same procedure. Incucyte® SX5 (Satorius) is used to monitor co-cultures every 4 hours. The cytotoxicity index is based on the remaining live target tumor cells, calculated by dividing the total NIR object area at each time point by the value of each stimulation at time 0. The lower the cytotoxicity index, the better the cytotoxic potential. After the second and third stimulations, CAR-mbIL-12 Vδ1 γδ T cells were associated with higher tumor cell killing compared with CAR and mbIL12 Vδ1 γδ T cells at the E:T ratios tested. No coculture conditions with a cytotoxicity index >1 (indicating incomplete tumor control) were analyzed in subsequent stimulations. Fig.24 It is shown and demonstrated that CAR-mbIL-12 expressed by Vδ1 γδ T cells maintains the function of cytolytic killing of tumor cells.

[0295] A suboptimal dose of 2.5e6 CAR+ viable cells of CAR-mbIL-12 Vδ1 γδ T cells was evaluated in a Raji cell subcutaneous xenograft tumor model. Raji cell subcutaneous xenografts were established by inoculating 1E6 cells / mouse in the right hind flank of female NSG mice. When the tumor volume was approximately 200 mm 3 At 4 pm, mice were randomized into study cohorts (N = 5 mice per group). Vδ1 γδ T cells expressing CAR and CAR-mbIL-12 were administered as a single bolus dose on day 0. Human IL-2 was supplemented three times per week during the study. Tumor volume and mouse weight were monitored throughout the experiment. Results Fig.25 . CAR-mbIL-12 Vδ1 γδ T cells were associated with significantly higher inhibition of tumor cell growth compared to the suboptimal therapeutic dose of CAR Vδ1 γδ T cells. The data support the enhanced function of Vδ1 γδ T cells expressing CAR-mbIL-12.

[0296] Example 11: CISH KO enhances the function of Vδ1 T cells

[0297] Healthy donor peripheral blood mononuclear cells (PBMC) are used for activation, amplification, CRISPR gene editing and engineering Vδ1γδ T cells to express CAR. In order to knock out the CISH gene in Vδ1 T cells, a ribonucleoprotein (RNP) complex containing CRISPR-Cas9 (Integrated DNA Technologies) or -MAD7 (Aldevron) and CISH sgRNA is combined with activated Vδ1 T cells (P3 primary cell 4D-Nucleofector X kit L, Lonza) from PBMC. The RNP complex is delivered to Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, the cells are transferred to a T bottle (Corning) containing X-Vivo15 (Lonza) for cell recovery, and then transduced with a gamma retroviral vector encoding CAR, and then amplified. In order to evaluate the CISH KO efficiency, cell pellets are collected, and genomic DNA is extracted using the NucleoSpin tissue kit (MACHEREY-NAGEL). The edited region of the CISH gene was amplified by PCR and Sanger sequencing was performed (Sequetech). The gene knockout efficiency was determined using the ICE analysis tool (Synthego). To evaluate the KO of CISH protein in CAR Vδ1 T cells, WT (unedited) and CISH KO CAR Vδ1 T cells were incubated with and without IL-2 (Peprotech) for 5 hours. Cell lysates were generated for western blot detection of CISH protein using anti-CISH rabbit mAb (Cell Signaling). The primary antibody was detected using IRDye 800CW goat anti-rabbit IgG secondary antibody (LI-COR), and the presence of IRDye was imaged using the Odyssey Imaging System (LI-COR). The results are in Figures 26A-26B . Fig.26A )When exposed to IL-2, WT CAR Vδ1 T cells showed increased CISH protein levels. In contrast, in the presence of IL-2 that supports KO of CISH, CISH protein levels were significantly reduced in CISH KO CAR Vδ1 T cells. ( Fig.26B)To demonstrate the enhanced functionality of CISH KO CAR transduced and untransduced Vδ1 T cells, cytolytic activity against the B7-H6+ HCT-15 cell line (ATCC) was evaluated using an in vitro repeated stimulation assay. HCT-15 NIR fluorescently labeled cell lines and effector cells were added to 96-well plates at an E:T ratio of 5:1, with or without different concentrations of IL-2. Each stimulation was monitored for 3 days, and then fresh target cells were plated in another 96-well plate. The effector cells from each stimulation were then transferred to a plate containing fresh target cells. Co-cultures were monitored every 4 hours using Incucyte® SX5 (Satorius). The cytotoxicity index is based on the remaining live target tumor cells, calculated by dividing the total NIR object area at each time point by the value of each stimulation at time 0. The lower the cytotoxicity index, the better the cytotoxic potential. After the second stimulation, CISH KO untransduced Vδ1 T cells were associated with higher tumor cell killing compared to WT untransduced Vδ1 T cells only in the presence of IL-2. In the absence of IL-2, CISH KO CAR Vδ1 T cells had superior tumor control compared with WT CAR Vδ1 T cells. The results indicate that CISH KO enhanced the in vitro cytotoxicity of Vδ1 cells.

[0298] CAS9 CISH sgRNA: TGTACAGCAGTGGCTGGTGG (AGG) (SEQ ID NO: 96)

[0299] MAD7 CISH sgRNA: (TTTA) GGTGTACAGCAGTGGCTGGTG (SEQ ID NO: 97).

[0300] Example 12: CBL-B KO enhances the function of Vδ1 T cells

[0301] Healthy donor peripheral blood mononuclear cells (PBMCs) were used for activation, expansion, CRISPR gene editing, and engineering of Vδ1γδ T cells to express CAR. To knock out the CBL-B gene in Vδ1 T cells, ribonucleoprotein (RNP) complexes containing CRISPR-Cas9 (Integrated DNA Technologies) and CBL-B sgRNA were combined with activated Vδ1 T cells from PBMCs (P3 Primary Cell 4D-Nucleofector X Kit L, Lonza). The RNP complex was delivered to Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, cells were transferred to T flasks (Corning) containing X-Vivo15 (Lonza) for cell recovery and then transduced with a gamma retroviral vector encoding CAR and then expanded. Results are shown in Figures 27A-27B . Fig.27A ) To determine CBL-B KO efficiency, genomic DNA was extracted from cell pellets using the NucleoSpin tissue kit (MACHARY-NAGEL). The editing region was amplified by PCR using previously internally optimized primers. The PCR reaction was run on an agarose gel, and the prominent bands were excised and the gel was extracted using the NucleoSpin gel and PCR Cleanup kit (MACHARY-NAGEL). The extracted DNA was sequenced by Sanger sequencing (Sequetech). % indels were determined using the ICE analysis tool (Synthego). ( Fig.27B ) To demonstrate the enhanced function of CBL-B KO CAR transduced and untransduced Vδ1 T cells, the cytolytic activity against PSMA+ PC3 cell lines was evaluated using an in vitro repeated stimulation assay. PC3-PSMA NIR fluorescently labeled cell lines and effector cells were added to 96-well plates at an E:T ratio of about 3:1, with or without IL-2. Each stimulation was monitored for 3 days, and then fresh target cells were plated in another 96-well plate. The effector cells from each stimulation were then transferred to a plate containing fresh target cells. Co-cultures were monitored every 4 hours using Incucyte® SX5 (Satorius). The cytotoxicity index is based on the remaining live target tumor cells, calculated by dividing the total NIR object area at each time point by the value at time 0 for each stimulation.

[0302] Cas9 multi-guide sgRNA sequences:

[0303] AAGACUCUUUAAAGAAGGCA (SEQ ID NO: 93)

[0304] AGUACUCAUUCUCACUGAGU (SEQ ID NO: 94)

[0305] CGUAAAUGCUGAUAUGUAUC (SEQ ID NO: 95)

[0306] Cas9 single guide: TAATCTGGTGGACCTCATGA (AGG) (SEQ ID NO: 98).

[0307] Example 13: Roquin-1 KO enhances the function of Vδ1 T cells

[0308] Healthy donor peripheral blood mononuclear cells (PBMCs) were used for activation, expansion, CRISPR gene editing, and engineering of Vδ1γδ T cells to express CAR. To knock out the Roquin-1 gene in Vδ1 T cells, ribonucleoprotein (RNP) complexes containing CRISPR-Cas9 (Integrated DNA Technologies) and Roquin-1 sgRNA were combined with activated Vδ1 T cells from PBMCs (P3 Primary Cell 4D-Nucleofector X Kit L, Lonza). The RNP complexes were delivered into Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, cells were transferred to T flasks (Corning) containing X-Vivo15 (Lonza) for cell recovery and then transduced with a gamma retroviral vector encoding CAR and then expanded. Results are presented in Figures 28A-28B . Fig.28A )To determine Roquin KO efficiency, genomic DNA was extracted from cell pellets using the NucleoSpin tissue kit (MACHARY-NAGEL). The editing region was amplified by PCR using previously optimized primers. The PCR reaction was run on an agarose gel, and the prominent bands were excised and the gel was extracted using the NucleoSpin gel and PCR Cleanup kit (MACHARY-NAGEL). The extracted DNA was sequenced by Sanger sequencing (Sequetech). The % indels were determined using the ICE analysis tool (Synthego). Editing was first performed using 3 gRNA sequences at a ratio of 1:1:1 to demonstrate the ability to edit genes in Vd1 T cells, and then single-guide optimization was performed to identify the gRNA with the highest KO efficiency. ( Fig.28B) To demonstrate the enhanced function of Roquin-1 KO CAR transduced and untransduced Vδ1 T cells, the cytolytic activity against PSMA+ PC3 cell lines was evaluated using an in vitro repeated stimulation assay. PC3-PSMA NIR fluorescently labeled cell lines and effector cells were added to 96-well plates at an E:T ratio of approximately 3:1, with or without IL-2. Each stimulation was monitored for 3 days, and then fresh target cells were plated in another 96-well plate. The effector cells from each stimulation were then transferred to a plate containing fresh target cells. Co-cultures were monitored every 4 hours using Incucyte® SX5 (Satorius). The cytotoxicity index is based on the remaining live target tumor cells, calculated by dividing the total NIR object area at each time point by the value at time 0 for each stimulation.

[0309] Multi-guide sgRNA sequences:

[0310] AAGCCCAUCAGUUUGGGUUG (SEQ ID NO: 99)

[0311] UGUACAAGCUCCACAAUGGA (SEQ ID NO: 100)

[0312] CAAAUGGGCAAGCCUUGCGG (SEQ ID NO: 101)

[0313] Internally optimized single gRNA sequence: CCTGAATAAACTCCACCGCA (AGG) (SEQ ID NO: 102)

[0314] Example 14: ICAM-1 and CD58 KO enhances in vitro cell survival of CAR Vδ1 T cells in the presence of allogeneic PBMCs

[0315] Healthy donor peripheral blood mononuclear cells (PBMCs) were used for activation, expansion, CRISPR gene editing, and engineering of Vδ1γδ T cells to express CAR. To knock out the CISH gene in Vδ1 T cells, ribonucleoprotein (RNP) complexes consisting of CRISPR-Cas9 (IntegratedDNA Technologies) or -MAD7 (Aldevron) and ICAM-1 or CD58 sgRNA were combined with activated Vδ1 T cells from PBMC (P3 Primary Cell 4D-Nucleofector X Kit L, Lonza). The RNP complexes were delivered to Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, cells were transferred to T flasks (Corning) containing X-Vivo15 (Lonza) for cell recovery and then transduced with a gamma retroviral vector encoding CAR and then expanded. To determine the KO efficiency of ICAM-1 and CD58, WT (unedited), ICAM-1 KO, and CD58 KO CAR Vδ1 γδ T cells were stained with anti-ICAM-1, anti-CD58, or isotype control antibodies conjugated to PE (BioLegend) and acquired using Novocyte flow cytometry (Agilent Technologies). Figures 29A-29B . Fig.29A ) In CAR Vδ1 γδ T cells, the KO efficiency of ICAM-1 and CD58 KO was observed to be over 80%. ( Fig.29B )

[0316] In order to evaluate whether ICAM-1 and CD58 can enhance the survival of CAR Vδ1 T cells in the presence of allogeneic PBMC, a 10-day mixed lymphocyte reaction assay (MLR) was performed. In the presence of IL-2, WT (unedited), CISH KO, ICAM-1 KO and CD58 KO CAR Vδ1 γδ T cells (target cells) and allogeneic PBMC (effector cells) were co-cultured with an E:T ratio of 10:1. During co-culture, half of the culture medium was replaced with a fresh culture medium containing IL-2 every 2-3 days. On the 3rd, 6th and 10th days, cells were harvested from co-culture, and B7-H6 conjugated with APC (Adicet Bio production) was used for CAR+ and Vδ1+ γδ T cells were stained for CAR detection, and anti-Vδ1 antibodies conjugated with PE-CY7 (Adicet Bio production) were used for Vδ1 T cell detection. Cells were acquired using Novocyte flow cytometry to obtain absolute counts of double positive CAR+ Vδ1+ T cells. To determine the % target cell change at each time point, the absolute counts of WT CAR+ Vδ1+ γδ T cells were compared to the KO CAR+ Vδ1+ γδ T cell count conditions using the following formula: [(WT CAR+ Vδ1+ γδ T cell count - KO CAR+ Vδ1+ γδ T cell count) ÷ (WT CAR+ Vδ1+ γδ T cell count)] x 100. Based on the % target cell change relative to the WT CAR+ Vδ1+ γδ T cell count, only ICAM-1 KO and CD58 KO CAR+ Vδ1+ γδ T cells had increased % target change, indicating that disruption of ICAM-1 and CD58 reduced in vitro killing of allogeneic PBMCs, thereby improving cell survival.

[0317] CAS9 ICAM-1 sgRNA: AAAGUCAUCCUGCCCCGGGG (SEQ ID NO: 103)

[0318] MAD7 ICAM-1 sgRNA: TTTG / AATAGCACATTGGTTGGCTAT (SEQ ID NO: 104)

[0319] CAS9 CD58 sgRNA:AAAUAUAUGGUGUGUGUAU (SEQ ID NO: 105)

[0320] MAD7 CD58 sgRNA: TTTA / GACACTGTGTCAGGTAGCCTC (SEQ ID NO: 106)

[0321] The embodiments and examples described above are merely illustrative and non-restrictive. Those skilled in the art will recognize or be able to determine many equivalents of specific compounds, materials and procedures using only routine experiments. All such equivalents are considered to be within the scope of the appended claims and are covered by the appended claims.

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

Claims

1. A γδ T cell, comprising: A chimeric antigen receptor (CAR), wherein the CAR comprises a binding domain that recognizes a CD70 antigen, at least one co-stimulatory domain, and at least one intracellular signaling domain; and wherein the γδ T cells functionally express the binding domain of the CAR on the surface of the γδ T cells.

2. The γδ T cell of claim 1, wherein the binding domain comprises a full-length CD27 receptor having an amino acid sequence as shown in SEQ ID NO:

33.

3. The γδ T cell of claim 1, wherein the binding domain comprises a full-length CD27 receptor having an amino acid sequence as shown in SEQ ID NO:

91.

4. The γδ T cell of any one of claims 1 to 3, wherein the at least one co-stimulatory domain is selected from the group consisting of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, CD3C, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD70, CD80, CD83, CD86, CD134 (OX40), CD137 (4-1BB), CD278 (ICOS), FcR, LAT, NKD2C, SLP76, TRIM, and ZAP70, or a combination thereof.

5. The γδ T cell of claim 4, wherein the at least one co-stimulatory domain is 4-1BB.

6. The γδ T cell of any one of claims 1 to 5, wherein the at least one intracellular signaling domain is selected from CD3ζ, DAP12, LFA-1, and a repeat (2-5) DAP10 YINM motif.

7. The γδ T cell of claim 6, wherein the at least one intracellular signaling domain is CD3ζ.

8. The γδ T cell of any one of claims 1 to 7, wherein the CAR comprises the binding domain that recognizes the CD70 antigen, followed by a 4-1BB co-stimulatory domain, followed by a CD3ζ signaling domain.

9. The γδ T cell of any one of claims 1 to 8, wherein the CAR is encoded by an isolated nucleic acid operably linked to a regulatable promoter.

10. The γδ T cell of claim 9, wherein the isolated nucleic acid encoding the CAD encodes one or more additional polypeptides.

11. The γδ T cell of claim 10, wherein the one or more additional polypeptides is a lymphotoxin β receptor (LTBR), optionally wherein the LTBR encoded by the isolated nucleic acid has an amino acid sequence as shown in SEQ ID NO:

27.

12. The γδ T cell of claim 10, wherein the one or more additional polypeptides are dominant negative (dn) receptors for TGF-β; preferably wherein the dominant negative receptor for TGF-β is dnTGFβR2; optionally wherein the dnTGFβR2 encoded by the isolated nucleic acid has an amino acid sequence as shown in SEQ ID NO:

23.

13. The γδ T cell of claim 10, wherein the one or more additional polypeptides are truncated forms of human epidermal growth factor receptor (EGFRt); optionally wherein the isolated nucleic acid has an amino acid sequence as shown in SEQ ID NO:

19.

14. The γδ T cell of claim 10, wherein the one or more additional polypeptides is a dominant negative Fas (dnFas).

15. The γδ T cell of claim 10, wherein the one or more additional polypeptides is membrane-bound IL-12 (mbIL-12).

16. The γδ T cell of any one of claims 10 to 15, wherein the isolated nucleic acid encodes at least one cleavage polypeptide sequence; optionally wherein the at least one cleavage polypeptide sequence is a 2A self-cleavage polypeptide sequence selected from T2A, P2A, E2A and F2A self-cleavage polypeptide sequences.

17. The γδ T cell of claim 16, wherein the 2A self-cleaving polypeptide sequence is a P2A self-cleaving polypeptide sequence; optionally wherein the P2A self-cleaving polypeptide sequence encoded by the isolated nucleic acid has an amino acid sequence as shown in SEQ ID NO: 8, 77 or 78.

18. The γδ T cell of any one of claims 10 to 17, wherein the isolated nucleic acid encodes SEQ ID NO: 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69 or 71.

19. The γδ T cell of any one of claims 10 to 17, wherein the isolated nucleic acid encodes SEQ ID NO:

57.

20. The γδ T cell of any one of claims 1 to 19, further comprising at least one disrupted endogenous gene.

21. The γδ T cell of claim 20, wherein the at least one disrupted endogenous gene is selected from the group consisting of cytokine-induced SH2-containing protein (CISH), Cbl proto-oncogene B (CBL-B), zinc finger protein 91 (ZFP91) and Roquin or a group consisting thereof.

22. The γδ T cell of claim 20, wherein the at least one disrupted endogenous gene is CD58 and / or ICAM-1.

23. The γδ T cell of any one of claims 1 to 22, wherein the γδ T cell exhibits in vitro and / or in vivo tumor cell killing activity against blood and / or solid tumor cells that display cell surface expression of the CD70 antigen; preferably wherein the tumor cell killing activity persists, persists about, persists at least, or persists at least about 6 days to 180 days after the first contact with blood and / or solid tumor cells that display cell surface expression of the CD70 antigen.

24. The γδ T cell of claim 23, wherein the γδ T cell proliferates in response to contact with the hematological and / or solid tumor cells that display cell surface expression of the CD70 antigen; preferably wherein the γδ T cell proliferation or increased γδ T cell proliferation persists, persists about, persists at least, or persists at least about 6 days to 180 days after the first contact with the blood and / or solid tumor cells that display cell surface expression of the CD70 antigen.

25. The γδ T cell of claim 23 or 24, wherein the γδ T cell expresses proinflammatory cytokines comprising tumor necrosis factor α or interferon γ after contact with the blood and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen.

26. The γδ T cell of any one of claims 1 to 25, wherein the γδ T cell is a δ1 γδ T cell.

27. A pharmaceutical composition comprising a plurality of γδ T cells according to any one of claims 1 to 26, wherein the plurality comprises at least about 10 7 γδ T cells, preferably about 10 8 from γδ T cells to about 10 11 γδT cells; optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

28. The pharmaceutical composition of claim 27, wherein the plurality comprises at least 60%, 80% or about 60% or 80% to about 90% or 95% δ1, δ2, δ3 or δ4 γδ T cells, preferably δ1 or δ2 γδ T cells, more preferably δ2 - A composition of γδ T cells, most preferably δ1 γδ T cells.

29. A method for producing a pharmaceutical composition as claimed in claim 27 or 28, wherein the method comprises ex vivo expansion of the γδ T cells, wherein the ex vivo expansion is performed before and / or after transfection of the isolated nucleic acid.

30. A method for killing blood and / or solid tumor cells expressing cell surface expression of the CD70 antigen, the method comprising contacting the blood and / or solid tumor cells with a tumor cell killing effective amount of the γδ T cells according to any one of claims 1 to 27 or the pharmaceutical composition according to claim 27 or 28.

31. The method of claim 30, wherein the method comprises introducing a therapeutically effective amount of the γδ T cells or the pharmaceutical composition into a host organism comprising the blood and / or solid tumor cells.

32. The method of claim 30 or 31, wherein the method further comprises administering simultaneously or sequentially one or more methods for increasing common γ chain cytokines; optionally wherein the method further comprises administering IL-2 or IL-15, or secreting one or more common γ chain cytokines from the introduced γδ T cells.

33. A method of treating cancer in a subject in need thereof, the method comprising: Administration of a therapeutically effective amount of the γδ T cells of any one of claims 1 to 26 or the pharmaceutical composition of claim 27 or 28, wherein the cancer comprises blood and / or solid tumor cells that exhibit cell surface expression of CD70.

34. The method of claim 33, wherein the method comprises performing multiple administrations of the γδ T cells, wherein the intervals between the multiple administrations are at least about one week, preferably at least about 2, 3, 4, 5, 6, 7, 8 or 12 weeks, and / or wherein the multiple administrations are no more than once every 6 or 12 months.

35. A method of reducing or inhibiting a graft-versus-host reaction of immune cells administered to a subject in need thereof, the method comprising administering a therapeutically effective amount of the γδ T cells of any one of claims 1 to 26, or the pharmaceutical composition of claim 27 or 28.

36. The method of claim 35, wherein the γδ T cells comprise dual CARs that bind to CD70 and another tumor-associated antigen.

37. The method of claim 35 or 36, wherein the method further comprises co-administering a therapeutically effective amount of γδ T cells as described in any one of claims 1 to 26 and T cells or NK cells comprising a CAR that binds to another tumor-associated antigen.

Images