Application of cholesterol sulfate in preparation of medicine for treating atopic dermatitis

Abstract

The invention provides application of cholesterol sulfate or a derivative thereof in preparation of a composition for treating atopic dermatitis or relieving symptoms of atopic dermatitis. The cholesterol sulfate or the derivative thereof is found to be capable of inhibiting keratinocyte generation and TSLP release so as to inhibit II-type inflammation formation, and AD can be effectively treated or prevented and symptoms of AD can be relieved. The invention also provides an external medicine or cosmetic containing the cholesterol sulfate or the derivative thereof.

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and in particular relates to the application of cholesterol sulfate or its derivatives in treating atopic dermatitis. Background Art

[0002] Atopic dermatitis (AD) is a chronic inflammatory skin disease based on genetic predisposition and impaired skin barrier function, mainly involving type 2 immune responses and multiple immune responses (Langan SM, Irvine AD, Weidinger S. Atopic dermatitis. Lancet 2020; 396: 345-60.). The main clinical manifestations are severe itching and recurrent eczema-like lesions. The Global Burden of Disease study showed that the prevalence of atopic dermatitis in children is 15% to 20%, and the prevalence in adults is as high as 10% (Stander, S. Atopic Dermatitis J. NEngl J Med, Mar 25, 2021, 384(12): 1136-1143.). The prevalence of AD among urban children aged 1-7 years in my country is 12.94% (Guo Y, Li P, Tang J et al. Prevalence of Atopic Dermatitis in Chinese Children aged 1-7 years. Sci Rep 2016; 6:29751.), while the overall prevalence of AD among infants aged 0-1 year is as high as 30.48% (Guo Y, Zhang H, Liu Q et al. Phenotypic analysis of atopic dermatitis in children aged 1-12 months: elaboration of novel diagnostic criteria for infants in China and estimation of prevalence. J Eur Acad Dermatol Venereol 2019; 33:1569-76.). Due to its high incidence and the significant psychological and financial burden it places on patients and their families, the disease has impacted the healthy development of some adolescents.

[0003] Studies have found that the core pathogenesis of AD is skin barrier dysfunction and immune imbalance, and the two interact with each other. After the skin barrier is damaged, the body's responsiveness to external stimuli such as dust mites increases, inducing keratinocytes to secrete alarmins such as thymic stromal lymphopoietin (TSLP), IL-33, and IL-25. TSLP is an important molecule that mediates type II immune responses and is an important initiating factor in AD. It is also an important inflammatory mediator that causes itching (Ebina-Shibuya R, Leonard WJ. Role of thymic stromal lymphopoietin in allergy and beyond. Nature Reviews Immunology 2022.), and is believed to play a key role in the onset of AD.

[0004] Traditional treatments for AD primarily rely on topical medications, with systemic therapy being used for severe cases. Common topical medications include glucocorticoids (TCSs) and calcineurin inhibitors (TCIs). In recent years, topical small molecule drugs such as JAK inhibitors have also made some progress (Bieber T. Atopic dermatitis: an expanding therapeutic pipeline for a complex disease. Nat Rev Drug Discov 2022; 21: 21-40.). All of these drugs, without exception, inhibit immune cells. While effective quickly, they all suffer from the problem of relapse or even rebound after discontinuation. Long-term, frequent, or excessive use can cause significant toxic side effects on the systemic or local skin. Studies have shown that intervention strategies targeting TSLP have great potential and clinical application value. Currently, in clinical practice, apart from monoclonal antibodies targeting TSLP in clinical trials, there are no other specific intervention drugs or methods targeting TSLP, especially those that target keratinocytes through topical medications. Therefore, targeting keratinocyte TSLP release for the treatment of atopic dermatitis is of great originality and significance. Summary of the Invention

[0005] Through the study and comparison of various active molecules, the applicants of the present invention discovered for the first time that cholesterol sulfate (CS) has the effect of inhibiting keratinocytes from producing TSLP (thymic stromal lymphopoietin), which makes CS an important substance for inhibiting the initial formation of type II inflammation.

[0006] There are few reports on the application of CS and its analogs in the prior art. Currently, only the sodium salt of CS (cholesteryl sodium sulfate, SCS) is available on the market as a complex with amphotericin. CN114306350A describes the effectiveness of 5-cholesten-3β-ol sodium sulfate (SCS) in preventing sepsis and its complications.

[0007] CN109862787A describes the use of sodium oxidized cholesterol sulfate (OCS) to treat inflammatory skin diseases. In Example 2 of this patent application, 5-cholestene-3,25-diol, 3-sodium sulfate (25HC3S) was subcutaneously injected to treat psoriasis model mice, and it was believed that the skin lesions at the injection site could be improved. In Example 3, 0.5 ml of a moisturizing lotion containing 5 mg / ml 25HC3S was applied externally every three days for a total of three times to treat a case of chronic dermatitis caused by poison ivy, and it was believed that improvement was achieved. However, these results are not sufficient to support the conclusion that OCS can treat inflammatory dermatitis, and have even been denied by subsequent studies: On the one hand, according to literature reports, 10%-30% of patients with atopic dermatitis (eczema) can achieve significant improvement when given placebo treatment (Paller AS, Tom WL, Lebwohl MG et al. Efficacy and safety of crisaborole ointment, anovel, nonsteroidal phosphodiesterase 4 (PDE4) inhibitor for the topical treatment of atopic dermatitis (AD) in children and adults. J Am Acad Dermatol 2016; 75: 494-503.e6.; Bieber T, Simpson EL, Silverberg JI et al. Abrocitinib versus Placebo or Dupilumab for Atopic Dermatitis. New Engl J Med 2021; 384: 1101-12.). Poison ivy is a well-known native and ornamental plant in Europe and has been identified as a common allergen causing contact dermatitis (Paulsen E, Christensen LP, Andersen KE. Dermatitis from common ivy (Hederahelix L. subsp. helix) in Europe: past, present, and future. Contact Dermatitis. 2010 Apr; 62(4): 201-9.). Contact dermatitis has a higher chance of improvement after being isolated from the allergen. Therefore, based solely on individual case treatment results without theoretical support, it is impossible to confirm that oxidized cholesterol sulfate has the effect of treating inflammatory skin diseases.On the other hand, literature reports that cholesterol sulfate can activate Th17 cell-specific transcription factors and increase IL-17A (Hu X, Wang Y, Hao LY et al. Sterol metabolism controls TH17 differentiation by generating endogenous RORγagonists. Nature Chemical Biology 2015; 11: 141-7.), which theoretically has the effect of aggravating psoriasis. This conclusion was verified in the psoriasis model mice of the applicant of the present invention, that is, topical cholesterol sulfate has no therapeutic effect on psoriasis in mice.

[0008] Cholesterol sulfate (CS) is a major steroid sulfate in human plasma. It is formed in vivo by the sulfation of the hydrogen atom at the third position of the cholesterol (C) molecule by hydroxysteroidsulfotransferase 2B1 (SULT2B1). Cholesterol sulfate or its derivatives include, but are not limited to, CS or its pharmaceutically acceptable salts (e.g., sodium, potassium, calcium, lithium, ammonium, etc.), such as 5-cholesten-3β-ol sulfate, sodium 5-cholesten-3β-ol sulfate, potassium 5-cholesten-3β-ol sulfate, and related isomeric structures and solvates.

[0009] The structural formulas of some compounds are as follows:

[0010]

[0011] The present invention discovered that CS and / or its derivatives inhibit TSLP production by binding to keratinocyte pyruvate kinase isoenzyme 2 (PKM2), thereby suppressing type II inflammation. This has significant clinical value, including the treatment of atopic dermatitis. Formulating CS and / or its derivatives into pharmaceuticals or cosmetics would represent a novel approach to treating AD.

[0012] The present invention provides use of cholesterol sulfate or its derivatives in preparing a composition for inhibiting keratinocytes from producing TSLP.

[0013] The present invention provides use of cholesterol sulfate or its derivatives in preparing a composition for inhibiting type II inflammation.

[0014] The present invention also aims to provide the use of cholesterol sulfate or its derivatives in preparing a composition for treating or preventing atopic dermatitis. Preferably, the treatment of atopic dermatitis is to relieve atopic dermatitis inflammation, improve rash, relieve dry skin, or relieve itching; preferably, the rash is selected from erythema, papules, exudation, crusting, hypertrophy, and lichenoid thickening.

[0015] According to the present invention, the cholesterol sulfate derivative includes tautomers, solvates, or pharmaceutically acceptable salts thereof of cholesterol sulfate. Cholesterol sulfate or its derivative is particularly selected from 5-cholesten-3β-ol sulfate, 5-cholesten-3β-ol sodium sulfate, 5-cholesten-3β-ol potassium sulfate, or related isomeric structures or solvates thereof.

[0016] According to the present invention, the above therapeutic use of cholesterol sulfate or its derivatives is preferably achieved by topical administration of cholesterol sulfate or its derivatives to the skin. Therefore, the composition is preferably a pharmaceutical composition or cosmetic for external use on the skin.

[0017] The present invention also provides a skin external-use pharmaceutical composition and cosmetics for treating or preventing AD, which have minimal side effects, particularly minimal skin irritation, clear efficacy, and can be used for a long time.

[0018] In the external pharmaceutical composition or cosmetic, the weight percentage content of cholesterol sulfate or its derivatives is 0.01%-2% based on cholesterol sulfate, for example, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, 0.4%, 0.45%, 0.5%, 0.5% or more. 5%, 0.6%, 0.65%, 0.7%, 0.75%, 0.8%, 0.85%, 0.9%, 0.95%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, etc., preferably 0.09-1%, more preferably 0.2-0.8%, especially 0.4%-0.75%, more preferably 0.45%-0.7%.

[0019] The topical pharmaceutical composition and cosmetics can be in any topical administration form such as a gel, cream, lotion, ointment, foam, spray, or patch. In some embodiments of the present invention, the topical pharmaceutical composition and cosmetics are in the semi-solid form of an ointment or cream. Based on the ease of use and the effect of use, the cream form is preferred. The cream can mainly include two parts: cholesterol sulfate or its derivatives as the active substance, and a cream base as a carrier. The cream base can contain three parts of excipients conventionally used in the preparation of creams in the art, such as excipients constituting the oil phase, excipients constituting the aqueous phase, and an emulsifier. Co-emulsifiers, stabilizers, etc. can also be added. The topical pharmaceutical composition and cosmetics can be prepared according to conventional preparation methods in the art.

[0020] The external pharmaceutical composition and cosmetic can be used 1-3 times a day, preferably 2-3 times a day.

[0021] Furthermore, the cholesterol sulfate or its derivatives and the composition containing cholesterol sulfate or its derivatives provided by the present invention have the effect of treating or preventing atopic dermatitis, relieving atopic dermatitis inflammation, improving rash (for example, relieving erythema, papules, exudation, scabs, hypertrophy, lichenoid thickening, etc.), relieving dry skin, or relieving symptoms such as itching.

[0022] The atopic dermatitis may be mild, moderate, or severe. In some embodiments of the present invention, mild or moderate atopic dermatitis is preferred. For mild or moderate atopic dermatitis, cholesterol sulfate or its derivatives may be used alone or in combination with other drugs. In some embodiments of the present invention, severe atopic dermatitis is preferred. For severe atopic dermatitis, cholesterol sulfate or its derivatives are preferably used in combination with other drugs.

[0023] The severity of the disease can be graded using AD severity assessment methods commonly used in the art, such as the AD score (SCORAD), the Eczema Area and Severity Index (EASI), the Investigator's Global Assessment (IGA), the Patient Eczema Self-Examination Rating Scale (POEM), the ADCT score (ADCT), the Peak Pruritus Numeric Rating Scale (peak pruritus NRS), the Dermatology Life Quality Index (DLQI), etc.

[0024] In some embodiments of the present invention, the severity of AD is assessed and graded using the Investigator Global Assessment (IGA). IGA divides severity into 6 levels (0-5 points) based on the doctor's subjective judgment: 0: no skin lesions, no inflammatory signs of AD; 1: almost no skin lesions, only noticeable erythema and papules / infiltration; 2: mild skin lesions, mild erythema and papules / infiltration; 3: moderate skin lesions, moderate erythema and papules / infiltration; 4: severe skin lesions, severe erythema and papules / infiltration; 5: very severe, with severe erythema and papules / infiltration with exudation and crusting. In some embodiments of the present invention, the atopic dermatitis patient is a patient with an IGA score of 0-3. In some embodiments of the present invention, the treatment of atopic dermatitis is to reduce the patient's IGA score after treatment by at least 1 level, or at least 2 levels, or at least 3 levels compared to the IGA score before treatment.

[0025] In some embodiments of the present invention, the peak pruritus NRS is used to assess the pruritus of the patient's AD. The peak pruritus NRS is a patient self-report used to assess the pruritus condition in the past 24 hours. 0 points represent no pruritus and 10 points represent the worst pruritus imaginable. The patient scores the worst pruritus experienced in the past 24 hours. In some embodiments of the present invention, the treatment of atopic dermatitis is to reduce the patient's NRS score after treatment by at least 5%, or at least 10%, or at least 15%, or at least 20%, or at least 25%, or at least 30%, or at least 35%, or at least 40%, or at least 45%, or at least 50%, or at least 55% compared to the NRS score before treatment.

[0026] Drugs that can be used in combination include but are not limited to: glucocorticoids (e.g., hydrocortisone, triamcinolone acetonide, mometasone furoate, etc.), tacrolimus, pimecrolimus, antibiotics (e.g., mupirocin, fusidic acid, erythromycin, tetracycline, quinolone, etc.), antihistamines (e.g., loratadine, mizolastine, ebastine, etc.), immunosuppressants (e.g., cyclosporine, mycophenolate mofetil, interferon-γ, azathioprine, methotrexate, tripterygium wilfordii polyglycosides, thalidomide, hydroxychloroquine, JAK inhibitors, etc.), and monoclonal antibodies (e.g., dupreu, etc.).

[0027] The cholesterol sulfate or its derivatives of the present invention can effectively regulate AD inflammation mainly by inhibiting the generation and release of TSLP by keratinocytes, thereby inhibiting the formation of type II inflammation.

[0028] Definition of terms:

[0029] “And / or” will be taken as a specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” used in phrases such as “A and / or B” is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” used in phrases such as “A, B, and / or C” is intended to cover each of the following: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0030] "Comprising" and "including" have the same meaning and are intended to be open ended and permit, but not require, the inclusion of additional elements or steps. When the terms "comprising" or "including" are used herein, the terms "consisting of" and / or "consisting essentially of" are also included and disclosed. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 CS synthase knockdown (SULT2B1 sh) keratinocyte cell line was constructed using shRNA. After stimulating the cells with inflammatory factors TNFα (10 ng / ml) and IL-4 (50 ng / ml) for 6 hours, the expression levels of TSLP and IL-6 in the cells were statistically analyzed. The results showed that the expression level of TSLP in SULT2B1 sh keratinocytes was significantly increased, while the expression level of IL-6 was significantly decreased.

[0032] Figure 2 Keratinocyte cell lines were pretreated with different concentrations of SCS and stimulated with inflammatory factors TNFα (10 ng / ml) and IL-4 (50 ng / ml) for 6 hours. The expression levels of TSLP and IL-6 in the cells were statistically analyzed. The results showed that 80 μM SCS inhibited the expression level of TSLP and increased the expression level of IL-6.

[0033] Figure 3 The results of transcriptome sequencing of keratinocyte cell lines without inflammatory stimulation, inflammatory stimulation, and inflammatory stimulation of keratinocyte cell lines pretreated with SCS showed that SCS inhibited the Toll-like receptor signaling pathway, Jak-STAT signaling pathway, and cytokine-cytokine receptor signaling pathway in the inflammatory pathway.

[0034] Figure 4 In a calcipotriol-induced atopic dermatitis-like model in mice, photos of mouse ears and statistical graphs of skin thickness after SCS treatment showed that SCS significantly improved atopic dermatitis symptoms, with 0.3% SCS having the strongest effect, and 0.5% SCS exacerbating the AD phenotype in mice.

[0035] Figure 5 In the calcipotriol-induced atopic dermatitis model in mice, after SCS treatment, HE-stained photos of mouse ear tissue sections and pathological evaluation statistical charts showed that 0.3% SCS improved the AD pathology of mice, while 0.5% SCS aggravated the AD pathology of mice.

[0036] Figure 6 Flow cytometry was used to detect Th2 immune cells in the skin lesions of AD mice (CD 3+ CD 4+ IL4 + ) and Th17 immune cells (CD 3+ CD 4+ IL17A +), the results showed that SCS inhibited the Th2 immune response of AD mice phenotype and aggravated the Th17 immune response. 0.3% SCS could inhibit the infiltration of Th2 immune cells, while 0.3% SCS and 0.5% SCS could increase the infiltration of Th17 immune cells.

[0037] Figure 7 Imiquimod was used to induce a psoriasis-like phenotype in the mouse ears. After administration of SCS at different concentrations (0.05%, 0.1%, and 0.3%), photos of the mouse ears, statistical graphs of the mouse ear thickness, and statistical graphs of the PASI scores showed that SCS had no effect on improving psoriasis symptoms.

[0038] Figure 8 Flow cytometry was used to detect Th17 immune cells (CD3+CD4+IL17A+) in the skin lesions of psoriasis mice. The results showed that SCS aggravated the Th17 immune response in psoriasis mice.

[0039] Figure 9 In the clinical trial, changes in NRS scores in the experimental and control groups during treatment, where G1-G5 represent groups 1, 2, 3, 4, and 5, respectively.

[0040] Figure 10 In the clinical trial, the NRS random (intercept) effect model was used to analyze the time / dose-grouping factor interaction diagram for the experimental group and the control group after 4 weeks of treatment. DETAILED DESCRIPTION

[0041] To make the purpose, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application are described in detail below. It should be noted that the embodiments are not intended to limit the scope of protection of the present invention. Those skilled in the art understand that any improvements and changes made based on the present invention are within the scope of protection of the present invention.

[0042] The conventional reagents used in the following examples are all commercially available. The biological experiments performed are conventional biological experiments in the art and can be performed according to the corresponding experimental manuals or kit instructions.

[0043] Example 1

[0044] The ointment was prepared using the sodium salt of CS (SCS). Five concentrations of the composition were prepared, with the weight percentage of the active ingredient SCS being 0%, 0.1%, 0.3%, 0.5% and 0.7%.

[0045] 1) Preparation prescription

[0046]

[0047]

[0048] 2) Preparation method

[0049] i. Heat and melt squalane, caprylic / capric triglyceride, shea butter, dimethicone, cetearyl alcohol, glyceryl stearate, and sodium stearoyl lactylate to form a uniform mixture, and stir to obtain an oil phase.

[0050] ii. Take some purified water, add sucrose stearate and SCS and stir thoroughly to disperse and dissolve SCS in the solution to obtain a mixed aqueous solution.

[0051] iii. Take the mixed aqueous solution, purified water, allantoin, disodium EDTA, p-hydroxyacetophenone, and glycerin, heat and stir to obtain an aqueous phase.

[0052] iv. Slowly add the oil phase to the aqueous phase for emulsification. Then, add the thickeners ammonium acryloyldimethyltaurate / VP copolymer, 1,2-hexanediol, and tocopheryl acetate, and continue stirring until the mixture reaches room temperature to obtain the SCS cream.

[0053] 3) Performance testing

[0054] The five creams obtained in Example 1 were tested according to QB / T 1857-2013 "Moisturizing Creams". The results are shown in the following table:

[0055]

[0056]

[0057] Example 2 Mechanism study proves

[0058] (I) Relationship between CS and TSLP and IL-6 expression levels

[0059] To clarify the correlation between the expression levels of TSLP and IL-6 and CS, we constructed a CS synthase knockdown (SULT2B1 sh) keratinocyte cell line using shRNA. The cells were stimulated with inflammatory factors TNFα (10 ng / ml) and IL-4 (50 ng / ml) for 6 hours. The samples were then collected and subjected to real-time fluorescence quantitative PCR to detect the expression levels of TSLP and IL-6.

[0060] Note: SULT2B1 shRNA sequence:

[0061] SULT2B1 sh F:

[0062] GATCGGCGACTGGAAGAACCACTTCATCAAGAGTGAAGTGGTTCTTCCAGTCGCTTTTT

[0063] SULT2B1 sh R:

[0064] AATTAAAAAGCGACTGGAAGAACCACTTCACTCTTGATGAAGTGGTTCTTCCAGTCGCC

[0065] The results are shown in the attached Figure 1 The results showed that compared with the empty control, the expression level of TSLP in keratinocytes of SULT2B1 sh was significantly increased, and the expression level of IL-6 was significantly decreased.

[0066] (II) CS simultaneously inhibits TSLP and increases IL-6 expression

[0067] TSLP and IL-6 are important inflammatory factors that mediate Th2 and Th17 immune responses, respectively. Keratinocytes were pretreated with various concentrations of SCS (0.5 μM, 1 μM, 10 μM, 40 μM, and 80 μM) for 18 hours. Keratinocytes were then stimulated with the inflammatory factors TNFα (10 ng / ml) and IL-4 (50 ng / ml) for 6 hours. Samples were collected and assayed for TSLP and IL-6 expression.

[0068] The results are shown in the attached Figure 2 The results showed that compared with the inflammatory stimulation group, 80μM SCS significantly inhibited TSLP expression and increased IL-6 expression. These results suggest that SCS may inhibit Th2 immunity and enhance Th17 immunity by acting on keratinocytes, suggesting that SCS can treat atopic dermatitis but has no benefit for psoriasis, and may even aggravate it.

[0069] (III) CS inhibits inflammation-related pathways

[0070] Experimental method: Transcriptome sequencing was performed on the blank group (no inflammatory stimulation), inflammatory stimulation group, and SCS treatment group respectively; the inflammatory stimulation group used the inflammatory factors TNFα (10ng / ml) and IL-4 (50ng / ml) to stimulate the keratinocyte cell line for 6 hours; the SCS treatment group was pre-treated with 80μM SCS for 18 hours, and then the inflammatory factors TNFα (10ng / ml) and IL-4 (50ng / ml) were added to stimulate the keratinocyte cell line for 6 hours.

[0071] The results of transcriptome sequencing are shown in the Appendix. Figure 3The results showed that SCS could significantly inhibit inflammation-related pathways, such as the Toll-like receptor signaling pathway, the Jak-STAT signaling pathway, and the cytokine-cytokine receptor signaling pathway; this result suggests that SCS has a very strong function in inhibiting inflammation.

[0072] (IV) CS can significantly improve the clinical phenotype of atopic dermatitis model mice

[0073] 1 nM calcipotriol (MC903) was dissolved in 20 μl of anhydrous ethanol, and 10 μl was evenly applied to the ventral and dorsal sides of the mouse ears for 14 consecutive days to induce atopic dermatitis-like phenotypes such as redness, scaling, scabs, and scratching in mice. Daily, 6 hours after MC903 application, mice were treated with different concentrations (weight-to-volume ratio, 0.05%, 0.1%, 0.3%, and 0.5%) of SCS (SCS dissolved in anhydrous ethanol). The ears of mice in the control group were treated with the same volume and concentration of MC903, and 6 hours later, anhydrous ethanol was applied to both ears. Six mice were included in each group (n=6). After 14 days, the thickness of the mouse ears was measured, and the ears were stained with hematoxylin-eosin for pathological evaluation.

[0074] The results are shown in the attached Figure 4 、 5 .

[0075] Depend on Figure 4 It can be seen that SCS can significantly improve the symptoms of atopic dermatitis, especially 0.3% SCS has the best effect, which can significantly improve the AD phenotype of mice, while 0.5% SCS will further aggravate the AD phenotype of mice. This result suggests that SCS has strong concentration selectivity for the treatment of AD.

[0076] Depend on Figure 5 It can be seen that 0.3% SCS can improve the AD pathology of mice, while 0.5% SCS will further aggravate the AD pathology of mice. This result further proves that 0.3% SCS can significantly improve the AD phenotype of mice, while 0.5% SCS will further aggravate the AD phenotype of mice.

[0077] Flow cytometry was used to detect Th2 immune cells in the skin lesions of AD mice (CD 3+ CD 4+ IL4 + ) and Th17 immune cells (CD 3+ CD 4+ IL17A + ).

[0078] The results are shown in the attached Figure 6The results showed that SCS can suppress the Th2 immune response of AD mice and aggravate the Th17 immune response. 0.3% SCS inhibited the infiltration of Th2 immune cells, while 0.3% SCS and 0.5% SCS increased the infiltration of Th17 immune cells. These results suggest that 0.3% SCS can improve AD in mice by regulating the balance of Th2 and Th17 immune responses.

[0079] (V) CS cannot significantly improve the clinical phenotype of psoriasis model mice

[0080] 30 mg of 5% imiquimod cream was evenly applied to the ventral and dorsal sides of the mouse ears for 6 consecutive days to induce psoriasis-like phenotypes such as scaling, crusting, and redness. Daily treatment with SCS (SCS dissolved in anhydrous ethanol) at varying concentrations (weight to volume ratio, 0.05%, 0.1%, and 0.3%) was administered 6 hours after imiquimod cream application. A control group of mice received an even application of imiquimod cream, followed by an application of anhydrous ethanol to both ears 6 hours later. Each group consisted of 4-7 mice (n=4-7). Ear thickness was measured daily and statistically analyzed. The PASI (Psoriasis Area and Severity Index) score was assessed on the seventh day. The PASI score encompasses redness, scaling, and ear thickness, each scored on a scale of 0 to 4 (0: no change; 1: mild; 2: moderate; 3: moderately severe; 4: severe). The sum of the scores for each component was used to calculate the PASI score.

[0081] The results are shown in the attached Figure 7 .

[0082] Depend on Figure 7 It can be seen that all concentrations of SCS could not improve the psoriasis phenotype, there was no difference in the daily ear thickness of mice among the groups, and there was no difference in the PASI score of mice among the groups.

[0083] Flow cytometry was used to detect Th17 immune cells (CD 3+ CD 4+ IL17A + ).

[0084] The results are shown in the attached Figure 8 The results showed that both 0.1% SCS and 0.3% SCS could aggravate the Th17 immune response in psoriasis mice.

[0085] Example 3 Clinical Trial

[0086] The following clinical study was conducted using the blank cream provided in Example 1 of the present invention and SCS creams at concentrations of 0.1%, 0.3%, 0.5%, and 0.7%. The purpose of this study was to determine the optimal concentration of topical SCS cream for the treatment of mild to moderate AD in children, adolescents, and adults, and to preliminarily evaluate its efficacy and safety. The experimental procedures were as follows:

[0087] Patients aged 6-70 years with mild to moderate AD were recruited and randomly assigned to the experimental group and the control group in a ratio of 1:1:1:1:1. The experimental group received 0.1%, 0.3%, 0.5%, and 0.7% SCS cream, and the control group received placebo (hereinafter referred to as group 1 as the control group, and groups 2-5 as the experimental group receiving 0.1%, 0.3%, 0.5%, and 0.7% SCS cream, respectively). This trial was a single-center, randomized, double-blind, placebo-controlled trial. All samples were packaged in tin foil inner packaging and group-labeled to ensure double blindness. All subjects signed informed consent before the trial and received the same standard drug treatment regimen. Patients took the drug twice a day for 4 weeks. Changes in IGA values ​​and EASI values ​​in each group were evaluated at baseline (D0), D14 (±2d), and D28 (±2d). At the same time, the itching of each group was evaluated at baseline (D0), D3, D7, D14, and D28.

[0088] This study used the IGA to evaluate AD severity. Itch intensity is an important indicator for determining AD severity and evaluating treatment efficacy. The Chinese chronic pruritus guidelines recommend the use of the numerical rating scale (NRS) for evaluating AD pruritus.

[0089] The primary endpoints of the trial study included the proportion of subjects whose IGA score reached 0 or 1 at week 4, with a decrease of 2 points or more, and the change in the NRS score for pruritus from baseline to week 4. The trial stipulated that the IGA assessed the severity of AD (excluding the scalp) on a 0-5 point scale, ranging from 0 (clear) to 5 (worst), with higher scores indicating more severe AD. Severity classification scale: 0 = completely clear (mild residual hypopigmentation / hyperpigmentation, no erythema or induration or papules, no exudation or crusting), 1 = almost clear (faint pink erythema, barely perceptible induration or papules, no exudation or crusting), 2 = mild (light pink erythema, mild induration or papules, no exudation or crusting), 3 = moderate (pink red erythema, moderate induration or papules, with or without exudation or crusting), 4 = severe (erythema with severe induration or papules, exudation or crusting) and 5 = very severe (deep or bright severe erythema and papules / infiltrates with severe induration or papules accompanied by exudation and crusting). Response to IGA treatment was defined as an IGA score of clear (0) or almost clear (1), with a decrease of at least 2 grades compared to baseline. NRS values ​​were calculated from the scores, assessed by the patients and recorded in the follow-up questionnaire provided by the sponsor.

[0090] Patient inclusion criteria:

[0091] 1) Subjects aged 6-70 years, male or female;

[0092] 2) clinical diagnosis of atopic dermatitis (AD) according to the criteria of Hanifin and Rajka;

[0093] 3) Rash covering 3-10% of the skin area (including erythema, exudation, nodules, hypertrophy, lichenification, etc.), excluding simple dry skin;

[0094] 4) Investigator's Inactive Global Assessment (IGA) score of 2-3 at baseline;

[0095] 5) The subject or his / her guardian agrees to participate in the trial and has signed the informed consent form;

[0096] Patient exclusion criteria:

[0097] 1) Those who are known to be allergic to cholesterol sulfate and its derivatives;

[0098] 2) Patients who have used phototherapy, immunoglobulin, biological agents, systemic glucocorticoids, or immunosuppressants (such as cyclosporine, mycophenolate mofetil, interferon-γ, azathioprine, methotrexate, tripterygium wilfordii polyglycosides, thalidomide, hydroxychloroquine, etc.) within 1 month;

[0099] 3) Skin infection at the lesion site;

[0100] 4) Patients who regularly used topical hormones within 2 weeks before enrollment.

[0101] Patient dropout criteria:

[0102] 1) The subjects have poor compliance and cannot use the study drugs or follow up regularly according to the study plan;

[0103] Note: Refers to patients using the drug less than once a day or more than six times a day on average;

[0104] 2) The subject violates the study protocol and uses prohibited concomitant medications during the study drug treatment period;

[0105] 3) The subject may unconditionally and proactively request to withdraw the informed consent and withdraw from this clinical trial;

[0106] Patient discontinuation criteria:

[0107] 1) The researcher believes that the risks faced by the subject in continuing to participate in the trial outweigh the possible benefits;

[0108] 2) The disease cannot be controlled by topical study medication and systemic medication is required;

[0109] 3) The subject experiences serious adverse events during the entire clinical trial and the trial needs to be terminated;

[0110] Statistical methods:

[0111] 1) According to the data type

[0112] 2) Categorical variables were expressed as frequencies (percentages), and continuous variables were described as means (± standard error SEM).

[0113] 3) Component differences of categorical variables were evaluated using the Pearson Chi-square test or Fisher's exact test, and component differences of normally distributed continuous variables were tested using one-way analysis of variance (ANOVA). If significant differences were found, post hoc tests using Tukey's multiple comparison test were performed to further analyze the differences between the two groups.

[0114] 4) PP-NRS was visited at multiple time points, and repeated measurement data analysis was performed using a mixed-effects model based on the scoring results. The relationship between the change in itching intensity and the duration of medication was observed to explore whether there were differences in the trend of change among the different treatment groups.

[0115] 5) All analyses were performed using SPSS 23.0 and R 4.2.1, and graphics were prepared using GraphPad Prism 8.0.1 and Origin 8.0. Statistical significance was considered to be a two-sided p-value < 0.05.

[0116] The baseline conditions of the subjects are shown in Table 1.

[0117] Table 1 Basic information and medical history of the subjects

[0118]

[0119] There were no statistically significant differences in age, disease duration, allergy history, family history, and NRS among the groups at baseline.

[0120] The effective results of each group after 4 weeks of treatment are shown in Table 2:

[0121] Table 2 Remission of IGA in each group

[0122]

[0123] The effective results of Group 1 and Group 4 after 4 weeks of treatment are shown in Table 3:

[0124] Table 3 Comparison of IGA remission between group 1 and group 4

[0125]

[0126] The effective results of Group 1 and Group 5 after 4 weeks of treatment are shown in Table 4:

[0127] Table 4 Comparison of IGA remission between group 1 and group 5

[0128]

[0129] The effective results of Group 2 and Group 4 after 4 weeks of treatment are shown in Table 5:

[0130] Table 5 Comparison of IGA remission between group 2 and group 4

[0131]

[0132] It was found that 0.5% and 0.7% SCS creams were superior to placebo in the treatment of mild to moderate AD, and the therapeutic effect of 0.5% SCS cream was superior to that of 0.1% SCS cream.

[0133] The pruritus symptoms in each group after 4 weeks of treatment were as follows Figure 9 shown.

[0134] The pruritus scores of the subjects were obtained from multiple assessments of the same study subject at different time points. As researchers, we wanted to observe how each subject's pruritus score changed over the course of treatment. We not only examined whether statistical differences existed at each time point, but also investigated the interaction between each time point and the duration of treatment and the different medications used. Therefore, we developed a mixed-effects model for further analysis. The model is shown in Table 6.

[0135] In Model 1, we analyzed time t as a dummy variable, with factors (t)3, (t)7, (t)14, and (t)28 representing each time point. The NRS value was assumed to be the Y variable. The grouping factor (g) was inserted into the model as a dummy variable, with factor (g)1 corresponding to Group 1, factor (g)2 corresponding to Group 2, and so on. The regression coefficients for each parameter in the model correspond to the mean values ​​for each group at each time point. Intercept represents the pre-treatment mean Y value for Group 1. Factor (t)3 represents the difference between the pre-treatment mean Y value for Group 1 on Day 3. Factor (t)2 represents the difference between the pre-treatment mean Y value for Group 0 on Day 2. Factor (g)2 represents the pre-treatment difference between the pre-treatment mean Y value for Group 2 and Group 1. Factor (g)3 represents the pre-treatment difference between the pre-treatment mean Y value for Group 3 and Group 1. And so on. factor(t)3:factor(g)2: represents the difference between the difference in Y between the second group on the third day of treatment and before treatment and the difference in Y between the first group, and so on.

[0136] We treated the time variable t as a continuous variable and applied a linear fit to Model 1 to generate Model 2, which more intuitively illustrates the trends in pruritus relief across groups. A log-likelihood ratio test (LLR) was performed after linear fitting of Model 2 compared with Model 1, with a p > 0.05. Therefore, the simplified Model 2 can replace Model 1.

[0137] The meanings of the regression coefficients of the parameters in Model 2 are as follows: intercept: represents the intercept of the fitting curve of the first group Y changing with t, t: represents the slope of the first-order term of the fitting curve of the first group Y changing with t. factor(g)2: represents the intercept difference between the two fitting curves of the first group and the second group. t: factor(g)2, represents the difference in the slope of the first-order term of the two fitting curves of the first group and the second group, and so on. This model is a mixed effect model, that is, a mixture of random effects and fixed effects. In Model 2, the intercept of the curve is a random effect, and the slope of the first-order term of the curve is a fixed effect. In order to express Model 2 intuitively, the simplified models of each group are obtained by drawing a graph as follows Figure 10 shown.

[0138] Table 6 Random (intercept) effect model analysis of time / dose-group interaction

[0139]

[0140]

[0141] Conclusion: 1.0.5% and 0.7% sodium cholesterol sulfate cream can better relieve the subjects' rash than placebo; at the same time, 0.5% sodium cholesterol sulfate cream can also better relieve the subjects' rash than 0.1% sodium cholesterol sulfate cream.

[0142] 2. There is no significant difference in the therapeutic effect among 0.3%, 0.5% and 0.7% sodium cholesterol sulfate cream.

[0143] 3.0.3%, 0.5% and 0.7% sodium cholesterol sulfate cream can effectively relieve itching on the 28th day of treatment compared with the baseline.

[0144] 4. Both 0.5% and 0.7% sodium cholesterol sulfate creams relieved itching more quickly than placebo.

[0145] 5.0.5% and 0.7% sodium cholesterol sulfate creams both have good therapeutic effects.

[0146] Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Therefore, based on the claims in this application, all other embodiments obtained fall within the scope of protection of this application.

Claims

1. Use of cholesterol sulfate or its derivatives in the preparation of a composition for inhibiting keratinocytes from producing TSLP or inhibiting type II inflammation or treating or preventing atopic dermatitis, wherein the cholesterol sulfate derivatives are selected from tautomers, solvates, or pharmaceutically acceptable salts thereof of cholesterol sulfate, and preferably, the cholesterol sulfate or its derivatives are selected from 5-cholesterene-3β-ol sulfate, 5-cholesterene-3β-ol sodium sulfate, and 5-cholesterene-3β-ol potassium sulfate.

2. The use according to claim 1, characterized in that The treatment of atopic dermatitis is to relieve atopic dermatitis inflammation, improve rash, relieve dry skin, or relieve itching; preferably, the rash is selected from erythema, papules, exudation, crusting, hypertrophy, and lichenoid thickening.

3. The use according to claim 1 or 2, characterized in that The composition is a pharmaceutical composition for external use on the skin or a cosmetic; Preferably, in the skin external pharmaceutical composition or cosmetic, the weight percentage content of cholesterol sulfate or its derivatives, calculated as cholesterol sulfate, is 0.01%-2%, preferably 0.09%-1%, more preferably 0.2%-0.8%, particularly preferably 0.4%-0.75%, and most preferably 0.45-0.7%.

4. The use according to claim 3, characterized in that The skin external pharmaceutical composition or cosmetic is selected from gel, cream, lotion, ointment or patch, preferably cream or ointment.

5. The use according to any one of claims 1 to 4, characterized in that The external pharmaceutical composition or cosmetic for skin use is used 1-3 times a day, preferably 2-3 times a day.

6. A pharmaceutical composition or cosmetic for external use on the skin for treating or preventing atopic dermatitis, characterized in that The active substance in the skin topical pharmaceutical composition or cosmetic is selected from cholesterol sulfate or its derivatives, and the cholesterol sulfate derivative is selected from tautomers, solvates, or pharmaceutically acceptable salts of cholesterol sulfate. Preferably, the cholesterol sulfate or its derivative is selected from 5-cholesterene-3β-ol sulfate, 5-cholesterene-3β-ol sodium sulfate, and 5-cholesterene-3β-ol potassium sulfate.

7. The pharmaceutical composition or cosmetic for external use on skin according to claim 6, characterized in that The treatment or prevention of atopic dermatitis is to relieve atopic dermatitis inflammation, improve rash, relieve dry skin, or relieve itching; preferably, the rash is selected from erythema, papules, exudation, crusting, hypertrophy, and lichenoid thickening.

8. The pharmaceutical composition or cosmetic for external use on skin according to claim 7, characterized in that The weight percentage content of cholesterol sulfate or its salt in the external pharmaceutical composition for skin or cosmetics is 0.01%-2%, preferably 0.09%-1%, more preferably 0.2%-0.8%, particularly preferably 0.4%-0.75%, and most preferably 0.45%-0.7%, calculated as cholesterol sulfate.

9. The pharmaceutical composition or cosmetic for external use on skin according to claim 8, characterized in that The skin external pharmaceutical composition or cosmetic is selected from a local pharmaceutical preparation of a gel, cream, lotion, ointment or patch, preferably a cream or ointment.

10. The pharmaceutical composition or cosmetic for external use on skin according to claim 6, characterized in that The skin external pharmaceutical composition or cosmetic is used 1-3 times a day, and most preferably 2-3 times a day.

Images