Application of Zika virus virulence site and / or testis adaptive mutation site

Abstract

The invention relates to the technical field of biology, and discloses an application of a mutant gene locus in changing Zika virus virulence and / or testis adaptability. According to the invention, testis adaptive sites and new virulence sites of the Zika virus are innovatively found, and the Zika virus mutant strain with changed virus virulence and / or testis adaptability can be obtained by mutating the functional sites; the method is of great significance to Zika virus research, related animal model construction and drug development work.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the application of mutant gene sites in changing the virulence of Zika virus and / or testicular adaptability. Background Art

[0002] Zika virus is a type of positive-strand RNA virus transmitted by insect vectors. Its genome has only one open reading frame, encoding a polyprotein, including three structural proteins and seven non-structural proteins. The polyprotein from N-terminus to C-terminus is: capsid protein (C), pre-membrane protein (prM) and envelope protein (E), non-structural proteins NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5.

[0003] Zika virus is the first flavivirus proven to be sexually transmitted, and can also be transmitted vertically from mother to child. In addition to causing serious diseases such as viral encephalitis, congenital microcephaly and fetal death, Zika virus has multi-tissue tropism. For example, high viral loads have been detected in tissues and organs such as the placenta, uterus and testicles, and it can also cause related diseases in the reproductive system. However, the infection and pathogenic mechanism of Zika virus on reproductive system tissues and organs is still unclear, which is very unfavorable for the development of related drugs and vaccines. Summary of the invention

[0004] The purpose of the present invention is to provide the application of a mutant gene site in changing the virulence and / or testicular adaptability of Zika virus. The present invention innovatively discovered a testicular adaptability site of Zika virus, which is also a new virulence site of Zika virus. By performing (site-directed) mutation on the site, the effect of changing the virulence and / or testicular adaptability of Zika virus can be obtained, which is of great significance for scientific research and medical work such as developing new Zika virus vaccines and antibodies and constructing new Zika virus animal infection models.

[0005] In order to achieve the above object, the present invention provides, on the one hand, the use of a mutant gene site in changing the virulence of Zika virus, wherein the gene site is selected from at least one of a nucleotide encoding the 401st amino acid of the E protein, a nucleotide encoding the 444th amino acid of the E protein, a nucleotide encoding the 117th amino acid of the NS2A protein, and a nucleotide encoding the 146th amino acid of the NS1 protein in the Zika virus genome;

[0006] The changing of the virulence of Zika virus includes increasing the virulence or reducing the virulence.

[0007] The second aspect of the present invention provides the use of a mutant gene site in changing the testicular adaptability of Zika virus, wherein the gene site is selected from at least one of a nucleotide encoding the 401st amino acid of the E protein, a nucleotide encoding the 444th amino acid of the E protein, a nucleotide encoding the 117th amino acid of the NS2A protein, and a nucleotide encoding the 146th amino acid of the NS1 protein in the Zika virus genome;

[0008] The changing of Zika virus virulence includes increasing testicular adaptability or decreasing testicular adaptability.

[0009] The third aspect of the present invention provides a Zika virus mutant strain, compared with the wild-type virus strain, at least one of the amino acid 401 of the E protein, the amino acid 444 of the E protein, the amino acid 117 of the NS2A protein and the amino acid 146 of the NS1 protein of the mutant strain is mutated.

[0010] The fourth aspect of the present invention provides a Zika virus attenuated mutant strain. Compared with the wild-type virus strain, at least one of the amino acid 401 of the E protein, the amino acid 444 of the E protein, the amino acid 117 of the NS2A protein and the amino acid 146 of the NS1 protein of the attenuated mutant strain is mutated.

[0011] The fifth aspect of the present invention provides a DNA molecule, which includes an open reading frame in the Zika virus genome, wherein at least one of the nucleotide encoding the 401st amino acid of the E protein, the nucleotide encoding the 444th amino acid of the E protein, the nucleotide encoding the 117th amino acid of the NS2A protein, and the nucleotide encoding the 146th amino acid of the NS1 protein is mutated.

[0012] The sixth aspect of the present invention provides the use of the mutant strain described in the third aspect, and / or the attenuated mutant strain described in the fourth aspect, and / or the DNA molecule described in the fifth aspect in constructing an animal model of Zika virus infection, especially in constructing an animal model of male reproductive system-related diseases caused by Zika virus infection.

[0013] The seventh aspect of the present invention provides the use of the mutant strain or part thereof described in the third aspect, and / or the attenuated mutant strain described in the fourth aspect, and / or the DNA molecule or fragment thereof described in the fifth aspect in Zika virus research, and / or in the preparation of drugs for preventing and / or treating diseases caused by Zika virus infection.

[0014] Through the above technical solution, the present invention can at least achieve the following beneficial effects:

[0015] (1) The present invention discovered a new Zika virus virulence and testicular adaptability site. By performing site-directed mutagenesis on the site, the virulence and / or testicular adaptability of the Zika virus can be effectively changed. This provides a basis for constructing a new Zika virus infection model and is of great significance for the research and development of new drugs for preventing and treating diseases caused by Zika virus infection.

[0016] (2) The present invention is the first to discover a gene locus in Zika virus that is related to testicular adaptability. By mutating the locus discovered by the present invention, a Zika virus mutant strain with altered testicular adaptability can be obtained, which is of great significance for the study of reproductive organ diseases such as testicular diseases caused by Zika virus infection and related drug development.

[0017] (3) By utilizing the new Zika virus virulence and testicular adaptability sites provided by the present invention to mutate wild-type Zika virus strains, mutant strains with altered virulence and / or testicular adaptability can be obtained, which helps to obtain new attenuated live Zika virus vaccine candidate strains, thereby developing new Zika virus vaccines and other drugs.

[0018] (4) The mutant strains of Zika virus provided by the present invention have different testicular tissue tropism, testicular tissue damage ability and neurotoxicity compared with the parent strain, among which some mutant strains show the characteristics of improved testicular tissue tropism and damage ability and improved neurotoxicity, while some mutant strains show the characteristics of reduced testicular tissue tropism, testicular tissue damage ability and neurotoxicity. The mutant strains provided by the present invention can be used to construct animal models related to male reproductive system diseases caused by Zika virus infection or as candidate strains for Zika virus attenuated live vaccines, laying a foundation for the development of new Zika vaccines, the study of reproductive system tissue and organ infection and pathogenic mechanism of Zika virus, and the development of related drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a schematic diagram of the process of continuous passage of FSS13025 in A129 mouse testis in Example 1.

[0020] Figure 2A-2B : is a plaque test result diagram of the recombinant mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E and the parent strain FSS13025 in Test Example 1, wherein Figure 2A The morphology of the empty spots is shown in Figure 2. Figure 2B It is a statistical graph of plaque diameter.

[0021] Figure 3This is a comparison chart of the proliferation of the recombinant double-point mutation viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E and the parent strain FSS13025 in human testicular primary Sertoli cells in Test Example 2.

[0022] Figure 4A-4B The recombinant double-point mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E in Test Example 3 and the parent strain FSS13025 were expressed in the mouse testicular cell line 15P-1 ( Figure 4A ) and TM3( Figure 4B ) in the replication capability comparison chart.

[0023] Figure 5A-Figure 5B This is a comparison of the viral loads of the recombinant double-point mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E and the parent strain FSS13025 in the testicular tissue of C57BL / 6J male mice in Test Example 4 ( Figure 5A ) and pathological damage detection diagram of testicular tissue ( Figure 5B ).

[0024] Figure 6 This is a comparison chart of the viral loads of the recombinant double-point mutation viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E and the parent strain FSS13025 in the brain tissue of A129 mice in Test Example 5.

[0025] Figure 7A-7B The recombinant single point mutant viruses of FSS13025-G444A, FSS13025-A117V and FSS13025-K146E in Test Example 6 and the parent strain FSS13025 in A129 mouse brain tissue ( Fig. 7A ) and testicles ( Figure 7B ) Comparison of viral load in .

[0026] Figure 8A-8B The binding ability of the recombinant mutant viruses FSS-G444A+A117V, FSS-G444A and FSS-A117V and the parent strain FSS13025 to BHK-21 cells in Test Example 7 ( Fig. 8A ) and entry capability ( Figure 8B ) comparison chart.

[0027] Fig. 9 It is a comparison chart of the replication ability of the attenuated mutant viruses FSS-A117G and FSS-H401A in Test Example 8 and the parent strain FSS13025 in the sensitive cell line BHK-21 cells.

[0028] Fig.10 This is a comparison chart of the lethality of the attenuated mutant viruses FSS-A117G and FSS-H401A in Test Example 9 and the parent strain FSS13025 when injected intracranially into ICR suckling mice. DETAILED DESCRIPTION

[0029] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0030] In the present invention, when not specifically stated, (virus) toxicity refers to the pathogenicity of Zika virus strain, especially the replication ability in brain tissue / nerve cell after Zika virus infection, i.e. neurotoxicity. Virus toxicity can usually be determined by testing the viral load in animal brain tissue / nerve cell after virus strain infection or nerve cell for a period of time, and after infection for a certain period of time, the higher the viral load in brain tissue / nerve cell, the stronger the neural tropism of the virus strain, i.e., stronger neurotoxicity. Testicular adaptability includes the replication ability of Zika virus in testicular tissue / cell, the damage ability to testicular tissue, etc., and usually can be determined by testing the viral load in cell line / animal testicular tissue and the testicular tissue damage of infected animal after Zika virus infection testicular cell line or experimental animal for a period of time, and after infection for a certain period of time, the higher the viral load in testicular cell line / testicular tissue, the more serious the damage to the testicular tissue of infected animal, and the stronger the testicular adaptability of the virus strain.

[0031] The inventors of the present invention accidentally discovered in the study of testicular passage of Zika virus that mutations in the genes encoding amino acids 401 of the E protein, 444 of the E protein, 117 of the NS2A protein, and 146 of the NS1 protein in the Zika virus genome had a significant impact on the virulence and testicular adaptability of the Zika virus, and further studies determined that the above-mentioned gene sites are new functional sites in the Zika virus genome that are related to viral virulence and / or testicular adaptability.

[0032] Based on this, the first aspect of the present invention provides the use of a mutant gene site in changing the virulence of Zika virus, wherein the gene site is selected from at least one of a nucleotide encoding the 401st amino acid of the E protein, a nucleotide encoding the 444th amino acid of the E protein, a nucleotide encoding the 117th amino acid of the NS2A protein, and a nucleotide encoding the 146th amino acid of the NS1 protein in the Zika virus genome;

[0033] The changing of the virulence of Zika virus includes increasing the virulence or reducing the virulence.

[0034] In the present invention, the mutation may be a mutation of one of the above gene loci, or a mutation of any combination of the above gene loci. These mutations may cause the virulence of the Zika virus to change, but the specific degree of change may vary. The present invention has no particular restrictions on the number and combination of specific mutated gene loci.

[0035] According to a preferred embodiment of the present invention, the mutation causes the 401st amino acid of the E protein to be tyrosine (Y) or alanine (A).

[0036] According to a preferred embodiment of the present invention, the mutation causes the 444th amino acid of the E protein to be alanine (A).

[0037] According to a preferred embodiment of the present invention, the mutation causes the 117th amino acid of the NS2A protein to be valine (V) or glycine (G).

[0038] According to a preferred embodiment of the present invention, the mutation causes the 146th amino acid of the NS1 protein to be glutamic acid (E).

[0039] In the present invention, any one or a combination of the above-mentioned sites can be mutated to obtain a mutant Zika virus with a changed (such as increased or decreased) viral virulence. The present invention has no particular restrictions on the specific mutation sites or the combination of mutation sites, and any mutation method that can achieve the above purpose belongs to the content of the present invention.

[0040] According to some preferred embodiments of the present invention, the mutation can make the 444th amino acid of the E protein A and the 117th amino acid of the NS2A protein V.

[0041] According to some preferred embodiments of the present invention, the mutation causes the 401st amino acid of the E protein to be Y and the 146th amino acid of the NS1 protein to be E.

[0042] According to some preferred embodiments of the present invention, the mutation can (only) make the 444th amino acid of the E protein A.

[0043] According to some preferred embodiments of the present invention, the mutation can (only) make the 401st amino acid of the E protein Y.

[0044] According to some preferred embodiments of the present invention, the mutation can (only) make the 401st amino acid of the E protein A.

[0045] According to some preferred embodiments of the present invention, the mutation may (only) make the amino acid at position 117 of the NS2A protein V.

[0046] According to some preferred embodiments of the present invention, the mutation may (only) cause the 117th amino acid of the NS2A protein to be G.

[0047] According to some preferred embodiments of the present invention, the mutation may (only) make the 146th amino acid of the NS1 protein E.

[0048] In the present invention, the mutation of the above gene loci refers to the mutation of the Zika virus mutant relative to the wild type. Since the above gene loci are discovered based on FSS13025 (GenBank Accession No. KU955593), for different wild-type Zika viruses, the actual gene loci where the mutation causes the change in viral virulence may be different, but they should all correspond to the above loci in FSS13025.

[0049] According to a preferred embodiment of the present invention, the (wild-type) Zika virus is FSS13025.

[0050] Preferably, the mutation causes the 401st amino acid of the E protein to mutate from histidine (H) to tyrosine (Y) or alanine (A).

[0051] Preferably, the mutation causes the 444th amino acid of the E protein to mutate from glycine (G) to alanine (A).

[0052] Preferably, the mutation causes the 117th amino acid of the NS2A protein to mutate from alanine (A) to valine (V) or glycine (G).

[0053] Preferably, the mutation causes the 146th amino acid of the NS1 protein to mutate from lysine (K) to glutamic acid (E).

[0054] According to some preferred embodiments of the present invention, the mutation can cause the 444th amino acid of the E protein to mutate from G to A and the 117th amino acid of the NS2A protein to mutate from A to V.

[0055] According to some preferred embodiments of the present invention, the mutation causes the 401st amino acid of the E protein to mutate from H to Y and the 146th amino acid of the NS1 protein to mutate from K to E.

[0056] According to some preferred embodiments of the present invention, the mutation may (only) cause the 444th amino acid of the E protein to mutate from G to A.

[0057] According to some preferred embodiments of the present invention, the mutation may (only) cause the 401st amino acid of the E protein to mutate from H to Y.

[0058] According to some preferred embodiments of the present invention, the mutation may (only) cause the 401st amino acid of the E protein to mutate from H to A.

[0059] According to some preferred embodiments of the present invention, the mutation may (only) cause the 117th amino acid of the NS2A protein to mutate from A to V.

[0060] According to some preferred embodiments of the present invention, the mutation may (only) cause the 117th amino acid of the NS2A protein to mutate from A to G.

[0061] According to some preferred embodiments of the present invention, the mutation may (only) cause the 146th amino acid of the NS1 protein to mutate from K to E.

[0062] The second aspect of the present invention provides the use of a mutant gene site in changing the testicular adaptability of Zika virus, wherein the gene site is selected from at least one of a nucleotide encoding the 401st amino acid of the E protein, a nucleotide encoding the 444th amino acid of the E protein, a nucleotide encoding the 117th amino acid of the NS2A protein, and a nucleotide encoding the 146th amino acid of the NS1 protein in the Zika virus genome;

[0063] The changing of Zika virus virulence includes increasing testicular adaptability or decreasing testicular adaptability.

[0064] In the present invention, the mutation may be a mutation of one of the above gene loci, or a mutation of any combination of the above gene loci. These mutations may cause changes in the testicular adaptability of the Zika virus, but the specific degree of change may vary. The present invention has no particular restrictions on the number and combination of specific mutated gene loci.

[0065] According to a preferred embodiment of the present invention, the mutation causes the 401st amino acid of the E protein to be tyrosine (Y) or alanine (A).

[0066] According to a preferred embodiment of the present invention, the mutation causes the 444th amino acid of the E protein to be alanine (A).

[0067] According to a preferred embodiment of the present invention, the mutation causes the 117th amino acid of the NS2A protein to be valine (V) or glycine (G).

[0068] According to a preferred embodiment of the present invention, the mutation causes the 146th amino acid of the NS1 protein to be glutamic acid (E).

[0069] According to some preferred embodiments of the present invention, the mutation can make the 444th amino acid of the E protein A and the 117th amino acid of the NS2A protein V.

[0070] According to some preferred embodiments of the present invention, the mutation causes the 401st amino acid of the E protein to be Y and the 146th amino acid of the NS1 protein to be E.

[0071] According to some preferred embodiments of the present invention, the mutation can (only) make the 444th amino acid of the E protein A.

[0072] According to some preferred embodiments of the present invention, the mutation can (only) make the 401st amino acid of the E protein Y.

[0073] According to some preferred embodiments of the present invention, the mutation can (only) make the 401st amino acid of the E protein A.

[0074] According to some preferred embodiments of the present invention, the mutation may (only) make the amino acid at position 117 of the NS2A protein V.

[0075] According to some preferred embodiments of the present invention, the mutation may (only) cause the 117th amino acid of the NS2A protein to be G.

[0076] According to some preferred embodiments of the present invention, the mutation may (only) make the 146th amino acid of the NS1 protein E.

[0077] In the present invention, the mutation of the above gene loci refers to the mutation of the Zika virus mutant relative to the wild type. Since the above gene loci are discovered based on FSS13025 (GenBank Accession No. KU955593), for different wild-type Zika viruses, the actual gene loci where the mutation causes the testicular adaptability of the virus may be different, but they should all correspond to the above loci in FSS13025.

[0078] According to a preferred embodiment of the present invention, the (wild-type) Zika virus is FSS13025.

[0079] Preferably, the mutation causes the 401st amino acid of the E protein to mutate from histidine (H) to tyrosine (Y) or alanine (A).

[0080] Preferably, the mutation causes the 444th amino acid of the E protein to mutate from glycine (G) to alanine (A).

[0081] Preferably, the mutation causes the 117th amino acid of the NS2A protein to mutate from alanine (A) to valine (V) or glycine (G).

[0082] Preferably, the mutation causes the 146th amino acid of the NS1 protein to mutate from lysine (K) to glutamic acid (E).

[0083] According to some preferred embodiments of the present invention, the mutation can cause the 444th amino acid of the E protein to mutate from G to A and the 117th amino acid of the NS2A protein to mutate from A to V.

[0084] According to some preferred embodiments of the present invention, the mutation causes the 401st amino acid of the E protein to mutate from H to Y and the 146th amino acid of the NS1 protein to mutate from K to E.

[0085] According to some preferred embodiments of the present invention, the mutation may (only) cause the 444th amino acid of the E protein to mutate from G to A.

[0086] According to some preferred embodiments of the present invention, the mutation may (only) cause the 401st amino acid of the E protein to mutate from H to Y.

[0087] According to some preferred embodiments of the present invention, the mutation may (only) cause the 401st amino acid of the E protein to mutate from H to A.

[0088] According to some preferred embodiments of the present invention, the mutation may (only) cause the 117th amino acid of the NS2A protein to mutate from A to V.

[0089] According to some preferred embodiments of the present invention, the mutation may (only) cause the 117th amino acid of the NS2A protein to mutate from A to G.

[0090] According to some preferred embodiments of the present invention, the mutation may (only) cause the 146th amino acid of the NS1 protein to mutate from K to E.

[0091] The third aspect of the present invention provides a Zika virus mutant strain, compared with the wild-type virus strain, at least one of the amino acid 401 of the E protein, the amino acid 444 of the E protein, the amino acid 117 of the NS2A protein, and the amino acid 146 of the NS1 protein of the mutant strain is mutated. Compared with the wild-type virus strain, the virus virulence and / or testicular adaptability of the mutant strain are changed, and the change can be increased or decreased.

[0092] According to some preferred embodiments of the present invention, the wild-type virus strain is FSS13025.

[0093] Preferably, in the mutant strain, the 401st amino acid of the E protein mutates from H to Y or A.

[0094] Preferably, in the mutant strain, the 444th amino acid of the E protein mutates from G to A.

[0095] Preferably, in the mutant strain, the 117th amino acid of the NS2A protein mutates from A to V or G.

[0096] Preferably, in the mutant strain, the 146th amino acid of the NS1 protein mutates from K to E.

[0097] According to a preferred embodiment of the present invention, in the mutant strain, the 444th amino acid of the E protein mutates from G to A and the 117th amino acid of the NS2A protein mutates from A to V.

[0098] According to a preferred embodiment of the present invention, in the mutant strain, the 401st amino acid of the E protein mutates from H to Y and the 146th amino acid of the NS1 protein mutates from K to E.

[0099] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 444th amino acid of the E protein mutates from G to A.

[0100] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 401st amino acid of the E protein mutates from H to Y.

[0101] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 401st amino acid of the E protein mutates from H to A.

[0102] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 117th amino acid of the NS2A protein mutates from A to V.

[0103] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 117th amino acid of the NS2A protein mutates from A to G.

[0104] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 146th amino acid of the NS1 protein mutates from K to E.

[0105] More preferably, in the mutant, the 401st amino acid of the E protein mutates from H to Y and / or the 146th amino acid of the NS1 protein mutates from K to E. Compared with the wild type, the virulence and testicular adaptability of the mutant are improved.

[0106] More preferably, in the mutant, the 444th amino acid of the E protein mutates from G to A and / or the 117th amino acid of the NS2A protein mutates from A to V. Compared with the wild type, the virulence and testicular adaptability of the mutant are improved.

[0107] The fourth aspect of the present invention provides a Zika virus attenuated mutant strain, compared to the wild-type virus strain, the attenuated mutant strain has at least one of the 401st amino acid of the E protein, the 444th amino acid of the E protein, the 117th amino acid of the NS2A protein, and the 146th amino acid of the NS1 protein mutated. The virulence of the attenuated mutant strain is reduced compared to the wild type, so it has the potential to be prepared as an attenuated live vaccine. However, the testicular fitness of the attenuated mutant strain is not necessarily reduced compared to the wild-type virus strain, and the testicular fitness of the attenuated mutant strain may be lower than that of the wild-type virus strain, or higher than that of the wild-type virus strain, or it may be equal to that of the wild-type virus strain. It should be noted that the above mutation sites are based on FSS13025 (GenBank Accession No. KU955593), therefore, for different wild-type Zika viruses, the actual mutation sites may be different, but they should all correspond to the above sites in FSS13025.

[0108] According to some preferred embodiments of the present invention, the wild-type virus strain is FSS13025.

[0109] Preferably, relative to the wild-type virus (FSS13025), in the attenuated mutant strain, (only) the 117th amino acid of the NS2A protein is mutated from A to G.

[0110] Preferably, relative to the wild-type virus (FSS13025), in the attenuated mutant strain, (only) the 401st amino acid of the E protein is mutated from H to A.

[0111] The fifth aspect of the present invention provides a DNA molecule, which includes an open reading frame in the Zika virus genome, wherein at least one of the nucleotide encoding the 401st amino acid of the E protein, the nucleotide encoding the 444th amino acid of the E protein, the nucleotide encoding the 117th amino acid of the NS2A protein, and the nucleotide encoding the 146th amino acid of the NS1 protein is mutated.

[0112] Due to the degeneracy of codons, when the nucleotides in the coding gene are changed, the encoded amino acid may not change. It should be understood by those skilled in the art that, in the present invention, the mutation of the nucleotides in the above-mentioned DNA molecule refers to the mutation of the nucleotides encoding the amino acid so that the encoded amino acid changes.

[0113] According to a preferred embodiment of the present invention, the mutation causes the 401st amino acid of the E protein to be Y or A.

[0114] According to a preferred embodiment of the present invention, the mutation causes the 444th amino acid of the E protein to be A.

[0115] According to a preferred embodiment of the present invention, the mutation causes the 117th amino acid of the NS2A protein to be V or G.

[0116] According to a preferred embodiment of the present invention, the mutation makes the 146th amino acid of NS1 protein E.

[0117] Preferably, the mutation causes the amino acid at position 444 of the E protein to be A and the amino acid at position 117 of the NS2A protein to be V.

[0118] Preferably, the mutation causes the amino acid at position 401 of the E protein to be Y and the amino acid at position 146 of the NS1 protein to be E.

[0119] Preferably, the mutation (only) makes the amino acid at position 444 of the E protein A.

[0120] Preferably, the mutation (only) makes the amino acid at position 401 of the E protein Y.

[0121] Preferably, the mutation (only) makes the amino acid at position 401 of the E protein A.

[0122] Preferably, the mutation (only) makes the amino acid at position 117 of the NS2A protein V.

[0123] Preferably, the mutation (only) makes the amino acid at position 117 of the NS2A protein a G.

[0124] Preferably, the mutation (only) makes the amino acid at position 146 of the NS1 protein E.

[0125] More preferably, the DNA molecule encodes the mutant strain described in the third aspect, or the DNA molecule encodes the attenuated mutant strain described in the fourth aspect.

[0126] The sixth aspect of the present invention provides the use of the mutant strain described in the third aspect, and / or the attenuated mutant strain described in the fourth aspect, and / or the DNA molecule described in the fifth aspect in constructing an animal model of Zika virus infection, especially in constructing an animal model of male reproductive system-related diseases caused by Zika virus infection.

[0127] For example, the mutant strains, attenuated mutant strains and DNA molecules provided by the present invention can be used to construct animal models such as male animal reproductive system damage models (caused by Zika virus infection), and the models can be used for related treatment plans, drug research and development and production work. The mutant strains, attenuated mutant strains and DNA molecules provided by the present invention can also be used to construct other types of animal models to study the relationship between Zika virus infection and male reproductive system-related diseases, pathogenic mechanisms, etc.

[0128] Based on the Zika virus virulence and testicular adaptability functional sites discovered by the present invention, further research can be conducted on Zika virus, and related drugs can also be developed. For example, new Zika virus antibodies, attenuated live vaccines and other drugs for preventing and / or treating diseases caused by Zika virus infection can be developed based on the functional gene sites discovered by the present invention.

[0129] Therefore, the seventh aspect of the present invention provides the mutant strain or part thereof described in the third aspect, and / or, the attenuated mutant strain or part thereof described in the fourth aspect, and / or, the DNA molecule or fragment thereof described in the fifth aspect for Zika virus research, and / or, in the preparation of drugs for preventing and / or treating diseases caused by Zika virus infection. The "mutant strain or part thereof" or "attenuated mutant strain or part thereof" refers to a complete mutant strain or attenuated mutant strain, or a part of material from a mutant strain or attenuated mutant strain (for example, one or some proteins, fragments of one or some proteins, genomes, genome fragments, etc.); the "DNA molecule or fragment thereof" refers to a complete DNA molecule or one or some fragments thereof (for example, the complete DNA molecule provided by the present invention, or one or more fragments thereof, can be used to develop and prepare related drugs, etc.).

[0130] According to some preferred embodiments of the present invention, the drug preferably comprises an antibody and / or a vaccine, and the vaccine is preferably a live attenuated vaccine.

[0131] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0132] In the following examples, unless otherwise specified, the reagents and materials used are all commercial products purchased from regular chemical or biological laboratory supplies suppliers, and the reagents are all analytically pure. Unless otherwise specified, the gene sequencing work in the following examples was commissioned by Nosai.

[0133] Example 1

[0134] This example is used to illustrate the construction and identification of the Zika virus mutant strain provided by the present invention.

[0135] Reference Figure 1 The full-length infectious clone pACNR of the Asian strain of Zika virus (FSS13025, GenBank Accession No. KU955593) (construction method refers to Shan et al., 2016, Cell Host & Microbe 19,891–900), and serially passaged in A129 mice. The viruses of each generation were observed, and two mutant strains with significantly enhanced testicular adaptability and neurovirulence were found. By sequencing the genomes of the two mutant strains, it was found that the amino acid at position 444 of the E protein of one of the strains mutated from glycine (G) to alanine (A), and at the same time, the amino acid at position 117 of the NS2A protein mutated from alanine (A) to valine (V), recorded as FSS-G444A+A117V; the amino acid at position 401 of the E protein of the other strain mutated from histidine (H) to tyrosine (Y), and at the same time, the amino acid at position 146 of the NS1 protein mutated from lysine (K) to glutamic acid (E), recorded as FSS-H401Y+K146E.

[0136] In order to further study the relationship between the mutation sites of the above two mutant strains and the virulence and testicular adaptability of Zika virus, the full-length clone construction, identification and rescue of the recombinant mutant virus were carried out by the following methods.

[0137] 1. Construction and identification of the full-length genome clone of the recombinant mutant strain of Zika virus

[0138] The primer sequences involved in the following experiments are detailed in Table 1, the PCR reaction system and procedures are detailed in Table 2, and the Seamless reaction system is detailed in Table 3.

[0139] The full-length infectious clone plasmid of FSS13025 (GenBank Accession No. KU955593) (the construction method can be referred to Shan et al., 2016, Cell Host & Microbe 19, 891–900) was used as a template, FSS-G444A-F and FSS-A117V-R were used as the first primer pair, and FSS-A117V-F and FSS-G444A-R were used as the second primer pair. PCR amplification was performed using Prime starMax polymerase (purchased from TaKaRa) to obtain two DNA fragments containing G444A mutation and A117V mutation. Seamless enzyme (purchased from Bomed) was then used to phosphorylate the two amplified DNA fragments, and DNA fragments were connected and circularized through phosphate linkage, and template removal was performed by specifically recognizing Escherichia coli methylation, and finally the recombinant mutant virus plasmid of FSS-G444A+A117V mutant virus was obtained.

[0140] The same method as above was used, with the full-length infectious clone plasmid of FSS13025 as the template, FSS-H401Y-F and FSS-K146E-R as the first primer pair, and FSS-K146E-F and FSS-H401Y-R as the second primer pair, to obtain the recombinant mutant virus plasmid of the FSS-H401Y+K146E mutant virus.

[0141] The same method as above was used, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-G444A-F and FSS-G444A-R as primer pairs to obtain the recombinant mutant virus plasmid of the FSS-G444A mutant virus.

[0142] The same method as above was used, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-A117V-F and FSS-A117V-R as a primer pair to obtain the recombinant mutant virus plasmid of the FSS-A117V mutant virus.

[0143] The same method as above was used, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-H401Y-F and FSS-H401Y-R as a primer pair to obtain the recombinant mutant virus plasmid of the FSS-H401Y mutant virus.

[0144] The same method as above was used, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-K146E-F and FSS-K146E-R as a primer pair to obtain the recombinant mutant virus plasmid of the FSS-K146E mutant virus.

[0145] The same method as above was used, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-A117G-F and FSS-A117G-R as a primer pair to obtain the recombinant mutant virus plasmid of the FSS-A117G mutant virus.

[0146] The same method as above was used to obtain the recombinant mutant virus plasmid of the FSS-H401A mutant virus using the full-length infectious clone plasmid of FSS13025 as a template and FSS-H401A-F and FSS-H401A-R as a primer pair.

[0147] Table 1

[0148] Primer name Sequence (5′-3′) FSS-G444A-F GGTGCTCTCAACTCACTGGGCAAGGCCATCCATCAAATTT FSS-G444A-R GGTGCTCTCAACTCACTGGGCAAGGCCATCCATCAAATTT FSS-A117V-F TTGGCCTCGTGTCTTCTGCAAACTGTGATCTCCGCCTT FSS-A117V-R AAGACACGAGGCCAAGGCCAGCAGCATGCTCTCACG FSS-H401Y-F GGAAAAGAAGATCACCCACCACTGGTACAGGAGTGGCAGC FSS-H401Y-R GTGATCTTCTTTTCCCCGACTCCTATGACAATGTAAGAGT FSS-K146E-F GGTGACACACTGAAGGAATGCCCACTCGAACATAGAGCAT FSS-K146E-R CTTCAGTGTGTCACCATCCACGACAAAGCTGTTATTTGTC FSS-A117G-F CTCGTGTCTCTGCAAACTGGGATCTCCGCC FSS-A117G-R AAGACACGAGGCCAAGGCCAGCAGCA FSS-H401A-F GGAAAAGAAGATCACCCACCACTGGGCCAGGAGTGGCAGC FSS-H401A-R GTGATCTTCTTTTCCCCGACTCCTATGACAATGTAAGAGT

[0149] Table 2

[0150]

[0151] Table 3

[0152]

[0153] The Seamless product was transformed into competent E. coli HB101 (purchased from TaKaRa), and a single clone was picked and sent to Nosai for sequencing. The sequencing results of the recombinant mutant full-length infectious clone plasmid were compared with the FSS13025 genome sequence, and the results are shown in Table 4.

[0154] Table 4

[0155]

[0156] It can be seen from the results in Table 4 that the full-length clones of the above double-point and single-point mutant viruses were constructed correctly.

[0157] 2. Rescue of Zika virus recombinant mutants

[0158] 1. In vitro transcription of full-length infectious clones of recombinant mutant strains of Zika virus

[0159] The full-length infectious clone plasmids of the recombinant mutant viruses in Table 4 were extracted using a plasmid extraction kit (purchased from Invitrogen), digested with Cla I, and then extracted with phenol chloroform. The linearized plasmids were quantified and aliquoted and stored at -20°C for later use.

[0160] Table 5

[0161]

[0162] Using the reaction system and conditions in Table 5, the full-length infectious clone plasmid of the linearized recombinant mutant virus was used as a template, and in vitro transcription was performed using RiboMAX Large Scale RNA Production System-T7RiboMAX (purchased from Promega) to obtain transcript RNA.

[0163] 2. Rescue of Zika virus recombinant mutant virus

[0164] The transcript RNA was transfected into a monolayer of BHK-21 cells (purchased from ATCC, catalog number CCL-10) using liposome Lipofectamine 3000 (purchased from Invitrogen) as follows: First, 50 μL of OPTI-MEM was mixed with 4 μL of liposomes, and then placed at room temperature for 5 minutes, and then mixed with 10 μL of RNA (5 μg) and 50 μL of OPTI-MEM, and then placed at room temperature for another 20 minutes. The above mixture was added to one well of a 6-well plate, and 450 μL of OPTI-MEM was added at the same time. Incubate at 37°C, 5% CO2 for 6 hours. After removing the supernatant, DMEM maintenance solution containing 2% FBS was added, and the culture medium was incubated at 37°C, 5% CO2. After the cells showed pathological changes, the culture medium supernatant was collected by centrifugation. The supernatant was re-inoculated into BHK-21 cells, and after the cells showed pathological changes, the supernatant was collected by centrifugation. The supernatant is the seed solution of the recombinant mutant recovery virus, which is named FSS-G444A+A117V, FSS-H401Y+K146E, FSS-G444A, FSS-A117V, FSS-H401Y, FSS-K146E, FSS-A117G and FSS-H401A according to the mutation, and is stored at -80°C for future use. Among them, FSS-G444A+A117V and FSS-H401Y+K146E are recombinant double-point mutation viruses; FSS-G444A, FSS-A117V, FSS-H401Y and FSS-K146E are recombinant single-point mutation viruses, and FSS-A117G and FSS-H401A are recombinant attenuated mutation viruses.

[0165] Test Example 1

[0166] This test example is used to illustrate the plaque characteristics of BHK-21 cells infected by the recombinant double-point mutant strain obtained in Example 1.

[0167] The recombinant mutant virus was diluted 10-fold to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 and 10 -7 , inoculated in a monolayer of BHK-21 cells in a 12-well plate at 400 μL / well. After adsorption for 1-2 hours, the virus solution was discarded, and a 1% agar cap containing DMEM medium (2% FBS) was added and placed in an incubator at 37°C and 5% CO2 for culture. After 4 days, the cells were fixed with 4% formaldehyde at room temperature for 1 hour, the agar cap was discarded, and crystal violet was stained at room temperature for 10 minutes. The morphology of the plaques was observed and the plaque forming units (PFU) were calculated. The plaques of the parental strain virus (i.e., wild-type strain FSS13025) were measured and analyzed in the same way as a control.

[0168] The results of the plaque assay showed that the FSS13025-G444A+A117V and FSS13025-H401Y+K146E recombinant mutant viruses could form plaques of relatively uniform size and clear edges, and the plaque diameter of the recombinant double-point mutant virus was significantly larger than that of the FSS13025 parent strain, so it had significant large plaque characteristics (see Figure 2A and Figure 2B ).

[0169] Test Example 2

[0170] This test example is used to illustrate the replication characteristics of the recombinant double-point mutant strain obtained in Example 1 in primary human testicular Sertoli cells.

[0171] The recombinant double-point mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E and the parental strain virus were inoculated into human primary Sertoli cells (purchased from Beina Chuanglian Biotechnology Co., Ltd.) in 24-well plates at an MOI of 1, placed in a 37°C, 5% CO2 incubator for adsorption for 1 hour, and then the virus solution was discarded, and DMEM supplemented with 2% FBS was placed in a 37°C, 5% CO2 incubator for culture. The cell supernatant was collected at 24h, 48h, and 72h after inoculation, and the virus titer was determined by plaque titration. A one-step growth curve was drawn. The results are shown in Figure 3 The parental strain virus (i.e., wild-type strain FSS13025) was measured and analyzed in the same manner as a control.

[0172] from Figure 3 It can be seen that the replication ability of the recombinant double-point mutation viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E in primary human Sertoli cells is stronger than that of the parental strong strains. In primary human Sertoli cells, the peak of replication was reached at 48h after infection. This shows that the recombinant double-point mutation virus replicates effectively in the testicular cell line, and the replication efficiency is significantly stronger than that of the parental strain.

[0173] Test Example 3

[0174] This test example is used to illustrate the replication characteristics of the recombinant double-point mutant strain obtained in Example 1 in a mouse testicular cell line.

[0175] The recombinant double-point mutant viruses FSS-G444A+A117V and FSS-H401Y+K146E and the parental virus FSS13025 were inoculated into 15P-1 and TM3 cells (both purchased from Wuhan Pronocell Life Science Co., Ltd.) in 24-well plates at MOI=1, placed in an incubator at 37°C, 5% CO2 for 1 hour of adsorption, the virus solution was discarded, 2% FBS-containing DMEM was added, and the cells were cultured in an incubator at 37°C, 5% CO2. The cell supernatant was collected at 24h, 48h and 72h after inoculation, and the virus titer was determined by plaque titration, and a one-step growth curve was drawn. The results are shown in Figure 4. The parental virus (i.e., wild-type strain FSS13025) was determined and analyzed in the same way as a control.

[0176] from Figure 4A-4B It can be seen that the recombinant double-point mutation virus is expressed in the mouse testicular cell line: 15P-1 (mouse testicular Sertoli cells, Figure 4A ) and TM3 (mouse testicular Leydig cells, Figure 4B ) were stronger than the parental strains. In the mouse testicular cell line, the peak of replication was reached at 48h after infection. This indicates that the recombinant double-point mutation virus replicates effectively in the testicular cell line, and the replication efficiency is significantly higher than that of the parental strain.

[0177] Test Example 4

[0178] This test example is used to illustrate the characteristics of the testicular adaptability and pathological damage effect on testicular tissue of the recombinant double-point mutant strain obtained in Example 1.

[0179] The recombinant double-point mutant viruses FSS-G444A+A117V and FSS-H401Y+K146E and the parent strain FSS13025 were cultured at 10 5 The dose of PFU was intraperitoneally injected into 7-8 week old C57BL / 6J male mice (purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) pretreated with type I anti-IFNAR antibody (purchased from Leinco).

[0180] The viral load of mouse testicular tissue was detected on days 3 and 9 after infection. Figure 5A As shown in the figure, it can be seen that at 3 days, there was no significant difference in the viral load in the testis between the recombinant double-point mutation viruses FSS-G444A+A117V and FSS-H401Y+K146E and the parental strains, but at 9 days, the viral load in the testis of the recombinant double-point mutation viruses was significantly higher than that of the parental strains.

[0181] Pathological damage detection of mouse testicular tissue was performed on days 3 and 14 after infection. Figure 5BAs shown in the figure, it can be seen that at 14 days, the recombinant double point mutation viruses FSS-G444A+A117V and FSS-H401Y+K146E destroyed the seminiferous tubule structure of the testis (black arrow) and reduced sperm (red arrow), while the parental strain did not show similar effects.

[0182] The above results show that compared with the parental strain FSS13025, the proliferation of FSS-G444A+A117V and FSS-H401Y+K146E in the testis was significantly enhanced, and damage to testicular tissue was observed, indicating that the recombinant double-point mutation virus has stronger testicular adaptability.

[0183] Test Example 5

[0184] This test example is used to illustrate the neurotoxicity characteristics of the recombinant double-point mutant strain obtained in Example 1.

[0185] The recombinant double-point mutation viruses FSS-G444A+A117V, FSS-H401Y+K146E and the parental strain FSS13025 were intraperitoneally injected at a dose of 100 PFU into 7-8 week-old A129 male mice with type I interferon receptor gene deletion (purchased from Saiye Biotechnology Co., Ltd.), and the viral load in the mouse brain tissue was detected 3 and 6 days after inoculation.

[0186] The results are as follows Figure 6 As shown in the figure, it can be seen that at 3d, the viral load of the recombinant double-point mutant virus FSS-G444A+A117V and FSS-H401Y+K146E in brain tissue has shown an increasing trend compared with the parental strain, and it is significantly increased at 6d. The viral load of the recombinant double-point mutant virus in brain tissue is significantly higher than that of the parental strain. The above results show that compared with the parental strain FSS13025, the proliferation of FSS-G444A+A117V and FSS-H401Y+K146E in brain tissue is significantly enhanced, indicating that the recombinant double-point mutant virus has stronger neurotropism and stronger neurotoxicity.

[0187] Test Example 6

[0188] This test example is used to illustrate the neurotoxicity and testicular adaptability characteristics of the recombinant single point mutant strain obtained in Example 1.

[0189] The recombinant single-point mutant viruses FSS-G444A, FSS-A117V, FSS-K146E and the parental strain FSS13025 were intraperitoneally injected at a dose of 100 PFU into 7-8 week-old A129 male mice with type I interferon receptor gene deletion (purchased from Saiye Biotechnology Co., Ltd.), and the viral load in the mouse brain tissue and testis was detected 6 days after inoculation.

[0190] Brain tissue viral load test results Fig. 7AAs shown in the figure, it can be seen that at 6 days after infection, the viral load of the recombinant single point mutant viruses FSS-G444A, FSS-A117V, and FSS-K146E in brain tissue was significantly higher than that of the parent strain. The above results show that compared with the parent strain FSS13025, the proliferation of FSS-G444A, FSS-A117V, and FSS-K146E in brain tissue was significantly enhanced, indicating that the recombinant single point mutant viruses have stronger neurotropism and stronger neurotoxicity.

[0191] Testicular viral load test results Figure 7B As shown in the figure, it can be seen that at 6 days after infection, the viral load of the recombinant single point mutant viruses FSS-G444A, FSS-A117V, and FSS-K146E in the testis was significantly higher than that of the parent strain. The above results show that compared with the parent strain FSS13025, the proliferation of FSS-G444A, FSS-A117V, and FSS-K146E in the testis is significantly enhanced, indicating that the recombinant single point mutant virus has stronger testicular adaptability.

[0192] Test Example 7

[0193] This test example is used to illustrate the characteristics of the ability of the recombinant mutant strain obtained in Example 1 to infect cells.

[0194] The recombinant mutant viruses FSS-G444A+A117V, FSS-G444A and FSS-A117V and the parent strain FSS13025 were infected with BHK-21 cells at a dose of MOI=1, and then treated in the following two ways:

[0195] (1) After incubation at 4°C for 1 h, cells were lysed, viral RNA was extracted, and the ability of the virus to bind to cells was detected;

[0196] (2) After incubation at 4°C for 1 h, the cells were moved to 37°C and incubated for another 1 h. The cells were lysed, viral RNA was extracted, and the ability of the virus to enter the cells was tested.

[0197] The results are as follows Figure 8A-8B As shown in the figure, it can be seen that compared with the parent strain FSS13025, the mutant strains FSS-G444A+A117V and FSS-G444A significantly enhanced the cell binding ability ( Fig. 8A ) and the ability to enter cells ( Figure 8B ), while the mutant strain FSS-A117V showed a cell binding ability that was basically the same as that of the parent strain ( Fig. 8A ) and the ability to enter cells ( Figure 8B). The above results show that compared with the parental strain FSS13025, the mutant viruses FSS-G444A+A117V and FSS-G444A have stronger ability to infect cells, while the ability of the mutant virus FSS-A117V to infect cells has no significant difference from that of the parental strain.

[0198] Test Example 8

[0199] This test example is used to illustrate the replication characteristics of the recombinant attenuated mutant strain obtained in Example 1 in a sensitive cell line.

[0200] The recombinant attenuated mutant viruses FSS-A117G and FSS-H401A and the parental strain virus were inoculated into BHK-21 cells in a 24-well plate at an MOI of 0.1, placed in a 37°C, 5% CO2 incubator for adsorption for 1 hour, and then the virus solution was discarded, and DMEM supplemented with 2% FBS was placed in a 37°C, 5% CO2 incubator for incubation. The cell supernatant was collected at 6h, 24h, 48h, and 72h after inoculation, and the one-step growth curve was drawn by measuring the viral RNA copy number. The results are shown in Fig. 9 The parental virus (i.e., wild-type strain FSS13025) was tested and analyzed in the same manner as a control.

[0201] from Fig. 9 It can be seen that the replication ability of the recombinant attenuated mutant viruses FSS-A117G and FSS-H401A in BHK-21 is weaker than that of the wild parent strain. This indicates that the above-mentioned recombinant attenuated mutant viruses replicate effectively in BHK-21 cells, and the replication efficiency is significantly weaker than that of the wild parent strain.

[0202] Test Example 9

[0203] This test example is used to illustrate the lethality characteristics of the recombinant attenuated mutant strain obtained in Example 1 when injected intracranially into ICR suckling mice.

[0204] The recombinant attenuated mutant viruses FSS-A117G and FSS-H401A and the parental strain virus were inoculated intracranially into one-day-old ICR suckling mice (purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) at a dose of 1000 PFU, and the mice were observed for morbidity and mortality within 15 days. Death within 24 hours of inoculation was considered nonspecific death.

[0205] The results are shown in Fig.10As can be seen from the figure, within 15 days after infection, 1000 PFU of the parental strain can kill 100% of mice, while the same dose of the attenuated strain FSS-A117G can kill 60% of suckling mice, and the same dose of the attenuated strain FSS-H401A is not lethal. At this dose, the average survival time of mice infected with the parental strain was 11.2 days, while the average survival time of suckling mice infected with the FSS-A117G virus was 13.3 days. The above results show that the neurotoxicity of the recombinant attenuated mutant viruses of FSS-A117G and FSS-H401A in mice is significantly weaker than that of the parental strains, and has obvious attenuation characteristics.

[0206] Further studies showed that FSS-A117G and FSS-H401A recombinant attenuated mutant viruses can induce mice to produce neutralizing antibodies.

[0207] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. Application of mutant gene sites in changing the virulence of Zika virus, including: The gene locus is selected from at least one of the nucleotide encoding the 401st amino acid of the E protein, the nucleotide encoding the 444th amino acid of the E protein, the nucleotide encoding the 117th amino acid of the NS2A protein, and the nucleotide encoding the 146th amino acid of the NS1 protein in the Zika virus genome; The changing of the virulence of Zika virus includes increasing the virulence or reducing the virulence.

2. Application of mutant gene loci in changing the testicular fitness of Zika virus, including: The gene locus is selected from at least one of the nucleotide encoding the 401st amino acid of the E protein, the nucleotide encoding the 444th amino acid of the E protein, the nucleotide encoding the 117th amino acid of the NS2A protein, and the nucleotide encoding the 146th amino acid of the NS1 protein in the Zika virus genome; The changing of Zika virus virulence includes increasing testicular adaptability or decreasing testicular adaptability.

3. The use according to claim 1 or 2, wherein: The mutation causes the 401st amino acid of the E protein to be tyrosine or alanine; and / or, the mutation causes the amino acid at position 444 of the E protein to be alanine; and / or, the mutation causes the 117th amino acid of the NS2A protein to be valine or glycine; and / or, the mutation causes the 146th amino acid of the NS1 protein to be glutamic acid; Preferably, the mutation makes the 444th amino acid of the E protein alanine and the 117th amino acid of the NS2A protein valine; or, the mutation makes the 401st amino acid of the E protein tyrosine and the 146th amino acid of the NS1 protein glutamic acid; or, the mutation makes the 444th amino acid of the E protein alanine; or, the mutation makes the 401st amino acid of the E protein tyrosine; or, the mutation makes the 401st amino acid of the E protein alanine; or, the mutation makes the 117th amino acid of the NS2A protein valine; or, the mutation makes the 117th amino acid of the NS2A protein glycine; or, the mutation makes the 146th amino acid of the NS1 protein glutamic acid; More preferably, the Zika virus is FSS13025.

4. A Zika virus mutant, characterized in that: Compared with the wild-type virus strain, at least one of the amino acid 401 of the E protein, the amino acid 444 of the E protein, the amino acid 117 of the NS2A protein, and the amino acid 146 of the NS1 protein of the mutant strain has mutated.

5. The Zika virus mutant according to claim 4, wherein The wild-type virus strain is FSS13025; Preferably, in the mutant strain, the 401st amino acid of the E protein mutates from histidine to tyrosine or alanine; Preferably, in the mutant strain, the 444th amino acid of the E protein mutates from glycine to alanine; Preferably, in the mutant strain, the 117th amino acid of the NS2A protein mutates from alanine to valine or glycine; Preferably, in the mutant strain, the 146th amino acid of the NS1 protein mutates from lysine to glutamic acid; More preferably, the mutation causes the amino acid at position 444 of the E protein to be alanine and the amino acid at position 117 of the NS2A protein to be valine; alternatively, the mutation causes the amino acid at position 401 of the E protein to be tyrosine and the amino acid at position 146 of the NS1 protein to be glutamic acid; alternatively, the mutation causes the amino acid at position 444 of the E protein to be alanine; alternatively, the mutation causes the amino acid at position 401 of the E protein to be tyrosine; alternatively, the mutation causes the amino acid at position 401 of the E protein to be alanine; alternatively, the mutation causes the amino acid at position 117 of the NS2A protein to be valine; alternatively, the mutation causes the amino acid at position 117 of the NS2A protein to be glycine; alternatively, the mutation causes the amino acid at position 146 of the NS1 protein to be glutamic acid.

6. A Zika virus attenuated mutant strain, characterized in that: Compared with the wild-type virus strain, at least one of the 401st amino acid of the E protein, the 444th amino acid of the E protein, the 117th amino acid of the NS2A protein, and the 146th amino acid of the NS1 protein of the attenuated mutant strain is mutated.

7. A DNA molecule, characterized in that The DNA molecule includes an open reading frame in the Zika virus genome, wherein at least one of the nucleotide encoding the 401st amino acid of the E protein, the nucleotide encoding the 444th amino acid of the E protein, the nucleotide encoding the 117th amino acid of the NS2A protein, and the nucleotide encoding the 146th amino acid of the NS1 protein is mutated.

8. The DNA molecule according to claim 7, wherein The mutation causes the 401st amino acid of the E protein to be tyrosine or alanine; and / or, the mutation causes the amino acid at position 444 of the E protein to be alanine; and / or, the mutation causes the 117th amino acid of the NS2A protein to be valine or glycine; and / or, the mutation causes the 146th amino acid of the NS1 protein to be glutamic acid; Preferably, the mutation makes the 444th amino acid of the E protein alanine and the 117th amino acid of the NS2A protein valine; or, the mutation makes the 401st amino acid of the E protein tyrosine and the 146th amino acid of the NS1 protein glutamic acid; or, the mutation makes the 444th amino acid of the E protein alanine; or, the mutation makes the 401st amino acid of the E protein tyrosine; or, the mutation makes the 401st amino acid of the E protein alanine; or, the mutation makes the 117th amino acid of the NS2A protein valine; or, the mutation makes the 117th amino acid of the NS2A protein glycine; or, the mutation makes the 146th amino acid of the NS1 protein glutamic acid; More preferably, the DNA molecule encodes the mutant strain according to claim 4 or 5, or the DNA molecule encodes the attenuated mutant strain according to claim 6.

9. Use of the mutant strain of claim 4 or 5, and / or the attenuated mutant strain of claim 6, and / or the DNA molecule of claim 7 or 8 in constructing an animal model of Zika virus infection, especially in constructing an animal model of male reproductive system-related diseases caused by Zika virus infection.

10. Use of the mutant strain or part thereof according to claim 4 or 5, and / or the attenuated mutant strain or part thereof according to claim 6, and / or the DNA molecule or fragment thereof according to claim 7 or 8 in Zika virus research, and / or in the preparation of a drug for preventing and / or treating diseases caused by Zika virus infection, wherein: The medicament preferably comprises an antibody and / or a vaccine, and the vaccine is preferably a live attenuated vaccine.

Images