Chimeric cytokine receptor gene modification enhanced cell therapy model as well as construction method and application thereof

Abstract

The invention relates to the technical field of tumor immunotherapy, in particular to a chimeric cytokine receptor gene modification enhanced cell therapy model and a construction method and application thereof. An IL4R / IL7R chimeric cytokine receptor is introduced into cells such as TCR-T and the like through a genetic engineering method, and the cells such as TCR-T and the like which can be applied to treatment of solid tumors secreted positively by IL4 are obtained. The novel combination mode not only can relieve the immunosuppression effect mediated by the combination of IL4 and IL4R, but also can turn the suppression signal into an activation signal to promote further proliferation and killing of cells such as TCR-T and the like, so that enhanced antitumor activity cell therapy drugs such as TCR-T and the like are obtained, and the efficient antitumor effect is achieved.

Description

[0001] This application claims the priority of the Chinese patent application filed with the China Patent Office on February 2, 2024, with application number 202410151571.9 and invention name “Chimeric cytokine receptor gene-modified enhanced TCR-T model and its construction method and application”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the technical field of tumor immunotherapy, and in particular to a chimeric cytokine receptor gene-modified enhanced cell therapy model and a construction method and application thereof. Background Art

[0003] Adoptive cell therapy is one of the important directions of tumor immunotherapy. It is a treatment method that separates autologous or allogeneic immune cells, activates or genetically modifies them in vitro, expands a sufficient number of immune cells with anti-tumor activity, and then returns them to tumor patients to amplify the cellular immune function in the patient's body and improve the anti-tumor effect.

[0004] In recent years, the application of adoptive cell therapy in tumor treatment has made remarkable progress. For example, chimeric antigen receptor T cell (CAR-T) therapy has made great progress in the treatment of hematological tumors. Another gene-modified adoptive T cell therapy technology is TCR-T cell (T cellreceptor engineered T cells) therapy technology, which is one of the current research hotspots of adoptive cell therapy. It refers to the introduction of new T cell receptor (T cellreceptor, TCR) genes into ordinary T cells, so that the modified T cells can express TCR that effectively recognizes tumor cells, thereby guiding T cells to kill tumor cells. The T cell receptors corresponding to different T cells are diverse, and the types of tumor target antigens that can be recognized are more than CAR-T cell therapy. It has a broader application prospect in solid tumors and is expected to become an important breakthrough in living cell drugs for solid tumors.

[0005] Currently, the most widely studied and applied TCR-T cell type in solid tumors is the TCR-T cell therapy technology targeting NY-ESO-1. A number of preclinical studies have confirmed that TCR-T cells targeting NY-ESO-1 can specifically target and kill multiple tumor cell lines such as melanoma, brain glioma, and non-small cell lung cancer. The latest clinical trial data also found that this TCR-T cell therapy showed a good objective response rate in patients with multiple myeloma, melanoma and synovial sarcoma.

[0006] Although TCR-T cell therapy technology has made progress in malignant tumor types, there are still many problems in the overall treatment of most solid tumors, such as the suppression of T cells by the inhibitory immune microenvironment in solid tumors and the weak ability of T cells to proliferate and survive in vivo, which makes the anti-tumor efficacy of TCR-T cells in solid tumors still limited. Summary of the invention

[0007] In view of this, the technical problem to be solved by the present invention is to provide a chimeric cytokine gene-modified enhanced TCR-T model and its construction method and application.

[0008] The present invention is based on NY-ESO-1 specific TCR-T cells as a model to develop a new chimeric cytokine gene modified enhanced TCR-T cell. The introduction of chimeric cytokine receptors in the design of NY-ESO-1 specific TCR-T cells can not only relieve the inhibition of these T cells in the tumor immune microenvironment, but also reverse the inhibitory signal of TCR-T cells into an activation signal, increase the activity and persistence of T cells, enhance the killing ability of TCR-T cells on solid tumors that secrete IL4, and improve the anti-tumor efficacy of TCR-T cell therapy. At the same time, a qualitative and quantitative evaluation system for the enhanced function of the TCR-T cells is established. The T cells of the present invention will also expand the application of TCR-T cells in the preparation of living cell drugs for the prevention and treatment of cancer.

[0009] The chimeric cytokine receptor of the present invention comprises an extracellular region, a transmembrane region and an intracellular region;

[0010] The extracellular region is from IL4R,

[0011] The transmembrane region is from an activated cytokine receptor such as IL2R, IL7R or IL21R;

[0012] The intracellular region is from an activated cytokine receptor such as IL2R, IL7R or IL21R;

[0013] In some embodiments, the chimeric cytokine receptor comprises, from N-terminus to C-terminus, the IL4R extracellular region, the IL7R transmembrane region and the IL7R intracellular region.

[0014] in:

[0015] The IL4R extracellular region is a human IL4R extracellular region, and preferably has an amino acid sequence as shown in SEQ ID NO:1, or an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO:1, or an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO:1.

[0016] (SEQ ID NO: 1). The IL7R transmembrane region is a human IL7R transmembrane region, and preferably has an amino acid sequence as shown in SEQ ID NO: 2, or an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 2, or an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 2.

[0017] ProIleLeuLeuThrIleSerIleLeuSerPhePheSerValAlaLeuLeuValIleLeuAlaCysValLeuTrp (SE Q ID NO:2).

[0018] The IL7R intracellular region is a human IL7R intracellular region, and preferably has an amino acid sequence as shown in SEQ ID NO: 3, or an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 3, or an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 3;

[0019] (SEQ ID NO: 3). In some specific embodiments, the chimeric cytokine receptor comprises, from N-terminus to C-terminus, a human IL4R extracellular region, a human IL7R transmembrane region, and a human IL7R intracellular region.

[0020] In a specific embodiment, the amino acid sequence of the chimeric cytokine receptor is:

[0021]

[0022] Biomaterial A, comprising at least one of the following i) to vi):

[0023] i), a chimeric cytokine receptor as described above;

[0024] ii), a nucleic acid encoding the chimeric cytokine receptor described in i);

[0025] iii), an expression unit comprising a promoter and the nucleic acid described in ii);

[0026] iv), a vector comprising the nucleic acid described in ii) or the expression unit described in iii).

[0027] v), a vector combination comprising a viral packaging plasmid and the vector described in iv);

[0028] vi) a transformant which expresses the chimeric cytokine receptor described in i), or has the nucleic acid described in ii) or the expression unit described in iii) integrated into its genome, or is transformed or transfected with a vector containing described in iv).

[0029] In some embodiments, the nucleic acid:

[0030] The nucleic acid encoding the extracellular region of IL4R has the nucleotide sequence shown in SEQ ID NO:4, or has a nucleic acid encoding the extracellular region of IL4R in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO:4, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO:4; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence;

[0031] (SEQ ID NO:4).

[0032] The nucleic acid encoding the transmembrane region of IL7R has the nucleotide sequence shown in SEQ ID NO:5, or has a nucleic acid encoding the transmembrane region of IL7R in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO:5, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO:5; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence;

[0033] cctatcttgttgacaatctcttcctctcctttttcagcgtggccctgctggtgatcctggcctgtgtgctgtgg (SEQ ID NO: 5).

[0034] The nucleic acid encoding the intracellular region of IL7R has the nucleotide sequence shown in SEQ ID NO:6, or has a nucleic acid encoding the intracellular region of IL7R in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO:6, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO:6; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence;

[0035] (SEQ ID NO:6).

[0036] The expression unit comprises, from 5' to 3' end: a promoter, a kozak sequence, a nucleic acid encoding an extracellular region, a nucleic acid encoding a transmembrane region and a nucleic acid encoding an intracellular region; preferably, the promoter is an EF1α promoter, an MSCV promoter or a CMV promoter.

[0037] The backbone vector of the vector is a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

[0038] In some embodiments, the backbone vector is a lentiviral vector. In a specific embodiment, the backbone vector is a pCDH series, a pLenti series, a pLVX series, etc.

[0039] In some embodiments, the host of the transformant is a T cell, a NK cell, a macrophage, a CAR-T cell or a TCR-T cell.

[0040] The present invention also provides a NY-ESO-1 targeted TCR fragment, which includes a NY-ESO-1 specific TCRβ chain variable region, a TCRβ chain constant region, a linker, a NY-ESO-1 specific TCRα chain variable region and a TCRα chain constant region.

[0041] Wherein, the linker is selected from: Furin-linker-spacer-F2A, P2A, T2A or E2A, etc.

[0042] In some embodiments, the NY-ESO-1 targeted TCR fragment, from N-terminus to C-terminus, is: NY-ESO-1 specific TCR β chain variable region, TCR β chain constant region, linker, NY-ESO-1 specific TCR α chain variable region and TCR α chain constant region;

[0043] in:

[0044] The NY-ESO-1 specific TCR β chain variable region is a human NY-ESO-1 specific TCR β chain variable region, preferably having an amino acid sequence as shown in SEQ ID NO: 7, or having an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 7, or having an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 7;

[0045] MetSerIleGlyLeuLeuCysCysAlaAlaLeuSerLeuLeuTrpAlaGlyProValAsnAlaGlyValThrGlnThrProLysPheGlnValLeuLysT hrGlyGlnSerMetThrLeuGlnCysAlaGlnAspMetAsnHisGluTyrMetSerTrpTyrArgGlnAspProGlyMetGlyLeuArgLeuIleHisTy rSerValGlyAlaGlyIleThrAspGlnGlyGluValProAsnGlyTyrAsnValSerArgSerThrThrGluAspPheProLeuArgLeuLeuSerAla AlaProSerGlnThrSerValTyrPheCysAlaSerSerTyrValGlyAsnThrGlyGluLeuPhePheGlyGluGlySerArgLeuThrValLeu(SEQ ID NO:7).

[0046] The TCR β chain constant region is a murine TCR β chain constant region, preferably having an amino acid sequence as shown in SEQ ID NO: 8, or having an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 8, or having an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 8;

[0047] GluAspLeuArgAsnValThrProProLysValSerLeuPheGluProSerLysAlaGluIleAlaAsnLysGlnLysAlaThrLeuValCysLeuAlaArgGlyPhePheProAspHisValGluLeuSe rTrpTrpValAsnGlyLysGluValHisSerGlyValCysThrAspProGlnAlaTyrLysGluSerAsnTyrSerTyrCysLeuSerSerArgLeuArgValSerAlaThrPheTrpHisAsnProArgA snHisPheArgCysGlnValGlnPheHisGlyLeuSerGluGluAspLysTrpProGluGlySerProLysProValThrGlnAsnIleSerAlaGluAlaTrpGlyArgAlaAspCysGlyIleThrSer AlaSerTyrGlnGlnGlyValLeuSerAlaThrIleLeuTyrGluIleLeuLeuGlyLysAlaThrLeuTyrAlaValLeuValSerThrLeuValValMetAlaMetValLysArgLysAsnSer(SEQID NO:8).

[0048] The NY-ESO-1 specific TCR α chain variable region is a human NY-ESO-1 specific TCR α chain variable region, preferably having the amino acid sequence as shown in SEQ ID NO: 9, or having an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 9, or having an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 9;

[0049] MetGluThrLeuLeuGlyLeuLeuIleLeuTrpLeuGlnLeuGlnTrpValSerSerLysGlnGluValThrGlnIleProAlaAlaLeuSerValProG luGlyGluAsnLeuValLeuAsnCysSerPheThrAspSerAlaIleTyrAsnLeuGlnTrpPheArgGlnAspProGlyLysGlyLeuThrSerLeuLeu LeuIleGlnSerSerGlnArgGluGlnThrSerGlyArgLeuAsnAlaSerLeuAspLysSerSerGlyArgSerThrLeuTyrIleAlaAlaSerGlnPr oGlyAspSerAlaThrTyrLeuCysAlaValArgProLeuTyrGlyGlySerTyrIleProThrPheGlyArgGlyThrSerLeuIleValHisPro(SEQ ID NO:9).

[0050] The TCR α chain constant region is a murine TCR α chain constant region, preferably having an amino acid sequence as shown in SEQ ID NO: 10, or having an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 10, or having an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 10;

[0051] LeuSerGlyGlyProGlnSerGlnSerHisGlnGlnIleLysProSerHisLeuGlnGlnGlnAspProGlnHisAspAspGlnGlnValLeuLysIleGlnValHisValCysLeuGluAlaLe uLeuCysGlnGlyGlyIleThrGlyHisValArgGlyTrpIleCysGlyValCysLeuLeuLysAspIleLeuAlaCysGluArgGlyLeuIleGlyProGlyAspGlyAlaValGlyLeuAlaVa lHisGlyLeuHisValGlnHisAlaLeuValCysAspLysGlyAlaArgLeuHisGlyLeuGlyHisValAspLeuGlyIleLysValCysGluGlnAlaGlnGlyGlyIleLeuAlaProTrpV alLeuGlnLeuValHisGlyArgLeuArgIleLeuAspValTrpSerArgIleLeuLeuHisValAlaCysLeuLeuGlnGlnArgGluIleGlyGlyAlaArgAlaAlaProLeuCysPro(SEQ ID NO:10).

[0052] In some specific embodiments, the NY-ESO-1 targeted TCR fragment, from N-terminus to C-terminus, is: human NY-ESO-1 specific TCRβ chain variable region, mouse TCRβ chain constant region, Furin-linker-spacer-F2A, human NY-ESO-1 specific TCRα chain variable region and mouse TCRα chain constant region. Its amino acid sequence is:

[0053]

[0054] The present invention also provides a biomaterial B, which comprises at least one of the following I) to VI):

[0055] I) TCR fragment targeted by NY-ESO-1

[0056] II), a nucleic acid encoding the TCR fragment described in I);

[0057] III), an expression unit comprising a promoter and the nucleic acid described in II);

[0058] IV), a vector comprising the nucleic acid described in II) or the expression unit described in III);

[0059] V), a vector combination, which comprises a viral packaging plasmid and the vector described in IV);

[0060] VI), a transformant which expresses the TCR fragment described in I), or has the nucleic acid described in II) or the expression unit described in III) integrated into its genome, or is transformed or transfected with the vector described in IV).

[0061] In the nucleic acid:

[0062] The nucleic acid encoding the NY-ESO-1 specific TCR β chain variable region has the nucleotide sequence shown in SEQ ID NO: 11, or has a nucleic acid encoding the NY-ESO-1 specific TCR β chain variable region after substitution, deletion or addition of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO: 11, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 11; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence;

[0063] ATGTCCATCGGGCTGCTGTGCTGTGCTGCTCTGTCCCTGCTGTGGGCTGGGCCTGTCAATGCTGGGGTCACTCAGACTCCTAAGTTCCAGGTGCTGAAGACCGGCCAGAGCATGACACTGCAGTGCGCCCAGGATATGAACCACGAGTACATGTCCTGGTATCGGCAGGACCCAGGCATGGGCCTGAGACTGATCCACTA CAGCGTGGGAGCAGGAATCACCGATCAGGGAGAGGTGCCCAACGGCTATAATGTGAGCCGGTCCACCACAGAGGACTTCCCACTGAGACTGCTGAGCGCCGCACCTTCTCAGACCAGCGTGTACTTTTGCGCCAGCTCCTATGTGGGCAATACAGGCGAGCTGTTCTTTGGAGAGGGCTCCAGGCTGACCGTGCTGACCGTGCTG(SEQ ID NO:11).

[0064] The nucleic acid encoding the TCR β chain constant region has the nucleotide sequence shown in SEQ ID NO: 12, or has a nucleic acid encoding the TCR β chain constant region in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO: 12, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 12; or is a nucleic acid that is partially complementary or completely complementary to the aforementioned sequence;

[0065] GAGGATCTGCGCAACGTGACACCCCCTAAGGTGAGCCTGTTCGAGCCTTCCAAGGCCGAGATCGCCAATAAGCAGAAGGCCACCCTGGTGTGCCTGGCCAGAGGCTTCTTTCCAGATCACGTGGAGCTGAG CTGGTGGGTGAACGGCAAGGAGGTGCACTCCGGCGTGTGCACCGACCCACAGGCCTACAAGGAGTCCAATTACTCTTATTGTCTGTCTAGCCGGCTGAGAGTGAGCGCCACATTTTGGCACAACCCCCGGA ATCACTTCAGATGCCAGGTGCAGTTTCACGGCCTGAGCGAGGAGGATAAGTGGCCTGAGGGCTCCCCAAAGCCAGTGACCCAGAACATCTCTGCCGAGGCATGGGGAAGGGCAGACTGTGGAATCACCTCT GCCAGCTATCAGCAGGGCGTGCTGTCCGCCACAATCCTGTACGAGATCCTGCTGGGCAAGGCCACCCTGTATGCCCGTGCTGGTGAGCACCCTGGTGGTCATGGCCATGGTGAAGCGCAAGAACTCC(SEQID NO:12).

[0066] The nucleic acid encoding the NY-ESO-1 specific TCR α chain variable region has the nucleotide sequence shown in SEQ ID NO: 13, or has a nucleic acid encoding the NY-ESO-1 specific TCR α chain variable region after substitution, deletion or addition of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO: 13, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 13; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence;

[0067] ATGGAGACACTGCTGGGCCTGCTGATCCTGTGGCTGCAGCTGCAGTGGGTGTCCTCTAAGCAGGAGGTGACCCAGATCCCTGCCGCCCTGAGCGTGCCAGAGGGAGAGAACCTGGTGCTGAATTGCTCTTTCACAGATAGCGCCATCTACAACCTGCAGTGGTTTCGGCAGGACCCTGGCAAGGGCCTGACCTCTCTGCTG CTGATCCAGAGCTCCCAGAGGGAGCAGACATCCGGCCGCCTGAATGCCTCTGGATAAGTCTAGCGGCAGATCCACCCTGTACATCGCAGCATCTCAGCCAGGCGACAGCGCCACATACCTGTGCGCCGTGAGGCCACTGTACGGAGGATCTTATATCCCCACCTTCGGCAGGGGCACAAGCCTGATCGTGCACCCT(SEQ ID NO:13).

[0068] The nucleic acid encoding the TCR α chain constant region has the nucleotide sequence shown in SEQ ID NO: 14, or has a nucleic acid encoding the TCR α chain constant region in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO: 14, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 14; or is a nucleic acid that is partially complementary or completely complementary to the aforementioned sequence;

[0069] TTATCAGGAGGACCACAGTCTCAGAGTCATCAGCAGATTAAACCCAGCCACCTTCAGCAGCAGATCCGCAGCACGATGACCAGCAGGTTCTGAAAATTCAGGTTCATGTCTGTCTCGAAGCTCTT CTCTGTCAGGGTGGCATCACAGGGCACGTCAGAGGATGGATATGTGGCGTTTGTCTCCTTAAAGATATCCTGGCATGTGAAAGAGGTCTGATTGGACCAGGCGATGGCGCCGTTGGACTTGCTGTC CATGGCCTTCATGTCCAGCACGCACTTGTCTGTGATAAAGGTGCCAGACTCCATGGTCTTGGGCACGTTGATCTGGGAATCAAAGTCTGTGAACAGGCACAGGGTGAATCCTGGCTCCGTGGGTC CTTCAGCTGGTACACGGCAGGCTCCGGATTCTGGATGTTTGGTCCAGGATTCTCCTCCACGTCGCCTGCCTGCTTCAGCAGAGAGAAATTGGTGGCGCCAGAGCCGCTCCGCTTTGCCCTTGA(SEQ ID NO:14)

[0070] The expression unit comprises, from the 5' end to the 3' end, a promoter, a kozak sequence, a nucleic acid encoding a NY-ESO-1-specific TCRβ chain variable region, a nucleic acid encoding a TCRβ chain constant region, a nucleic acid encoding a linker, a nucleic acid encoding a NY-ESO-1-specific TCRα chain variable region, and a nucleic acid encoding a TCRα chain constant region; preferably, the promoter is an EF1α promoter, an MSCV promoter, or a CMV promoter.

[0071] In some embodiments, the backbone vector of the vector is a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

[0072] In some embodiments, the backbone vector is a lentiviral vector. In a specific embodiment, the backbone vector is a pCDH series, a pLenti series, a pLVX series, etc.

[0073] In some embodiments, the host of the transformant is a T cell, a NK cell, a macrophage, a CAR-T cell or a TCR-T cell.

[0074] Furthermore, the present invention also provides a TCR-T cell, which expresses the NY-ESO-1 targeted TCR fragment as described above, or has the nucleic acid or expression unit as described above integrated into its genome, or is transformed or transfected with the vector as described above.

[0075] Furthermore, the present invention also provides a method for constructing TCR-T cells, comprising:

[0076] The host is allowed to express the NY-ESO-1-targeted TCR fragment as described above;

[0077] or integrating the nucleic acid or expression unit as described above into the host genome;

[0078] Or transform or transfect the host with the vector as described above.

[0079] Furthermore, the present invention also provides another TCR-T cell, which expresses the NY-ESO-1 targeted TCR fragment as described above, or has the nucleic acid or expression unit as described above integrated into the genome, or is transformed or transfected with the vector as described above, and expresses the chimeric cytokine receptor fragment as described above, or has the nucleic acid or expression unit as described above integrated into the genome, or is transformed or transfected with the vector as described above. The transformation or transfection method includes but is not limited to overexpression methods such as lentivirus, adenovirus, adeno-associated virus, electroporation, and chemical transfection.

[0080] Furthermore, the present invention also provides a method for constructing the TCR-T cell, which comprises:

[0081] Allowing the host to express the NY-ESO-1-targeting TCR fragment as described above, and the chimeric cytokine receptor as described above;

[0082] or integrating the nucleic acid or expression unit as described above into the host genome;

[0083] Or transform or transfect the host with the vector as described above, and the vector as described above.

[0084] The transformation or transfection method includes but is not limited to overexpression methods such as lentivirus, adenovirus, adeno-associated virus, electroporation, and chemical transfection.

[0085] Furthermore, the present invention also provides at least one of the following uses:

[0086] a) Use of IL4 antibody and / or IL4R antibody in the preparation of drugs for improving the activity of TCR-T cells;

[0087] b) Application of the aforementioned biomaterials in improving the activity of TCR-T cells;

[0088] c) Use of the aforementioned biomaterial in the preparation of drugs for treating tumors;

[0089] d) Use of the aforementioned TCR-T cells in the preparation of drugs for treating tumors;

[0090] e) Use of TCR-T cells and other cells prepared by the preparation method as described above in the preparation of drugs for treating tumors.

[0091] In the present invention, the improvement of TCR-T cell activity includes: relieving the inhibition of IL4 on TCR-T cells, enhancing the proliferation ability of TCR-T cells and / or enhancing the anti-tumor killing ability of TCR-T cells against IL4-positive tumors.

[0092] Furthermore, the present invention also provides a medicine, which comprises at least one of the following A) to E):

[0093] A), TCR-T cells, IL4 antibody and / or IL4R antibody;

[0094] B) at least one of the aforementioned biomaterials;

[0095] C), at least one of the TCR-T cells described above;

[0096] D) TCR-T cells prepared by the preparation method described above.

[0097] The drug described in the present invention includes at least two forms. First, it includes antibodies to cells such as TCR-T or CAR-T and cytokines, wherein the antibodies are used to block cytokine receptors on the surface of cells such as TCR-T or CAR-T. Cells such as TCR-T or CAR-T may or may not have targeting, which is not limited by the present invention. Second, cells such as TCR-T or CAR-T are made to express cytokine receptors endogenously to achieve the inhibitory effect of cytokines on cellular drugs such as TCR-T or CAR-T in the closed tumor microenvironment. The expression of endogenous cytokine receptors can be in the same cell or in different cells. When it is in the same cell, the exogenous fragments can be in the same vector or in different vectors, which is not limited by the present invention.

[0098] The medicine of the present invention also includes other therapeutic agents, which are selected from other drugs for treating tumors. The other drugs for treating tumors include but are not limited to cisplatin, paclitaxel, gemcitabine, bevacizumab, apatinib, anlotinib, pembrolizumab, carrelizumab, ginsenosides, ganoderma lucidum extract or cordyceps sinensis.

[0099] In the present invention, the tumor refers to a malignant tumor, which includes solid tumors and non-solid tumors. The solid tumors include: cervical cancer, ovarian cancer, endometrial cancer, vulvar cancer, prostate cancer, parotid cancer, thyroid cancer, salivary gland cancer, lung cancer, fibrosarcoma, skin cancer, nasopharyngeal cancer, tongue cancer, oral cancer, laryngeal cancer, brain tumor, gallbladder cancer, kidney cancer, gum cancer, testicular cancer, penis cancer, multiple myeloma and / or malignant melanoma; the non-solid tumors include: leukemia and / or malignant lymphoma.

[0100] Furthermore, the present invention provides a method for treating tumors, which comprises administering the above-mentioned drug.

[0101] In the present invention, the administration method includes but is not limited to oral, spray inhalation, rectal, nasal, buccal, vaginal, topical or parenteral administration. The parenteral administration includes subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal and intracranial injection or infusion, or administration with the aid of an explanted reservoir. Among them, oral, intraperitoneal or intravenous administration is preferred. (If it is an IL4R / IL7R enhanced TCR-T cell drug, it is mainly intravenous reinfusion. If it is a TCR-T drug combined with IL4 antibody or IL4R antibody, the use of the antibody drug can be intravenous, subcutaneous, oral, etc.)

[0102] The present invention introduces IL4R / IL7R chimeric cytokine receptors into TCR-T or CAR-T cells by genetic engineering methods to obtain TCR-T or CAR-T cells that can be used to treat IL4-positive solid tumors. This new combination method can not only relieve the immunosuppression mediated by the binding of IL4 and IL4R, but also reverse the inhibitory signal to an activation signal, promote further proliferation and killing of TCR-T or CAR-T cells, obtain enhanced anti-tumor activity TCR-T or CAR-T cell drugs, and achieve a highly effective anti-tumor effect.

[0103] Compared with the simple IL4 antibody or IL4R antibody blocking technology, the present invention constructs a vector for the coordinated expression of multiple genes through genetic engineering technology, which can introduce exogenous IL4R / IL7R and TCR molecules into T cells at the same time. The constructed enhanced TCR-T cells can express IL4R and continuously block IL4 in the tumor microenvironment. It is not only an alternative method for IL4 antibody or IL4R antibody blocking, but also because of the presence of IL7R elements, it can obtain a more lasting T cell proliferation and killing ability than the simple IL4 antibody or IL4R antibody blocking. Not only does it reduce the continuous use of IL4 antibody or IL4R antibody, it also means that the preparation process and time of cells such as TCR-T are shortened, saving the time and economic cost of repeated treatment of cells such as TCR-T or CAR-T. BRIEF DESCRIPTION OF THE DRAWINGS

[0104] Figure 1 HEK-293FT was transfected with pCDH-EF1a-NY-ESO-1TCR recombinant plasmid for expression identification;

[0105] Figure 2 HEK-293FT was transfected with pCDH-EF1a-IL4R / IL7R recombinant plasmid for expression identification;

[0106] Figure 3 Identification of NY-ESO-1-specific TCR-T cell lines expressing IL4R / IL7R chimeric cytokine receptors;

[0107] Figure 4 Identification of NY-ESO-1-specific TCR-T cells expressing IL4R / IL7R chimeric cytokine receptors;

[0108] Figure 5 To compare the proliferation capacity of enhanced NY-ESO-1-specific TCR-T cell lines;

[0109] Figure 6 Comparison of the killing ability of enhanced NY-ESO-1-specific TCR-T cells

[0110] Figure 7 To compare the killing ability of enhanced HER2-specific CAR-T cells. DETAILED DESCRIPTION

[0111] The present invention provides a chimeric receptor gene-modified enhanced TCR-T model and its construction method and application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be noted in particular that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0112] Unless otherwise defined herein, scientific and technical terms related to the present invention shall have the meanings understood by those of ordinary skill in the art.

[0113] The terms "include", "comprising" and "having" are used interchangeably herein and are intended to indicate the inclusiveness of the solution, meaning that the solution may have other elements in addition to the listed elements. At the same time, it should be understood that the use of "include", "comprising" and "having" descriptions herein also provides a "consisting of..." solution.

[0114] The term "and / or" as used herein includes the meanings of "and", "or" and "all or any other combination of elements linked by the corresponding term".

[0115] In this application, "at least one" means one or more, "more than one" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single or plural items.

[0116] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0117] The term "TCR" in this article refers to T cell receptor (T cell receptor, TCR), which is a specific receptor present on the surface of T cells that can recognize and bind to protein antigens. It specifically recognizes and binds to specific antigen peptides presented by the major histocompatibility complex (MHC) on the surface of antigen presenting cells (APC) to form a TCR-antigen peptide-MHC complex (TCR-pMHC complex), initiates the first transduction signal, thereby inducing the activation of T cells and exerting adaptive immune effector functions.

[0118] The term "chimeric" or "fusion" herein refers to the combination of two or more fragments (nucleic acids, proteins or polypeptides), for example: connecting two or more genes together to form a chimeric gene; connecting two or more proteins (polypeptides) together to form a chimeric protein; the term "chimeric cytokine receptor" herein refers to a fusion protein formed by combining two or more cytokine receptor fragments. The chimeric cytokine receptor described herein is composed of an extracellular region, a transmembrane region and an intracellular region, wherein the extracellular region recognizes and binds to specific signal molecules or ligands, thereby affecting the function of the cell. The transmembrane region helps maintain the structural and functional integrity of the cell membrane. Intracellular region: interacts with other proteins and signal molecules in the cell, thereby affecting signal transduction and substance transport in the cell.

[0119] The term "nucleic acid" herein includes any compound and / or substance comprising a polymer of nucleotides. Each nucleotide is composed of a base, particularly a purine or pyrimidine base (i.e., cytosine (C), guanine (G), adenine (A), thymine (T) or uracil (U)), a sugar (i.e., deoxyribose or ribose) and a phosphate group. Typically, nucleic acid molecules are described by a sequence of bases, whereby the bases represent the primary structure (linear structure) of the nucleic acid molecule. The sequence of bases is typically expressed as 5' to 3'. In this article, the term nucleic acid molecule encompasses deoxyribonucleic acid (DNA), including, for example, complementary DNA (cDNA) and genomic DNA, ribonucleic acid (RNA), particularly messenger RNA (mRNA), synthetic forms of DNA or RNA, and polymers comprising a mixture of two or more of these molecules. Nucleic acid molecules can be linear or cyclic. In addition, the term nucleic acid molecule includes both sense and antisense strands, as well as single-stranded and double-stranded forms. Moreover, nucleic acid molecules as described herein may contain naturally occurring or non-naturally occurring nucleotides. Examples of non-naturally occurring nucleotides include modified nucleotide bases with derived sugar or phosphate backbone bonds or chemically modified residues. Nucleic acid molecules also encompass DNA and RNA molecules, which are suitable as vectors for direct expression of antibodies of the present invention in vitro and / or in vivo, such as in a host or patient. Such DNA (e.g., cDNA) or RNA (e.g., mRNA) vectors can be unmodified or modified. "Isolated" nucleic acid herein refers to a nucleic acid molecule that has been separated from the components of its natural environment. Isolation nucleic acid includes a nucleic acid molecule contained in the following cells, which cells typically contain the nucleic acid molecule, but the nucleic acid molecule is present outside the chromosome or is present at a chromosomal position different from its natural chromosomal position.

[0120] The term "expression unit" herein refers to a DNA sequence used to control gene or protein expression. Its main function is to guide gene transcription and translation, and to regulate protein expression levels. In the present invention, an expression unit may include only a promoter and one or more genes, or may also include other regulatory elements, such as terminators, enhancers, silencers, etc.

[0121] The term "vector" herein refers to a nucleic acid molecule capable of amplifying another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures as well as vectors that integrate into the genome of a host cell into which the vector has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[0122] The term "transformant" herein refers to an organism into which a target gene has been successfully introduced after the transformation process, including the offspring of such an organism. The offspring may not be identical to the parent cell in nucleic acid content, but may contain mutations. Mutant offspring having the same function or biological activity as screened or selected in the initially transformed cell are included herein.

[0123] The term "drug" herein refers to a preparation which is in a form which permits the biological activity of the active ingredient contained therein to be effective and which contains no additional ingredients which are unacceptably toxic to a subject to which the pharmaceutical composition is administered.

[0124] The term "treatment" herein refers to surgical or therapeutic treatment, the purpose of which is to prevent, slow down (reduce) undesirable physiological changes or lesions in the treated subject, such as cancer and tumors. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction of disease severity, stabilization of the disease state (i.e., no deterioration), delay or slowing of disease progression, improvement or alleviation of the disease state, and relief (whether partial relief or complete relief), whether detectable or undetectable. Subjects in need of treatment include subjects who already have a disorder or disease, as well as subjects who are susceptible to a disorder or disease or subjects who intend to prevent a disorder or disease. When referring to terms such as slowing down, alleviating, weakening, alleviating, and alleviating, their meanings also include situations such as elimination, disappearance, and non-occurrence.

[0125] As used herein, the term "effective amount" refers to an amount of a therapeutic agent that is effective in preventing or alleviating a disease condition or the progression of the disease when administered alone or in combination with another therapeutic agent to a cell, tissue, or subject. "Effective amount" also refers to an amount of a compound sufficient to relieve symptoms, such as to treat, cure, prevent, or alleviate a related medical condition, or to increase the rate of treatment, cure, prevent, or alleviate these conditions. When an active ingredient is administered alone to an individual, a therapeutically effective dose refers to that ingredient alone. When a combination is used, a therapeutically effective dose refers to the combined amount of the active ingredients that produces a therapeutic effect, whether administered in combination, sequentially, or simultaneously.

[0126] The term "cancer" herein refers to or describes a physiological condition in mammals that is typically characterized by unregulated cell growth. Both benign and malignant cancers are included in this definition. The term "tumor" or "neoplasm" herein refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. The terms "cancer" and "tumor" are not mutually exclusive when referred to herein.

[0127] The term "subject" herein refers to an organism that is treated for a specific disease or condition as described herein. Exemplarily, a "subject" includes a mammal, such as a human, a primate (e.g., a monkey), or a non-primate mammal that is treated for a disease or condition. The non-primate mammal includes bovines, equines, ovines, porcines, canines, felines, or rodents, wherein the preferred mammal is a human, a cat, a dog, or a pig.

[0128] The cytokine blockade of the present invention is used for adoptive immunotherapy of immune cells, wherein the cytokine may be one or more, which may be an antibody to the cytokine, added exogenously during the immune cell culture process, or endogenously produced by genetic engineering. The genetic engineering means include but are not limited to gene targeting technology, TALENs technology, ZFNs technology, CRISPR-Cas9 technology. In an embodiment of the present invention, the cells are overexpressed with exogenous genes by retrovirus, electroporation, chemical transformation, etc.

[0129] In the present invention, if the number of exogenous fragments is greater than 1, they can be in the same vector or in different vectors. The vectors for introducing exogenous genes can be the same or different. In some specific embodiments, the vectors for introducing exogenous genes are lentiviral vectors. The exogenous fragments are connected in series in the vector in the form of IRES, 2A or dual promoters.

[0130] In the present invention, the immune cells used for adoptive immunotherapy include but are not limited to: CAR-T cells, TCR-T cells, CAR-NK cells or macrophages. Among them, TCR-T cells or CAR-T cells are targeted or non-targeted. For example, CAR-T cells targeting PSCA and CAR-T cells targeting MUC1. In the present invention, NY-ESO-1 targeted TCR-T cells or HER2 targeted CAR-T cells are used for experiments.

[0131] The present invention utilizes IL4R / IL7R chimeric cytokine receptors to block the inhibitory effect of IL4, thereby relieving the inhibition of IL4 on TCR-T cells and enhancing the proliferation ability of TCR-T cells and the anti-tumor killing ability of IL4-positive tumors.

[0132] In addition, the above-mentioned technology for blocking the inhibitory effect of IL4 in TCR-T cells is not limited to the IL4R / IL7R chimeric cytokine receptor gene editing method, but includes the therapeutic combination of TCR-T or CAR-T cells and IL4 antibodies or IL4R antibodies, enhanced TCR-T or CAR-T cells that are gene-edited to overexpress IL4 antibodies or IL4R antibodies in TCR-T or CAR-T cells, and gene-edited TCR-T or CAR-T cells that are gene-edited to overexpress other activated chimeric cytokine receptors such as IL4R / IL2R, IL4R / IL21R, etc.

[0133] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0134] The nucleic acid sequences and / or amino acid sequences involved in the embodiments are as follows:

[0135] ① Human NY-ESO-1 specific TCRβ chain variable region:

[0136]

[0137] ② Mouse TCRβ chain constant region:

[0138]

[0139]

[0140] ③Furin-linker-spacer-F2A

[0141]

[0142] ④ Human NY-ESO-1 specific TCRα chain variable region

[0143] ⑤ Mouse TCRα chain constant region

[0144] ⑥IL4R extracellular region:

[0145]

[0146]

[0147] ⑦IL7R transmembrane region:

[0148] ⑧IL7R intracellular region:

[0149]

[0150]

[0151] The present invention will be further described below in conjunction with embodiments:

[0152] Example 1 Recombinant plasmid construction

[0153] (1) Construction of recombinant pCDH-EF1α-NY-ESO-1TCR vector:

[0154] NY-ESO-1 TCR element sequence assembly: from N-terminus to C-terminus, it is the human NY-ESO-1 specific TCRβ chain variable region, the mouse TCRβ chain constant region, Furin-linker-spacer-F2A, the human NY-ESO-1 specific TCRα chain variable region and the mouse TCRα chain constant region. The schematic diagram of the tandem assembly sequence is shown in the figure. Figure 1 .

[0155] The self-assembled NY-ESO-1TCR target gene sequence was codon optimized. The codon-optimized nucleic acid sequence was synthesized at Nanjing GenScript, and the restriction sites EcoRI and SalI were introduced, and the kozak sequence GCCACC was added, where EcoRI was located at the 5' end of the sequence, SalI was located at the 3' end of the sequence, and the kozak sequence was located before the start codon. The DNA sequence of the synthesized NY-ESO-1mTCR gene was cloned into the lentiviral expression vector pCDH-EF1α-Luc2-T2A-tdTomato (purchased from Wuhan Miaoling Biology) using the restriction sites EcoRI and SalI, and the promoter was EF1α, and a recombinant expression plasmid expressing NY-ESO-1TCR was established, named pCDH-EF1α-NY-ESO-1TCR.

[0156] (2) Construction of recombinant pCDH-EF1α-IL4R / IL7R vector:

[0157] IL4R / IL7R element sequence assembly: From the N-terminus to the C-terminus, there are the human IL4R extracellular region, IL7R transmembrane region and IL7R intracellular region. The schematic diagram of the tandem assembly sequence is as follows:

[0158] The self-assembled IL4R / IL7R target gene sequence was codon optimized. The codon-optimized nucleic acid sequence was synthesized at Nanjing GenScript, and the restriction sites EcoRI and SalI were introduced, and the kozak sequence GCCACC was added, where EcoRI was located at the 5' end of the sequence, Sal I was located at the 3' end of the sequence, and the kozak sequence was located before the start codon. The DNA sequence of the synthetic IL4R / IL7R gene was cloned into the lentiviral expression vector pCDH-EF1α-Luc2-T2A-tdTomato (purchased from Wuhan Miaoling Biology) using the restriction sites EcoRI and Sal I, and the promoter was EF1α, and a recombinant expression plasmid expressing IL4R / IL7R was established, named pCDH-EF1α-IL4R / IL7R.

[0159] Example 2 Preparation and collection of recombinant plasmid lentivirus

[0160] (1) EndoFree Plasmid Extraction from Recombinant Plasmid: The kit is a commercial EndoFree Plasmid Extraction Kit (EndoFree Plasmid MaxiKit, brand: QIAGEN). For specific experimental steps, refer to the kit manual.

[0161] (2) Preparation of recombinant plasmid lentivirus:

[0162] ① Virus packaging preparation: The ratio of virus packaging MIX plasmid is 2:2:1 for pLP1:pLP2:pLP-VSVG; the ratio of transfection reagent to plasmid DNA is 3:1 (mass ratio) for PEI to plasmid DNA.

[0163] ② Virus packaging: Transfection was performed when the confluence of HEK-293FT cells reached 90%; Preparation of transfection premix (measured as one portion for 10 cm dish): Plasmid mixture was 500 μL Opti-MEM medium, 9 μg of packaging MIX plasmid and 5 μg of target plasmid (pCDH-EF1α-NY-ESO-1TCR or pCDH-EF1α-IL4R / IL7R) were added, and vortexed to mix thoroughly. PEI mixture was 500 μL Opti-MEM medium, 42 μg PEI was added, and vortexed to mix thoroughly. Let stand for 10 minutes. 500 μL PEI mixture was added to 500 μL plasmid mixture, vortexed to mix thoroughly, and incubated at room temperature for 20 minutes. The incubated mixture was gently added to HEK 293-FT cells along the side wall of the culture dish.

[0164] (3) Collection and concentration of recombinant plasmid lentiviral supernatant:

[0165] The virus supernatant was collected at 48 hours and 72 hours after transfection and directly frozen in a -80 degrees Celsius low-temperature refrigerator for later use.

[0166] Or concentrate the virus: centrifuge the virus supernatant at room temperature for 5 minutes, remove cell debris with a 0.45μm filter, collect the filtered virus supernatant, and transfer it to an ultracentrifuge tube. Centrifuge at 20000g, 4℃ for 90min. After discarding the supernatant, resuspend the virus precipitate with 100 times the concentrated volume of serum-free X-VIVO medium (Lonza), aliquot and store in a -80℃ low-temperature refrigerator for later use.

[0167] (4) Flow cytometry was used to detect the expression of HEK-293FT cells to evaluate the expression integrity of the target sequence:

[0168] HEK-293FT cells transfected with two target plasmids were digested with trypsin, washed twice with PBS, and 1×10^6 cells were resuspended in 100μL PBS buffer in a 1.5mL EP tube. Non-transfected 293FT cells were used as negative controls. The corresponding flow detection antibodies were added according to the dosage in the instructions. The expression integrity of NY-ESO-1 specific TCR was detected with anti-mouse TCRβ flow cytometry monoclonal antibody (thermofisher), and the expression integrity of IL4R / IL7R was detected with anti-IL4R flow cytometry monoclonal antibody (R&D). The cells were incubated at room temperature and away from light for 15 minutes. After the fluorescent antibody incubation, the cells were mixed and washed twice with 1mL PBS buffer, each time at 800rpm for 5 minutes. After centrifugation, the cells were resuspended in 200-300μL PBS buffer and analyzed by flow cytometry.

[0169] Figure 1 It showed that NY-ESO-1-specific TCR was correctly expressed in 293-FT cells, and the transfection efficiency could reach 99.17%; Figure 2 The results showed that IL4R / IL7R was correctly expressed in 293-FT cells, and the transfection efficiency was 88.6%. The above results indicate that the sequence assembly is correct and the complete NY-ESO-1 specific TCR element and IL4R / IL7R element can be expressed by the above system.

[0170] Example 3 Preparation and expression identification of IL4R / IL7R chimeric cytokine receptor modified TCR-T cells:

[0171] (1) Recombinant lentivirus co-infection of J.RT3-T3.5 cell line and expression detection:

[0172] J.RT3-T3.5 is a T-cell leukemia cell line Jurkat variant, which is a tool cell that can be used to simulate normal T cells for expression and immune function detection. J-RT3-T3.5 cells were 1×10 6 / 200μL in a 24-well plate; add 1mL of viral supernatant and 8μg / mL polybrene, and culture in a cell incubator at 37°C, 5% CO2; after 72 hours, detect the expression of the target NY-ESO-1 specific TCR and IL4R / IL7R genes.

[0173] J-RT3-T3.5 cells co-infected with recombinant lentivirus were resuspended into single cells, washed twice with PBS, and resuspended in 100 μL PBS buffer to 1×10 6 Cells were placed in a 1.5 mL EP tube, and uninfected J-RT3-T3.5 cells were used as negative controls. The corresponding flow cytometry antibodies were added according to the dosage in the instructions. The expression of NY-ESO-1 specific TCR was detected with anti-mouse TCRβ-Percp cy5.5 flow cytometry monoclonal antibody (thermofisher), and the expression of IL4R / IL7R was detected with anti-IL4R-PE flow cytometry monoclonal antibody (R&D). Incubate at room temperature in the dark for 15 minutes. After the fluorescent antibody incubation, wash twice with 1 mL PBS buffer, 400g each time, 5 minutes. After centrifugation, resuspend with 200-300 μL PBS buffer and analyze by flow cytometry.

[0174] Figure 3 The results showed that a TCR-T cell line expressing only NY-ESO-1 specific TCR and an enhanced NY-ESO-1 specific TCR-T cell line co-expressing IL4R / IL7R were successfully prepared. The expression efficiency of the cell line infected with the NY-ESO-1 specific TCR recombinant lentivirus alone reached 99.9%, and the co-expression efficiency of NY-ESO-1 TCR and IL4R / IL7R in the combined infection group reached 99.7%.

[0175] (2) Recombinant lentivirus co-infection of peripheral blood T cells and expression detection:

[0176] Peripheral blood mononuclear cells (PBMCs) were isolated from fresh peripheral blood by Ficoll density gradient centrifugation and activated with T cell culture medium for 3 days before co-infection with recombinant lentivirus. The density of peripheral blood T cells was adjusted to 1×10 6 The cells were plated in 24-well plates at a concentration of 500 μL / well and concentrated lentivirus and 8 μg / mL polybrene were added at a ratio of MOI ≥ 5. The cells were cultured in a 37°C, 5% CO2 incubator. The expression of NY-ESO-1-specific TCR and IL4R / IL7R was detected after 72 hours.

[0177] Peripheral blood T cells co-infected with recombinant lentivirus were resuspended into single cells, washed twice with PBS, and resuspended in 100 μL PBS buffer to 1×10 6Cells were placed in a 1.5 mL EP tube, with uninfected peripheral blood T cells as negative control. The corresponding flow cytometry antibodies were added according to the dosage in the instructions, and the expression of NY-ESO-1 specific TCR was detected with anti-mouse TCRβ-PE flow cytometry monoclonal antibody (thermofisher), and the expression of IL4R / IL7R was detected with anti-IL4R flow cytometry monoclonal antibody-PE (R&D), and incubated at room temperature in the dark for 15 minutes. After the fluorescent antibody incubation, wash twice with 1 mL PBS buffer, 400g each time, 5 minutes. After centrifugation, resuspend with 200-300 μL PBS buffer and analyze and detect by flow cytometry.

[0178] Figure 4 It shows that TCR-T cells expressing only NY-ESO-1 specific TCR and enhanced NY-ESO-1 specific TCR-T cells co-expressing IL4R / IL7R were successfully prepared. Among them, the expression efficiency of the recombinant lentivirus infected with NY-ESO-1 specific TCR alone can reach 75.5%, and the co-expression efficiency of NY-ESO-1TCR and IL4R / IL7R in the combined infection group can reach 26.7%. TCR-T cell lines expressing only NY-ESO-1 specific TCR and enhanced NY-ESO-1 specific TCR-T cells co-expressing IL4R / IL7R were prepared respectively, and downstream enhanced immune function verification was planned. The test methods for enhanced TCR-T cells include proliferation ability detection and specific recognition and killing ability detection.

[0179] Example 4 Evaluation of the proliferation ability of IL4R / IL7R gene-modified enhanced TCR-T cell lines:

[0180] The uninfected J.RT3-T3.5 cell line (referred to as J.RT3-T3.5-mock) and the common NY-ESO-1 specific J.RT3-T3.5T cell line (referred to as J.RT3-T3.5-NY-ESO-1TCR) in the control group, and the NY-ESO-1 specific J.RT3-T3.5T cell line (referred to as J.RT3-T3.5-NY-ESO-1TCR+IL4 / IL7R) in the experimental group were plated on 12-well plates at 25,000 cells per well. Each group was divided into two groups, one with IL4 added and one without IL4 cytokine, for a total of 6 groups. All of them were cultured in 10% FBS DMEM medium containing 400U / mL cytokine IL-4. Each group was set up with 4 replicate wells, and the medium containing IL-4 was added twice a week. The cells were counted by trypan blue staining on the 18th day.

[0181] Figure 5The results showed that under the culture conditions of the inhibitory cytokine IL-4, the proliferation ability of the cells in the control group decreased compared with the group without factor addition, indicating that IL4 inhibited the proliferation ability of T cells in the control group. However, the proliferation ability of enhanced TCR-T cells modified by IL4R / IL7R chimeric cytokine receptors increased under the IL-4 cytokine conditions compared with those without factor addition (independent sample t test, p<0.001), indicating that IL4R / IL7R chimeric cytokine receptors can reverse the inhibitory effect of cytokine IL4 on T cells and turn them into activation signals that promote T cell proliferation, confirming that IL4R / IL7R chimeric cytokine receptors can significantly enhance the immune function of TCR-T cells.

[0182] Example 5 Evaluation of the specific recognition and killing ability of IL4R / IL7R gene-modified enhanced TCR-T cell line:

[0183] T2 cells were used as antigen presenting cells and loaded with NY-ESO-1 (157-165V, SLLMWITQV) antigen peptide 10ug / mL for 3 hours, and washed with PBS buffer 3 times to remove free unloaded antigen peptides. The TCR-T cell density was adjusted to 2.5×10 4 / mL, and incubated with T2 cells loaded with antigen peptides at an effector-target ratio of 8:1 in a cell incubator for 24 hours, with a final volume of 200μL. Among them, the common NY-ESO-1-specific peripheral blood TCR-T cells (abbreviated as NY-ESO-1TCR-T) were used as the control group, and the IL4R / IL7R gene-modified enhanced NY-ESO-1-specific peripheral blood TCR-T cells (abbreviated as NY-ESO-1TCR-T-IL4R / IL7R) were used as the experimental group. There were 2 groups in total, all of which were cultured in X-VIVO15 serum-free medium containing 400U / mL cytokine IL-4, with 3 replicates set for each group.

[0184] After 24 hours of co-incubation, 100 μL of supernatant was collected for IFN-γ ELISA (Shanghai Yikesai Biotechnology) detection, according to the instructions:

[0185] ① Take out the cytokine ELISA strips 20 minutes in advance. Add 100 μL of the prepared samples and standards to each well of the ELISA plate in order, seal the reaction wells with sealing tape, incubate at 37°C for 90 minutes, and keep the blank wells.

[0186] ② Add 350 μL Wash Buffer to each well, let stand for 30 seconds, discard the supernatant, pat dry with thick paper, and repeat 5 times.

[0187] ③ Antibody incubation: Prepare biotinylated antibody diluent 30 minutes in advance, dilute 100× concentrated biotinylated antibody to 1× with reagent diluent. Add 100 μL of diluted antibody to the corresponding well (excluding blank wells) in each well. Seal the reaction wells with sealing tape and incubate at 37°C for 60 minutes.

[0188] ④Wash Buffer 350μL per well, let stand for 30s, discard the supernatant, pat dry with thick paper, and repeat 5 times. After the last wash, pat dry the waste liquid as much as possible;

[0189] ⑤ Enzyme-substrate binding reaction: Prepare the enzyme binding working solution 30 minutes in advance, and dilute the 100× concentrated enzyme conjugate to 1× with the reagent diluent. Add 100 μL of the diluted working solution to the corresponding well (excluding the blank well), seal the reaction well with sealing tape, and incubate at 37°C in the dark for 30 minutes.

[0190] ⑥Wash Buffer 350 μL per well, let stand for 30 seconds, discard the supernatant, pat dry with thick paper, and repeat 5 times;

[0191] ⑦ Color reaction: add color substrate (including blank wells 100 μL / well, incubate at 37℃ in dark for 15 min;

[0192] ⑧ Add stop solution (including blank wells 100 μL / well, mix well and detect OD450 value (within 10 minutes).

[0193] Figure 6 The results showed that under the conditions of IL4 cytokine, enhanced TCR-T cells introduced with IL4R / IL7R chimeric cytokine receptors were able to produce higher levels of IFNγ than TCR-T cells without the introduction of IL4R / IL7R chimeric cytokine receptors after co-incubation with T2 loaded with NY-ESO-1 (157-165V) antigen peptide (independent sample t test, p<0.05), indicating that the specific recognition and killing function of the enhanced TCR-T cells was significantly enhanced.

[0194] Example 6 Evaluation of the specific recognition and killing ability of IL4R / IL7R gene-modified enhanced HER-2 targeted CAR-T cell lines:

[0195] The HER2-positive SKOV3 ovarian cancer cell line was used as the target cell, and the number of HER2-positive CAR-T cells modified with IL4R / IL7R chimera (abbreviated as HER2 CAR-T-IL4R / IL7R) was adjusted to 2.5×10 6 / mL, and co-incubated with SKOV3 cell line with effector-target ratio of 10:1, with a final volume of 200μL. The group without IL-4 cytokine was used as the control group, and the group with 10ug / mL cytokine IL-4 culture system was used as the experimental group. After 24 hours of co-incubation, 100μL of supernatant was collected for IFN-γ ELISA (Shanghai Yikesai Biological), and the ELISA operation method was the same as that in Example 5.

[0196] Figure 7 The results showed that under the condition of IL4 cytokine, enhanced HER2-targeted CAR-T cells with introduced IL4R / IL7R chimeric cytokine receptors were able to produce higher levels of IFNγ than HER2-targeted CAR-T cells without cytokine addition after co-incubation with target cells (independent sample t-test, p<0.001), indicating that the specific recognition and killing function of enhanced HER2-targeted CAR-T cells was significantly enhanced.

[0197] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Biomaterial A, comprising: i), a chimeric cytokine receptor comprising an extracellular region, a transmembrane region and an intracellular region; The extracellular region is from IL4R, The transmembrane region is from IL2R, IL7R or IL21R; The intracellular region is from IL2R, IL7R or IL21R; ii), a nucleic acid encoding the chimeric cytokine receptor described in i); iii), an expression unit comprising a promoter and the nucleic acid described in ii); iv), a vector comprising the nucleic acid described in ii) or the expression unit described in iii); v), a vector combination comprising a viral packaging plasmid and the vector described in iv); vi) a transformant which expresses the chimeric cytokine receptor described in i), or has the nucleic acid described in ii) or the expression unit described in iii) integrated into its genome, or is transformed or transfected with a vector containing described in iv).

2. The biomaterial A according to claim 1, characterized in that: The chimeric cytokine receptor comprises, from N-terminus to C-terminus, the IL4R extracellular region, the IL7R transmembrane region and the IL7R intracellular region, wherein: The IL4R extracellular region is a human IL4R extracellular region, preferably having an amino acid sequence as shown in SEQ ID NO: 1, or having an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 1, or having an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 1; The IL7R transmembrane region is a human IL7R transmembrane region, and preferably has an amino acid sequence as shown in SEQ ID NO: 2, or an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 2, or an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 2; The IL7R intracellular region is a human IL7R intracellular region, and preferably has an amino acid sequence as shown in SEQ ID NO: 3, or an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 3, or an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 3; In the nucleic acid: The nucleic acid encoding the extracellular region of IL4R has the nucleotide sequence shown in SEQ ID NO:4, or has a nucleic acid encoding the extracellular region of IL4R in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO:4, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO:4; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence; The nucleic acid encoding the transmembrane region of IL7R has the nucleotide sequence shown in SEQ ID NO:5, or has a nucleic acid encoding the transmembrane region of IL7R in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO:5, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO:5; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence; The nucleic acid encoding the intracellular region of IL7R has the nucleotide sequence shown in SEQ ID NO:6, or has a nucleic acid encoding the intracellular region of IL7R in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO:6, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO:6; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence; The expression unit comprises, from the 5' end to the 3' end, a promoter, a kozak sequence, a nucleic acid encoding an extracellular region, a nucleic acid encoding a transmembrane region, and a nucleic acid encoding an intracellular region; preferably, the promoter is an EF1α promoter, an MSCV promoter, or a CMV promoter; The backbone vector of the vector is a lentiviral vector, an adenoviral vector or an adeno-associated viral vector; The host of the transformant is a T cell, a NK cell or a macrophage.

3. The biomaterial according to claim 2, characterized in that The host of the transformant is a CAR-T cell or a TCR-T cell.

4. Biomaterial B, comprising: I), a NY-ESO-1 targeted TCR fragment, which includes a NY-ESO-1 specific TCR β chain variable region, a TCR β chain constant region, a linker, a NY-ESO-1 specific TCR α chain variable region and a TCR α chain constant region; II), a nucleic acid encoding the TCR fragment described in I); III), an expression unit comprising a promoter and the nucleic acid and amino acid sequence described in II); IV), a vector comprising the nucleic acid described in II) or the expression unit described in III); V), a vector combination, which comprises a viral packaging plasmid and the vector described in IV); VI), a transformant which expresses the TCR fragment described in I), or has the nucleic acid described in II) or the expression unit described in III) integrated into its genome, or is transformed or transfected with the vector described in IV).

5. The biomaterial B according to claim 4, characterized in that: The TCR fragment targeted by NY-ESO-1, from N-terminus to C-terminus, is composed of the NY-ESO-1 specific TCRβ chain variable region, TCRβ chain constant region, linker, NY-ESO-1 specific TCRα chain variable region and TCRα chain constant region; wherein: The NY-ESO-1 specific TCR β chain variable region is a human NY-ESO-1 specific TCR β chain variable region, preferably having an amino acid sequence as shown in SEQ ID NO: 7, or having an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 7, or having an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 7; The TCR β chain constant region is a murine TCR β chain constant region, preferably having an amino acid sequence as shown in SEQ ID NO: 8, or having an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 8, or having an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 8; The linker is selected from: Furin-linker-spacer-F2A, P2A, T2A or E2A; The NY-ESO-1 specific TCR α chain variable region is a human NY-ESO-1 specific TCR α chain variable region, preferably having the amino acid sequence as shown in SEQ ID NO: 9, or having an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 9, or having an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 9; The TCR α chain constant region is a murine TCR α chain constant region, preferably having an amino acid sequence as shown in SEQ ID NO: 10, or having an amino acid sequence formed by replacing, deleting or adding one or more amino acids in the amino acid sequence as shown in SEQ ID NO: 10, or having an amino acid sequence having at least 70% homology with the amino acid sequence as shown in SEQ ID NO: 10; In the nucleic acid: The nucleic acid encoding the NY-ESO-1 specific TCR β chain variable region has the nucleotide sequence shown in SEQ ID NO: 11, or has a nucleic acid encoding the NY-ESO-1 specific TCR β chain variable region after substitution, deletion or addition of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO: 11, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 11; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence; The nucleic acid encoding the TCR β chain constant region has the nucleotide sequence shown in SEQ ID NO: 12, or has a nucleic acid encoding the TCR β chain constant region in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO: 12, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 12; or is a nucleic acid that is partially complementary or completely complementary to the aforementioned sequence; The nucleic acid encoding the NY-ESO-1 specific TCR α chain variable region has the nucleotide sequence shown in SEQ ID NO: 13, or has a nucleic acid encoding the NY-ESO-1 specific TCR α chain variable region after substitution, deletion or addition of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO: 13, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 13; or is a nucleic acid partially complementary or completely complementary to the aforementioned sequence; The nucleic acid encoding the TCR α chain constant region has the nucleotide sequence shown in SEQ ID NO: 14, or has a nucleic acid encoding the TCR α chain constant region in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO: 14, or is a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 14; or is a nucleic acid that is partially complementary or completely complementary to the aforementioned sequence; The expression unit comprises, from the 5' end to the 3' end, a promoter, a kozak sequence, a nucleic acid encoding a NY-ESO-1 specific TCRβ chain variable region, a nucleic acid encoding a TCRβ chain constant region, a nucleic acid encoding a linker, a nucleic acid encoding a NY-ESO-1 specific TCRα chain variable region, and a nucleic acid encoding a TCRα chain constant region; preferably, the promoter is an EF1α promoter, an MSCV promoter, or a CMV promoter; The backbone vector of the vector is a lentiviral vector, an adenoviral vector or an adeno-associated viral vector; The host of the transformant is a T cell, a NK cell, a macrophage, a CAR-T cell or a TCR-T cell.

6. A TCR-T cell, which expresses the NY-ESO-1-targeted TCR fragment of claim 4 or 5, or has the nucleic acid or expression unit of claim 4 or 5 integrated into its genome, or is transformed or transfected with the vector of claim 4 or 5.

7. The method for constructing the TCR-T cell according to claim 6, comprising: Allowing the host to express the NY-ESO-1-targeted TCR fragment of claim 4 or 5; or integrating the nucleic acid or expression unit of claim 4 or 5 into the host genome; Or transform or transfect the host with the vector according to claim 4 or 5.

8. A TCR-T cell expressing the NY-ESO-1 targeted TCR fragment of claim 4 or 5, or having the nucleic acid or expression unit of claim 4 or 5 integrated into its genome, or being transformed or transfected with the vector of claim 4 or 5, Furthermore, it expresses the chimeric cytokine receptor fragment according to any one of claims 1 to 3, or has the nucleic acid or expression unit according to any one of claims 1 to 3 integrated into its genome, or is transformed or transfected with the vector according to any one of claims 1 to 3.

9. The method for constructing the TCR-T cell according to claim 7, comprising: Allowing a host to express the NY-ESO-1-targeted TCR fragment of claim 4 or 5, and the chimeric cytokine receptor of any one of claims 1 to 3; or the nucleic acid or expression unit according to claim 4 or 5, and the nucleic acid or expression unit according to any one of claims 1 to 3 are integrated into the host genome; Or transform or transfect a host with the vector according to claim 4 or 5, and the vector according to any one of claims 1 to 3.

10. Uses, comprising at least one of the following a) to e): a) Use of IL4 antibody and / or IL4R antibody in the preparation of a drug for improving TCR-T activity; b) Use of the biomaterial according to any one of claims 1 to 3 in improving TCR-T activity; c) Use of the biomaterial according to any one of claims 1 to 5 in the preparation of a drug for treating tumors; d) Use of the TCR-T cell according to claim 6 or claim 8 in the preparation of a drug for treating tumors; e) Use of the TCR-T cells prepared by the construction method of claim 7 or claim 9 in the preparation of drugs for treating tumors.

11. A drug comprising at least one of the following A) to E): A), TCR-T cells, IL4 antibody and / or IL4R antibody; B), at least one of the biomaterials according to any one of claims 1 to 5; C) at least one of the TCR-T cells of claim 6 or claim 8; D) TCR-T cells prepared by the preparation method of claim 7 or claim 9.

Images