Mesenchymal stem cell overexpressing MED1 and preparation method and application thereof

Abstract

The present application relates to a kind of mesenchymal stem cells of MED1 overexpression and its preparation method and application, belong to stem cell treatment technical field.The mesenchymal stem cell of MED1 overexpression of the present application includes the nucleotide sequence as shown in SEQ ID NO:2 and dCas9-target plasmid.The present application constructs MSCs of MED1 gene modification for the first time, improves its osteogenic differentiation function, to promote its clinical treatment effect in bone defect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of stem cell therapy, and particularly relates to a mesenchymal stem cell overexpressing MED1 and a preparation method and application thereof. BACKGROUND

[0002] Super enhancers (SEs) are composed of clusters of high-density traditional enhancers (TEs) that synergistically recruit high-density transcription factors (TFs) and cofactors to achieve highly efficient transcription, and are mainly characterized by larger region span and higher density of transcriptional activation-related histone modifications (such as H3K27Ac and H3K4me1) than ordinary enhancers.

[0003] Mesenchymal stem cells (MSCs) are multipotent stem cells with osteogenic, adipogenic, chondrogenic and other differentiation potentials, maintaining tissue homeostasis and regeneration, and strong immunomodulatory capacity, and are the main source of osteoblasts in vivo, playing a key role in bone repair and regeneration. Bone defects caused by severe trauma, infection, tumor surgery or femoral head necrosis are often difficult to heal naturally. MSCs transplantation to promote regeneration at the bone defect site is currently considered as a potential treatment method. There are many experimental and clinical studies that bone extracellular matrix cells promote bone regeneration. However, most of them only show limited therapeutic effect. In order to enhance the osteogenic potential of MSCs and promote clinical application, the engineering strategy based on gene modified MSCs shows good application prospect. However, the traditional use of lentivirus or adeno-associated virus for gene modification of MSCs has potential biological safety hazards, and other physical or chemical methods also have the limitation of low modification efficiency, so the application of MSCs transplantation for treating bone defects in the clinic has been hindered. At present, due to various limitations of bone transplantation surgery, therefore, for the bone defect diseases that are difficult to heal, it is urgent to develop an effective treatment method. SUMMARY

[0004] The present application aims to overcome the deficiencies of the prior art and provide a mesenchymal stem cell overexpressing MED1 capable of promoting bone repair and bone regeneration, and a preparation method and application thereof.

[0005] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0006] In a first aspect, the present application provides a mesenchymal stem cell overexpressing MED1, comprising a nucleotide sequence as shown in SEQ ID NO: 2 and a dCas9-target plasmid.

[0007] The present application finds that mediator complex subunit 1 (MED1) is a key transcriptional coactivator in the regulatory mechanism of super-enhancers (SEs), can bind to SEs, and can improve the osteogenic differentiation ability of mesenchymal stem cells (MSCs), thereby enhancing the therapeutic effect of MSCs transplantation. The present application uses improved CRISPRa / dCas9 technology, artificially mutates two domains RuvC and HNH of Cas9 to make it lose endonuclease activity, and then designs MED1-specific gRNA to specifically guide dCas9 fused with transcription factor VP64, p65 activation domain and Rta to the transcription start site (TSS) site of MED1, promotes the transcription of MED1 in MSCs through the activation of the transcription factor, and successfully constructs MSCs stably overexpressing MED1. The transplantation of MSCs overexpressing MED1 is verified to be able to treat bone defects and promote bone regeneration through in vitro and in vivo experiments.

[0008] As a preferred embodiment of the first aspect, the dCas9-target plasmid is a dSp-VP64-p65-RTA plasmid.

[0009] As a preferred embodiment of the first aspect, the mesenchymal stem cells further comprise a nucleotide sequence as shown in SEQ ID NO: 1.

[0010] As a preferred embodiment of the first aspect, the mesenchymal stem cells are selected from one or more of bone marrow, fat, umbilical cord, induced pluripotent stem cells, and embryonic stem cell-derived mesenchymal stem cells.

[0011] As a preferred embodiment of the first aspect, the mesenchymal stem cells comprise bone marrow-derived mesenchymal stem cells.

[0012] Human bone marrow-derived MSCs (BMSCs) are more effective in promoting osteogenesis, while umbilical cord-derived MSCs are more effective in promoting angiogenesis. Induced pluripotent stem cell (iPS)-derived MSCs and human embryonic stem cell-derived MSCs have similar osteogenic ability. Further studies have found that, in the comparison of in vitro and in vivo endochondral ossification potential, only BMSCs can form a three-dimensional cartilage disc in vitro, and successfully cure a large bone defect in a mouse. Therefore, BMSCs are considered to be the most osteogenic and regenerative cell type.

[0013] In a second aspect, the present application provides use of the mesenchymal stem cells of the first aspect in the preparation of a drug or preparation for treating or repairing bone defects.

[0014] As a preferred embodiment of the second aspect, a specific sgRNA is designed according to the sequence of the TSS upstream sequence of MED1, the dCas9 fused with the transcription factor VP64, the p65 activation domain and Rta is specifically guided to the TSS site of MED1 by the sgRNA, the transcription of MED1 in mesenchymal stem cells is promoted by the activation of the transcription factor, and the mesenchymal stem cells overexpressing MED1 are constructed; the nucleotide sequence of the TSS upstream sequence of MED1 is shown as SEQ ID NO: 1.

[0015] As a preferred embodiment of the second aspect, the sequence of the specific sgRNA designed according to the TSS upstream sequence of MED1 is shown as SEQ ID NO: 2.

[0016] As a preferred embodiment of the second aspect, the dCas9 fused with the transcription factor VP64, the p65 activation domain and Rta is a plasmid dSp-VP64-p65-RTA.

[0017] In a third aspect, the present application provides a method for constructing the mesenchymal stem cells of the first aspect, characterized in that it comprises the following steps:

[0018] S1, a specific sgRNA is designed according to the TSS upstream sequence of MED1 shown as SEQ ID NO: 1, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO: 2;

[0019] S2, the dCas9-target plasmid, the sgRNA and the opti-MEM medium are mixed to obtain a premix 1;

[0020] S3, the auxiliary transfection reagent is mixed with the opti-MEM medium to obtain a premix 2;

[0021] S4, after mixing the premix 1 and the premix 2, the cell culture medium is added, and after incubation at room temperature, the culture medium is added to the well plate for culturing mesenchymal stem cells, and then the puromycin is added to the culture medium to screen the viable mesenchymal stem cells, and the MSCs overexpressing MED1 are constructed.

[0022] As a preferred embodiment of the third aspect, the dCas9-target plasmid in step S2 is a dSp-VP64-p65-RTA plasmid.

[0023] In a fourth aspect, the present application provides the use of the construction method of the third aspect in the preparation of a drug or preparation for treating or repairing bone defects.

[0024] Compared with the prior art, the present application has the following beneficial effects:

[0025] The inventors discovered that mediator complex subunit 1 (MED1), as a transcriptional coactivator, plays a crucial role in the regulation of osteogenic differentiation of MSCs by SEs. Therefore, this invention, based on a super-enhancer mechanism, enhances the osteogenic function of MSCs by regulating MED1 expression, thereby more precisely and effectively improving the osteogenic function of MSCs and promoting the application of MSC transplantation in bone defect transplantation. This invention is the first to construct MED1 gene-modified MSCs to enhance their osteogenic differentiation function, thereby promoting their clinical therapeutic effect in bone defects. Attached Figure Description

[0026] Figure 1 The experimental flowchart for the construction and efficacy validation of MED1-overexpressing MSCs;

[0027] Figure 2 A schematic diagram of the Western blot results of MED1-overexpressing MSCs;

[0028] Figure 3 A schematic diagram showing the results of alizarin red staining experiments on MED1-overexpressing MSCs and ordinary MSCs;

[0029] Figure 4 A schematic diagram showing the experimental results of skull defect repair and regeneration between MED1-overexpressing MSCs and ordinary MSCs;

[0030] Figure 5 This is a schematic diagram of the plasmid dSp-VP64-p65-RTA. Detailed Implementation

[0031] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0032] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0033] Example 1: Construction of MSCs stably overexpressing the MED1 gene

[0034] according to Figure 1 The experimental procedure shown below is for constructing stably MED1-overexpressing MSCs and verifying their application effect.

[0035] 1. Design sgRNA:

[0036] The base sequence 250 bp upstream of the TSS of the MED1 gene was found through the Ensembl website (https: / / www.ensembl.org / index.html?redirect=no) (GGGATCTGGAGATTTTAATTTGCGAGCTGTTTAACTGCTAAAATAAAAAAAAAATGGCGGTTTCCGCAGGGGAGCCGAAAGCTACCGGCCGGCAGGTTTAATATCCAGCGGCGCGAGGCCTGAGACAGCTCAGATCAAAGGGAAGACTGCGCTGAAAGAAATCTCGCGAGGCCGACGCATTGACCAATATTCGCGAGATTTCGATGCCCTGTCCTCTTCCTCTCTCTGGCAGGACCACGGTTTATCTCGC, SEQ ID NO: 1), and the sgRNA was designed for the upstream of the TSS through the sgRNA design website CRISPick (https: / / portals.broadinstitute.org / ). According to the returned results, the sgRNA sequence with the highest comprehensive score and no adverse effects was selected (GCGAATATTGGTCAATGCGT, SEQ ID NO: 2) according to the target sequence score, off-target effect score and other indicators.

[0037] 2. Transfection and screening

[0038] Using the existing tool plasmid dSp-VP64-p65-RTA (addgene, #99670), the expression of the target-specific gene can be promoted through the guidance of sgRNA, and the specific operation is as follows:

[0039] 1) Premix 1: Take 5 μg of dSp-VP64-p65-RTA plasmid and 25 ng of sgRNA, linearize the dSp-VP64-p65-RTA plasmid, then connect the linearized plasmid with the sgRNA to form an sgRNA-Cas9 connection plasmid; mix the sgRNA-Cas9 connection plasmid with the opti-MEM (ThermoFisher, 31985070) medium to a total volume of 150 μl;

[0040] Premix 2: Mix the auxiliary transfection reagent Lipofectamine3000 (ThermalFish, L3000-015) with opti-MEM to 150 μl;

[0041] Transfection: Mix Premix 1 and Premix 2, incubate at room temperature for 15 minutes, then aspirate the original culture medium in the well plate, add the premix mixture to the culture medium (DMEM culture medium (Gibco, #11885084) added with 10% fetal bovine serum (Gibco, #10099141)), then add 1 x 10 5 6 MSCs / well into a six-well plate seeded 24 hours ago, and culture for 48 hours;

[0042] 2) Screening: Add puromycin (1 pg / ml) to the culture medium to screen the cells through the puromycin resistance gene carried by the plasmid, and the MSCs that can survive are the MSCs into which the plasmid is introduced and normally overexpressed;

[0043] 3) Verification: After selecting the MSCs after puromycin screening, the overexpression efficiency of MED1 is verified by Western blot (as shown in Figure 2 , and the control group is MSCs transfected with empty vector plasmid) for subsequent experiments.

[0044] Example 2 Functional verification

[0045] 1. Verify that the function of MSCs overexpressing MED1 is enhanced in vitro differentiation into osteoblasts by alizarin red staining experiment:

[0046] Common MSCs and stable overexpressing MSCs constructed in Example 1 were respectively seeded in a 24-well cell culture plate, and osteogenic induction liquid (DMEM low-sugar culture medium, 10% fetal bovine serum, 100 IU / ml penicillin, 100 IU / ml streptomycin, 0.1 uM dexamethasone, 10 mM beta glycerophosphate, 50 uM vitamin C) was used to culture cells for osteogenic differentiation induction, and the osteogenic induction liquid was replaced every 3 days. After 14 days of induction, alizarin red staining was performed, and the osteogenic differentiation function of different MSCs in vitro was observed. Alizarin red staining used 1% ARS (pH 4.2) to stain MSCs at room temperature for 15 minutes. After rinsing with PBS to remove non-specific staining, the staining images of the well plate and under the microscope after staining were collected to evaluate the difference in calcium nodule formation.

[0047] The results are shown in Figure 3 , compared with common MSCs, the osteogenic ability of MSCs overexpressing MED1 constructed in Example 1 was significantly enhanced in vitro.

[0048] 2. Verify that MED1 overexpressing MSCs transplantation promotes the repair and regeneration of skull defects by skull defect model:

[0049] Take 8-week-old mice, cut the skin after anesthesia, separate the subcutaneous tissue, and expose the skull. Use a 2.5 mm sterilized drill to make a skull defect to construct a bone defect model. Take 2 x 10 5Bone marrow mesenchymal stem cells (MSCs overexpressing MED1, common MSCs) were resuspended with 1% sodium alginate saline solution and transplanted into the skull defect, and the wound was sutured. Three weeks after the operation, the mice were sacrificed, and micro-CT was used for imaging observation.

[0050] As shown in the results Figure 4 The skull defect mouse model after transplantation of MSCs overexpressing MED1 showed stronger skull defect repair.

[0051] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not a limitation on the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.

Claims

1. The use of mesenchymal stem cells overexpressing MED1 in the preparation of a medicament for treating or repairing bone defects, characterized in that, The mesenchymal stem cells are bone marrow-derived mesenchymal stem cells. The preparation method of the mesenchymal stem cells comprises the following steps: S1, a specific sgRNA is designed according to the sequence upstream of the TSS of the MED1 gene, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO: 2; S2, a dCas9-target plasmid, sgRNA and opti-MEM medium are mixed to obtain a premix 1; S3, an auxiliary transfection reagent is mixed with the opti-MEM medium to obtain a premix 2; S4, after mixing the premix 1 and the premix 2, the mixture is added into a cell culture medium, and after incubation at room temperature, the culture medium is added into a well plate for culturing mesenchymal stem cells, and then puromycin is added into the culture medium to screen the viable mesenchymal stem cells, so that the mesenchymal stem cells overexpressing MED1 are obtained; The nucleotide sequence of the sequence upstream of the TSS of the MED1 gene is shown as SEQ ID NO: 1; The dCas9-target plasmid is dSp-VP64-p65-RTA, and the dCas9-target plasmid is fused with a transcription factor VP64, a p65 activation domain and Rta; The dCas9 fused with the transcription factor VP64, the p65 activation domain and Rta is specifically guided to the TSS site of MED1 through the sgRNA, the transcription factor is activated to promote the transcription of MED1 in the mesenchymal stem cells, and the mesenchymal stem cells overexpressing MED1 are constructed.

2. Use according to claim 1, wherein The auxiliary transfection reagent in the step S2 is Lipofectamine3000; the incubation time at room temperature in the step S4 is 15 minutes; and the culture time of the culture medium in the well plate for culturing mesenchymal stem cells in the step S4 is 48 h, and then puromycin is added into the culture medium for screening.

Images