Proline hydroxylase mutant as well as application and method thereof in hydroxyproline production

Abstract

The invention belongs to the field of gene engineering and enzyme engineering, and particularly relates to a proline hydroxylase mutant and application and a method thereof in hydroxyproline production. The invention provides mutations of sites such as p4hG141A, p4hS85A, p4hV126A, p4hH125A, p4hS205A, p4hD122A, p4hS211A and the like, the expression of the mutant enzymes can obviously increase the yield of hydroxyproline and reduce the proportion of proline, then the sites are respectively subjected to saturated mutation, and dominant mutations are combined to obtain strains with better performance, such as p4hS85Q-V126A, p4hS85A-V126T, p4hG141A-H125S and p4hG141A-H125T. Compared with a traditional chemical method, the technology is low in production cost, green and environmentally friendly, and large-scale continuous production can be carried out.

Description

Technical Field

[0001] The invention belongs to the field of gene engineering and enzyme engineering, and specifically relates to a proline hydroxylase mutant and an application and method thereof in the production of hydroxyproline. Background Art

[0002] Hydroxyproline (HYP) is a subdivided product of amino acids. It is a non-essential amino acid and one of the main components of collagen tissue. It is also a unique amino acid in collagen, accounting for about 13% of the total amount of collagen amino acids. Hydroxyproline has a wide range of uses and has broad application prospects in food, cosmetics, dietary supplements, medicine and other fields. In the food field, hydroxyproline can be used as a food additive for cakes, bread, juices, sauces, ice cream and other products, which can improve the taste of food and increase the utilization rate of raw materials; in the pharmaceutical field, hydroxyproline can treat arthritis and synthesize collagen required by the human body. The preparation methods of hydroxyproline include microbial fermentation, protein hydrolysis extraction, and chemical synthesis. Due to the high production cost and complex operation of the chemical synthesis method, it has not yet achieved large-scale production. Therefore, the protein hydrolysis extraction method is the mainstream preparation method of hydroxyproline. However, the high production cost of this preparation method limits its large-scale application, so it is urgent to develop a lower-cost production method.

[0003] Microbial fermentation mainly utilizes the biosynthetic pathway of microbial strains to produce hydroxyproline. Its advantages are that it uses sugar as raw material, which is in line with eating habits, has low production costs and high benefits. In particular, the current adoption of genetic engineering breeding technology and high-yield optimization control technology has greatly reduced the production cost of the fermentation method. The technology of transforming strains using metabolic engineering and genetic engineering methods to produce products that are beneficial to humans is becoming more and more mature, and its advantages are more obvious. However, due to the low enzymatic activity of proline hydroxylase P4H, a certain proportion of proline is mixed in the fermentation end product hydroxyproline, making it impossible to continue to increase the yield of hydroxyproline, and also increasing the difficulty of the downstream purification process, making it difficult to obtain high-purity hydroxyproline. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a proline hydroxylase mutant, which can increase the hydroxyproline production and reduce the proline content. The present invention reports for the first time that the p4h point mutation can increase the HYP production.

[0005] On the one hand, the present invention provides a proline hydroxylase mutant, which is mutated based on the sequence SEQ ID NO.1; the mutation site is selected from one or more of S85, D122, H125, V126, G141, S211, or S205.

[0006] SEQ ID NO.1:

[0007] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGTCCGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGCATGTGGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGGTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA。

[0008] More specifically, the amino acid sequence corresponding to SEQ ID NO.1 is SEQ ID NO.6.

[0009] SEQ ID NO.6:

[0010] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEAT HLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*.

[0011] Specifically, the mutation site includes a half-saturation mutation and / or a saturation mutation.

[0012] Preferably, the mutation site may be a saturation mutation.

[0013] Specifically, the mutation site can be selected from one or more of S85G, S85N, S85R, S85E, S85Q, S85D, S85A, D122A, H125A, H125S, H125T, V126A, V126N, V126T, G141A, G141T, G141R, G141Q, G141S, S205A and S211A.

[0014] Preferably, the mutation site can be selected from S85Q, S85A, V126A, V126T, H125S, H125T, G141A, S85Q-V126A (a combination of S85Q and V126A), S85A-V126T, G141A-H125S or G141A-H125T.

[0015] In yet another aspect, the present invention provides a nucleic acid molecule encoding the aforementioned proline hydroxylase mutant.

[0016] In yet another aspect, the present invention provides a recombinant plasmid comprising the aforementioned nucleic acid molecule.

[0017] In yet another aspect, the present invention provides a host cell comprising the aforementioned nucleic acid molecule or recombinant plasmid.

[0018] Specifically, the host cell can be a eukaryotic cell or a prokaryotic cell.

[0019] More specifically, the host cell may be a prokaryotic cell.

[0020] Preferably, the prokaryotic cells include, but are not limited to, Escherichia coli, Pseudomonas, Bacillus, Streptococcus or Actinomycetes.

[0021] Further preferably, the prokaryotic cell may be Escherichia coli.

[0022] In another aspect, the present invention provides a method for increasing the yield and / or purity of hydroxyproline, which is obtained by fermenting the aforementioned host cell.

[0023] In another aspect, the present invention provides use of the aforementioned proline hydroxylase mutant or nucleic acid molecule or host cell in the preparation of hydroxyproline.

[0024] In another aspect, the present invention provides use of the aforementioned proline hydroxylase mutant or nucleic acid molecule or host cell in the preparation of cosmetics or medicines.

[0025] The technical effects achieved by the present invention are:

[0026] The present invention proposes for the first time that mutation of the p4h site can significantly increase the content and proportion of hydroxyproline (HYP), and the mutation sites include but are not limited to: G141, S205, S211, H125, D122, S85 or V126. The above sites can be semi-saturated mutations or saturated mutations, and the above sites can also be mutated in pairs, which can increase the yield and purity of HYP. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a comparison chart of HPLC peaks.

[0028] Figure 2 This is the result of P4H alanine scanning.

[0029] Figure 3 The content of hydroxyproline and proline and the proportion of hydroxyproline in the S85 saturation mutation.

[0030] Figure 4 The content of hydroxyproline and proline and the proportion of hydroxyproline in the V126 saturation mutation.

[0031] Figure 5 is the content of hydroxyproline and proline and the proportion of hydroxyproline in the G141 saturation mutation.

[0032] Figure 6 is the content of hydroxyproline and proline and the proportion of hydroxyproline in the H125 saturation mutation.

[0033] Figure 7 The contents of hydroxyproline and proline and the proportion of hydroxyproline in the combined mutation of H125 and G141. DETAILED DESCRIPTION

[0034] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0035] Basic experiment 1: Method for producing hydroxyproline by genetically engineered strains (shake flask fermentation)

[0036] (1) Experimental reagents

[0037] (a) LB medium: Each liter of the medium contains 5 g of yeast powder, 10 g of sodium chloride, 10 g of peptone, and deionized water to make up to 1 L (author: J. Shambrook, translated by Huang Peitang, Molecular Cloning Guide 2002, 1595).

[0038] The above solution is sterilized by high pressure steam at a sterilization temperature of 121° C. for 20-30 min.

[0039] (b) Fermentation medium (per liter): 30 g glucose, 200 mL 5N-5 times salt solution, 1 mL TM3 solution, 10 mg ferric citrate, 246 mg magnesium sulfate heptahydrate, 111 mg calcium chloride, 1 μg thiamine, dilute to 1 L with sterile deionized water.

[0040] The 5N-5 times salt solution is 75.6g of disodium hydrogen phosphate dodecahydrate, 15g of potassium dihydrogen phosphate per liter, 2.5g of sodium chloride, and 25g of ammonium chloride, which are diluted to 1L with ionized water; the TM3 solution is 2.0g of zinc chloride tetrahydrate, 2.0g of calcium chloride hexahydrate, 2.0g of sodium molybdate dihydrate, 1.9g of copper sulfate pentahydrate, 0.5g of boric acid, and 100mL of hydrochloric acid, which are diluted to 1L with deionized water.

[0041] The above solution is sterilized by high pressure steam at a temperature of 121° C. for 20-30 min. At the same time, empty shake bottles are prepared, and 0.6 g of calcium carbonate is weighed into each bottle to make the final concentration of calcium carbonate 30 g / L.

[0042] (2) Experimental equipment: constant temperature shaking incubator.

[0043] (3) Experimental methods:

[0044] (a) Inoculate the recombinant strain into 3 mL of LB medium containing antibiotics, and culture it in a 37°C shaker at 250 rpm; (b) Take 200 μL of the seeds after 16 hours of culture and transfer them to 2 mL of LB liquid medium containing antibiotics, and culture them in a 37°C shaker at 250 rpm for 4 hours; (c) Transfer all 2 mL of secondary seeds into a shake flask containing 18 mL of fermentation medium, and culture it in a 37°C shaker at 250 rpm for 4 hours; (d) Add IPTG to a final concentration of 1 mM, adjust the shaker temperature to 37°C, and continue to culture for about 20 hours. Take 0.1 mL of fermentation broth and 0.9 mL of water, mix and centrifuge (12000 rpm, 1 min), and take 100 uL of the supernatant for derivatization treatment and sample preparation.

[0045] Derivatization method: Take 100ul of the supernatant, add 100uL of 0.5M boric acid solution (pH7.7), mix well, incubate in a 30°C water bath for 3min, add 200uL of Fmoc-Cl solution, mix well, incubate in a 30°C water bath for 5min, add 800uL of ADAM solution, mix well for 2min, filter the organic phase and detect by HPLC.

[0046] Basic Experiment 2: Determination of Hydroxyproline in Fermentation Broth by HPLC

[0047] Accurately pipette the derivatized supernatant through a 0.22μm organic filter membrane and perform HPLC detection. The HPLC parameters are as follows: Agilent SB-C18 4.6*150mm, mobile phase A: 0.1% formic acid water, C: acetonitrile, initial ratio A: C = 55:45; elution gradient program is shown in Table 1, column flow rate is 1.35mL / min, column temperature is 30℃; wavelength is 264nm, injection volume is 5uL; detection time is 13.5min. Hydroxyproline elution time: 2.6min Proline elution time: 5.9min, HPLC spectrum is as follows Figure 1 shown.

[0048] Table 1 Gradient elution program

[0049] Time (min) Phase A (% v / v) Phase C (% v / v) 0.01 55 45 7.00 47 53 7.50 25 75 8.00 0 100 10.00 0 100 10.50 55 45 13.5 55 45

[0050] Example 1p4h Alanine Scanning and Fermentation Verification

[0051] Our laboratory used Escherichia coli W3110 (ATCC27325) (genotype: F-mcrAmcrB IN(rrnD-rrnE)1lambda-) as the starting strain, knocked out the hydroxyproline degradation and uptake genes, integrated the hydroxyproline synthesis operon that relieved feedback inhibition, improved its feedback inhibition and weakened regulation, and obtained the genetically engineered strain SHX107, which was named Escherichia coli.

[0052] Our laboratory conducted alanine scanning on seven positions (G141, S205, S211, H125, D122, S85 and V126) by docking and analyzing the protein three-dimensional structure of p4h, and constructed the corresponding mutant plasmids pHJ01-pHJ07. The expression plasmids with correct sequencing were transformed into the host SHX107, and the production of hydroxyproline in the recombinant strain was verified according to the shake flask fermentation method in basic experiment 1. The results are shown in Table 2. Figure 2 As shown in the figure, the alanine scanning mutant plasmids can increase the hydroxyproline production to varying degrees, among which G141A, V126A, H125A, and S85A can significantly increase the purity of hydroxyproline from 68% to more than 78%. G141A The gene sequence is SEQ ID NO.2, and the amino acid sequence is SEQ ID NO.7.

[0053] SEQ ID NO.2:

[0054] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGTCCGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGCATGTGGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGCTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA;

[0055] SEQ ID NO.7:

[0056] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEAT HLNAPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*.

[0057] pHJ01 (pEZ07-p4h G141A ) was used as an example. pHX217 (pEZ07-p4h) was used as a template. The primers in Table 3 were used to perform expansion PCR on pHJ01-F / pHJ01-R. 2 μL of the amplified product was digested at 37°C for 1 hour with 1 μL of sterile water + 1 μL of DpnI + 1 μL of 10xFDBuffer. The product was then transferred to ice for 5 minutes and then transferred to TG1 competent cells. The cells were mixed and placed for 5 minutes. The cells were heat-shocked at 42°C for 2 minutes. After an ice bath for 2 minutes, 800 μL of recovery medium LB was added. The cells were recovered and cultured at 37°C for 1 hour and then centrifuged and coated on LB plates containing 100 mg / L spectinomycin. The clones were picked and cultured overnight the next day. The plasmids were extracted and digested correctly and sent to Jinweizhi for sequencing.

[0058] Table 2 Alanine scanning results

[0059]

[0060] Note: In the table, hydroxyproline proportion = hydroxyproline production / (hydroxyproline production + proline production)*100;

[0061] Increase percentage = (hydroxyproline production of mutant plasmid - hydroxyproline production of wild-type plasmid) / hydroxyproline production of wild-type plasmid * 100.

[0062] Table 3 Primers for construction of pHJ01-pHJ07 plasmids

[0063]

[0064]

[0065] Example 2 Construction and fermentation verification of p4h saturation mutation plasmid

[0066] S85, H125, V126, and G141 with higher mutation yields in Example 1 were subjected to saturation mutation at the same time. According to the method in Example 1, a saturated library plasmid was constructed, and an LB plate containing 100 mg / L spectinomycin was coated. The next day, 5 clones were picked from each plate and sent to Jinweizhi for sequencing verification. The mutation probability of the library reached more than 80% before it could be transferred to the host SHX107 for screening. Specifically, according to the shake flask fermentation method in Basic Experiment 1, 60 clones were randomly picked for initial screening of the library and rescreening of dominant clones.

[0067] The results are as follows Figure 3-Figure 6 The data are summarized in Table 4, where most mutations can increase both the yield and purity of hydroxyproline. V126T 、p4h S85G 、p4h H125S The gene sequences are SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, and the amino acid sequences are SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10.

[0068] Table 4 Saturation library screening results

[0069]

[0070]

[0071] SEQ ID NO.3:

[0072] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGTCCGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGCATACTGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGGTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA;

[0073] SEQ ID NO.4:

[0074] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGGGGGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGCATGTGGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGGTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA;

[0075] SEQ ID NO.5:

[0076] ATGCTGACTCCAACCGAACTGAAACAATATCGTGAAGCTGGCTATCTGCTGATTGAGGATGGTCTGGGCCCTCGCGAAGTGGACTGCCTGCGCCGTGCAGCGGCGGCTCTGTACGCTCAGGATAGCCCTGACCGTACCCTGGAAAAGGACGGTCGTACCGTTCGTGCTGTCCACGGTTGCCACCGCCGCGACCCGGTTTGCCGTGATCTGGTTCGTCACCCTCGTCTGCTGGGTCCAGCTATGCAAATCCTGTCCGGCGACGTTTACGTGCACCAGTTCAAGATCAACGCGAAGGCTCCTATGACCGGTGATGTCTGGCCTTGGCACCAGGATTACATCTTTTGGGCACGCGAAGATGGCATGGACCGCCCGAGTGTGGTTAACGTGGCTGTTCTGCTGGATGAGGCAACTCACCTGAACGGTCCTCTGCTGTTCGTTCCAGGCACCCACGAACTGGGCCTGATTGACGTTGAGCGCCGTGCTCCAGCCGGTGACGGCGATGCACAGTGGCTGCCACAGCTGAGCGCAGACCTGGACTACGCTATCGATGCCGACCTGCTGGCTCGCCTGACCGCAGGCCGCGGTATTGAAAGCGCAACTGGCCCAGCCGGCTCTATCCTGCTGTTTGACTCCCGCATCGTGCACGGTTCCGGCACTAACATGAGCCCGCATCCGCGCGGTGTGGTTCTGGTCACCTACAACCGCACTGACAATGCGCTGCCAGCACAGGCTGCGCCTCGTCCTGAGTTCCTGGCGGCTCGCGACGCAACCCCACTGGTGCCGCTGCCAGCAGGCTTCGCACTGGCTCAACCGGTGTAA;

[0077] SEQ ID NO.8:

[0078] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHTVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*;

[0079] SEQ ID NO.9:

[0080] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILGGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*;

[0081] SEQ ID NO.10:

[0082] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPSVVNVAVLLDEATHLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV*。

[0083] Construction of the p4h combination mutant plasmid in Example 3 and related fermentation

[0084] The dominant mutations in Example 2 were combined in pairs, specifically, according to the method in Example 1, the combined mutant plasmids were constructed and transformed into host SHX107 for screening. Shake flask fermentation was carried out according to the method in Basic Experiment 1.

[0085] Take the combination of H125 and G141 as an example, the result is as follows Figure 7 As shown, compared with the wild-type p4h, the hydroxyproline production in the combinatorial mutant library was improved to varying degrees, with the highest combination G141A-H125S increasing by 58.8% and the highest proportion increasing to 90%, greatly improving the purity of hydroxyproline.

[0086] Comparative Example

[0087] Comparative Examples 1-6 were prepared with reference to Example 1. The difference between the comparative examples and the example is that the mutation sites of the constructed plasmids are different. The mutation sites and plasmid construction primers are shown in Table 5. The others are the same as Example 1. The results are shown in Table 6.

[0088] Table 5 Comparative Example Plasmid Construction Primers

[0089]

[0090]

[0091] Table 6

[0092]

[0093] The results showed that mutations at the key sites of p4h significantly changed the activity of the enzyme, and superposition of preferred dominant mutations could significantly increase the yield of hydroxyproline and improve the purity of hydroxyproline.

Claims

1. A proline hydroxylase mutant, characterized in that The proline hydroxylase mutant is mutated based on the sequence SEQ ID NO.1; the mutation site is selected from one or more of G141, S205, S211, H125, D122, S85 or V126.

2. The proline hydroxylase mutant according to claim 1, characterized in that The mutation sites include half-saturation mutations and / or saturation mutations.

3. The proline hydroxylase mutant according to claim 1 or 2, characterized in that The mutation sites are selected from one or more of S85A, S85G, S85N, S85R, S85E, S85Q, S85D, D122A, H125A, H125S, H125T, V126A, V126N, V126T, G141A, G141T, G141R, G141Q, G141S, S205A and S211A.

4. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the proline hydroxylase mutant according to any one of claims 1-3.

5. A recombinant plasmid, characterized in that: Comprising the nucleic acid molecule of claim 4.

6. A host cell comprising the nucleic acid molecule of claim 4 or the recombinant plasmid of claim 5.

7. The host cell according to claim 6, characterized in that The host cell is a eukaryotic cell or a prokaryotic cell.

8. A method for increasing the yield and / or purity of hydroxyproline, characterized in that: Obtained by fermentation with the host cell according to claim 6 or 7.

9. Use of the proline hydroxylase mutant according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, or the host cell according to any one of claims 6 to 7 in the preparation of hydroxyproline.

10. Use of the proline hydroxylase mutant according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, or the host cell according to any one of claims 6 to 7 in the preparation of cosmetics or medicines.

Images