SNP (Single Nucleotide Polymorphism) marker for mytilus coruscus byssus adhesion protein gene Mfp5 coding region and application of SNP marker

Abstract

The invention relates to a mytilus coruscus byssus adhesion protein gene Mfp5 coding region SNP marker and application thereof, the mytilus coruscus byssus adhesion protein gene Mfp5 coding region SNP marker comprises a gene sequence numbered as an McMfp5 coding region, the nucleotide sequence of the gene sequence is shown as SEQ ID No.1, an SNP marker primer pair is designed based on the sequence, three SNP markers numbered as McMfp51, McMfp52 and McMfp53 are obtained through sequencing, and the primer sequences of the three SNP markers are shown as SEQ ID No.2 and SEQ ID No.3 in sequence. The primer designed aiming at the gene sequence of the McMfp5 coding region is used for SNP (Single Nucleotide Polymorphism) marker typing, is high in specificity, stable in amplification and high in polymorphism, can be used for genetic diversity analysis, germplasm identification and marker-assisted selection breeding of mytilus coruscus populations, and provides a powerful tool for genetic breeding of mytilus coruscus.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a SNP marker in a coding region of a thick-shelled mussel byssus adhesion protein gene and an application thereof. Background Art

[0002] Mussels are an important species in the shellfish aquaculture industry. At present, there are no new mussel varieties with excellent performance. The lack of "species" restricts the development of its industry. Thick-shelled mussels (Mytilus coruscus) are one of the important aquaculture mussel varieties. Farmers tend to pursue quantity rather than quality. Extreme temperatures will reduce the adhesion of byssus, resulting in frequent seed shedding in summer. Therefore, improving the adhesion performance of thick-shelled mussel byssus is an important way to increase production. Thick-shelled mussels secrete byssus proteins through the foot glands, which form byssus after seawater solidification and adhere to the surface of the substrate. At present, many proteins have been identified in mussel byssus and glands. Among them, Mfp5 is an adhesion protein present at the interface between the byssus disc and the attachment substrate, which has an important adhesion function. SNP markers follow Mendel's codominant inheritance law, can identify pure and heterozygous, provide complete genetic information, and are not affected by factors such as season, developmental stage and environment. They have the advantages of large quantity, high polymorphism, simple technology, rapidity and easy automation. They are powerful tools for genetic structure analysis, germplasm resource identification, genetic diversity analysis and marker-assisted selection breeding. Based on the important role of the byssus adhesion protein gene in the byssus attachment of thick-shelled mussels, identifying the SNP sites in the gene and screening molecular markers that can be used to screen the byssus attachment strength can provide an important tool for breeding new thick-shelled mussel varieties with stronger byssus adhesion. Summary of the invention

[0003] The invention provides a SNP marker for the coding region of the byssus adhesion protein gene Mfp5 of thick-shelled mussel and an application thereof. The marker has stable amplification and good polymorphism, and can be applied to genetic diversity analysis of thick-shelled mussel populations, identification of germplasm resources and marker-assisted selection breeding.

[0004] The invention provides a thick-shelled mussel byssus adhesion protein Mfp5 coding region, comprising a gene sequence numbered as the McMfp5 coding region, and the nucleotide sequence of the gene sequence is shown as SEQ ID No.1.

[0005] Mussel Foot Protein (Mfp) is a general term for the family of adhesion proteins secreted by mussel byssus. Different members are distinguished by numbers (such as Mfp1, Mfp3, Mfp5, etc.) according to differences in protein structure and function. The English name of the byssus adhesion protein Mfp5 is usually Mussel Foot Protein 5 (abbreviated as Mfp5 or Mfp-5). Mfp5 is one of the key proteins, which is mainly involved in the interfacial adhesion of mussel byssus to the substrate material. Its characteristics include repeating sequences rich in DOPA and lysine.

[0006] Thick-shelled mussel (Mytilus coruscus) is abbreviated as Mc, and thick-shelled mussel byssus adhesion protein Mfp5 is abbreviated as McMfp5.

[0007] The invention provides a SNP marker primer pair for detecting the diversity of thick-shelled mussel population, which is designed based on the gene sequence of the McMfp5 coding region.

[0008] Preferably, the sequences of the primer pairs designed for the gene sequence numbered as the McMfp5 coding region are shown as SEQ ID No. 2 and SEQ ID No. 3 respectively.

[0009] Preferably, the primer pair is used for direct PCR sequencing to obtain three SNP markers, namely McMfp5_1, McMfp5_2 and McMfp5_3.

[0010] The present invention also provides the use of the thick-shelled mussel byssus adhesion protein Mfp5 coding region or the SNP marker primer pair in thick-shelled mussel population genetic analysis and / or marker-assisted selection.

[0011] The present invention also provides a method for detecting SNP polymorphism of thick-shelled mussel, comprising the following steps: using the genomic DNA of the thick-shelled mussel as a template, using primer pairs designed for the gene sequence of the thick-shelled mussel byssus adhesion protein Mfp5 coding region or the SNP marker primer pair to establish a PCR amplification system, performing PCR amplification, performing genotyping on the amplification product, and performing population genetic analysis and / or germplasm resource identification according to the typing results.

[0012] Preferably, the template comprises genomic DNA of gill filament tissue of thick-shelled mussel.

[0013] Preferably, the PCR amplification system, in 25 μL, includes: 1-2 μL template, 0.5 μL upstream primer, 0.5 μL downstream primer, 0.5 μL dNTP, 2.5 μL 10×PCR Buffer, 0.2 μL Taq Plus DNA polymerase and the remainder sterile deionized water.

[0014] Preferably, the PCR amplification procedure includes: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 40 s, 35 cycles; and extension at 72°C for another 10 min.

[0015] Beneficial effects: The present invention clones the coding region of the thick-shelled mussel byssus adhesion protein Mfp5, which is numbered as the gene sequence of the McMfp5 coding region, and the nucleotide sequence of the gene sequence is shown in SEQ ID No. 1. The present invention designs a SNP marker primer pair for the gene sequence of the McMfp5 coding region, and the SNP marker primer pair has strong specificity, stable amplification and high polymorphism, and can be used for the genetic diversity analysis of thick-shelled mussel populations and marker-assisted selection breeding, providing a powerful tool for the genetic breeding of thick-shelled mussels. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The sequencing peak diagram of the McMfp5_1 locus genotype of the thick-shelled mussel sample; (a) is the AA genotype and (b) is the AG genotype.

[0017] Figure 2 The sequencing peak diagram of the McMfp5_2 locus genotype of the thick-shelled mussel sample; (a) is the TT genotype, (b) is the TC genotype, and (c) is the CC genotype.

[0018] Figure 3 The sequencing peak diagram of the McMfp5_3 locus genotype of the thick-shelled mussel sample; (a) is the AA genotype, (b) is the AG genotype, and (c) is the GG genotype. DETAILED DESCRIPTION

[0019] The present invention provides a thick-shelled mussel byssus adhesion protein Mfp5 coding region, including a gene sequence numbered as McMfp5 coding region, wherein the nucleotide sequence of the McMfp5 coding region gene sequence is preferably as shown in SEQ ID No. 1: ATGAAGCTTAGTTGTGTAGTCTTGGTGCTCGTTCTTGTAACTTTAGCAGCTTGTATCGATGTAGGCTCAGGATATGATGATTACAGTGACGGCTATTACCCAGGCAGTGCGTACAATTATCCATCTGGAAGTCATTGGCACGGT CATGGATATAAGGGAAAGTATTACGGAAAAGGAAAGAAATACTATTACAAATTTAAGCGCACTGGAAAATACAAATATCTTAAGAAAGCTAGAAATACCACAGAAAAGGTTACAAGAAACATTATGGAGGCAGTAGCAGTTAG; The invention provides a SNP marker primer pair for detecting the diversity of thick-shelled mussel population and marker-assisted selection breeding, which is designed based on the gene sequence of the McMfp5 coding region.

[0020] The present invention designs a SNP marker primer pair based on the gene sequence of the McMfp5 coding region, and the criteria for selecting the primers include: (1) the primer length is 15-30 bp; (2) the GC content is 40%-70%; (3) the annealing temperature is 50-65°C; and (4) the sequence identity between the target fragment and SEQ ID No.1 is ≥95%.

[0021] In the embodiment of the present invention, the sequences of the primer pairs designed for the gene sequence numbered as the McMfp5 coding region are shown in SEQ ID No. 2 and SEQ ID No. 3 respectively.

[0022] The present invention also provides the use of the SNP marker primer pair in population genetic analysis and / or marker-assisted selection breeding of thick-shelled mussels.

[0023] The SNP marker primer sequence information of the present invention is shown in Table 1 below: Table 1

[0024] The SNP markers described in the present invention are stably amplified and have good polymorphism. The present invention uses the three SNP markers identified by the primer pairs shown in Table 1 to amplify the coding sequence of the McMfp5 coding region in individuals with different byssus phenotypes in three thick-shelled mussel populations at different latitudes (Zhoushan, Zhejiang, Taizhou, Zhejiang, and Fuding, Fujian), and perform SNP marker typing by direct sequencing. After amplifying the McMfp5 sequence in the three populations, the genotype of each SNP site of each individual was obtained, and genetic diversity analysis showed that the average observed heterozygosity (0.54 in the Zhoushan population and 0.53 in the Fuding population) was 0. Ho) is higher than the Taizhou population by 0.29. The observed heterozygosity of the three populations is greater than the expected heterozygosity ( H e), indicating that the three populations have different genetic diversity. The average polymorphic information content (PIC) of the three populations was in the range of 0.25-0.5, showing moderate polymorphism, indicating that the three markers can be used for genetic diversity analysis. The chi-square test was used to analyze the byssal adhesion phenotype values ​​(number of byssal secretion, byssal diameter, breaking force and adhesion strength) of the three thick-shelled mussel populations and the genotype frequencies of the three SNP markers McMfp5_1, McMfp5_2 and McMfp5_3 in the three populations. The results showed that McMfp5_2 and McMfp5_3 significantly affected the number of byssal secretion and byssal adhesion, while McMfp5_1 significantly affected the byssal breaking force. The haplotypes of McMfp5 all significantly affected the diameter of the byssus, the breaking force of the byssus and the adhesion of the byssus. The genotype and haplotype frequencies of the McMfp5 locus were significantly different among different populations, indicating that the three SNPs provided important candidate markers for the selective breeding of the byssus adhesion strength of thick-shelled mussels. It can be seen that the three SNP markers of the present invention showed significant genetic analysis and marker-assisted selection value, providing a powerful tool for genetic diversity, population structure analysis and marker-assisted selection breeding of thick-shelled mussels.

[0025] The present invention also provides a method for detecting the diversity of thick-shelled mussel populations, comprising the following steps: using the genomic DNA of the thick-shelled mussel as a template, establishing a PCR amplification system using primer pairs designed for the above gene sequences or the above SNP marker primer pairs, performing PCR amplification, performing genotyping on the amplified products by sequencing, and performing genetic analysis based on the typing results.

[0026] The template of the present invention preferably includes genomic DNA from gill filament tissue of thick-shelled mussel. There is no special limitation on the method for extracting the genomic DNA, and the genomic DNA can be extracted using conventional methods in the art.

[0027] The PCR amplification system of the present invention preferably includes 25 μL of the following: 1-2 μL of template, 0.5 μL of upstream primer (10 mM), 0.5 μL of downstream primer (10 mM), 0.5 μL of dNTP (10 mM), 2.5 μL of 10×PCR Buffer (containing Mg 2 +), 0.2 μL Taq Plus DNA polymerase (5U / μL) and the rest sterile deionized water. In the present invention, when preparing the PCR amplification system, preferably one reaction system is prepared for each pair of primers, and then PCR amplification is performed. The PCR amplification procedure preferably includes: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 40 s, 35 cycles; and extension at 72°C for 10 min.

[0028] In the present invention, after the PCR amplification is completed, the amplified product is detected by a sequencer to obtain the genotype information of each SNP site; the SNP raw data file is analyzed using BioEdit software, and the observed heterozygosity ( H o), expected heterozygosity ( H e) and polymorphism information content (PIC).

[0029] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention. Example

[0030] 1. Extraction of genomic DNA from thick-shelled mussel The genomic DNA of 150 thick-shelled mussels used in the experiment was extracted according to the Tiangen Marine Animal Tissue Genome Extraction Kit (TIANGEN, Tiangen Biochemical Technology Co., Ltd.). The quality of the extracted genomic DNA was tested with 2% agarose gel. After the concentration was determined, the DNA was diluted to 50 ng / μL and stored at -20℃ for later use.

[0031] 2. Primer design Primer3 (v. 0.4.0) software was used for primer screening and design. The primers designed in Table 1 can stably amplify the sequence of McMfp5, and three SNP sites (McMfp5_1, McMfp5_2, and McMfp5_3) can be obtained through multiple sequence alignment.

[0032] 3. SNP marker amplification detection and data analysis The SNP marker primer (McMfp5) was used to amplify the genomic DNA of thick-shelled mussel. The PCR amplification system was 25 μL, including 1 μL template DNA, 0.5 μL forward primer, 0.5 μL reverse primer, 0.5 μL dNTP (10 mM), 2.5 μL 10× PCR Buffer (containing Mg 2+), 0.2 μL Taq Plus DNA polymerase (5 U / μL), 19.8 μL sterile deionized water; PCR amplification program included: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for another 10 min. After PCR amplification, the amplified products were sequenced to obtain the genotype information of each SNP site of 150 thick-shelled mussels in three populations.

[0033] BioEdit software was used to analyze the SNP raw data files. H o), expected heterozygosity ( H e) and polymorphism information content (PIC) were calculated using Cervus (version: v3.0.7) (Table 2).

[0034] Table 2 Genetic diversity parameters of SNP loci in thick-shelled mussel population

[0035] (N: number of samples, Ho: observed heterozygosity, He: expected heterozygosity, PIC: polymorphic information content) Based on Example 1, it can be seen that the above three SNP loci analyze the genetic diversity of the three populations, and the average observed heterozygosity of the Zhoushan population ( H o) was 0.54, and the average expected observed heterozygosity ( H e) was 0.41, and the average polymorphic information content (PIC) was 0.25; the average observed heterozygosity of the Taizhou population ( H o) was 0.29, and the average expected observed heterozygosity ( H e) was 0.30, and the average polymorphic information content (PIC) was 0.32; the average observed heterozygosity of the Fuding population ( H o) was 0.53, and the average expected observed heterozygosity ( H e) was 0.38, and the average polymorphism information content (PIC) was 0.31. H o) and expected heterozygosity ( He) is an important indicator for determining the level of genetic diversity of a population. Analysis of three thick-shelled mussel populations showed that the genetic diversity of the Zhoushan population and the Fuding population was higher than that of the Taizhou population. In addition, the haplotypes of McMfp5 significantly affected the diameter, breaking force and adhesion of the byssus thread, and the genotype and haplotype frequencies of the McMfp5 locus were significantly different among different populations (Table 3), indicating that the three SNP loci provide important candidate markers for the selective breeding of the adhesion strength of the byssus thread of thick-shelled mussels. It can be seen that the three SNP markers of the present invention show significant genetic diversity analysis and marker-assisted selection value, providing a powerful tool for genetic analysis and marker-assisted selection breeding of thick-shelled mussels.

[0036] Table 3 Chi-square test between Mfp-5 genotype and haplotype frequencies and phenotypes and regions

[0037] The above embodiments provide a detailed description of the present invention, but are only a part of the embodiments of the present invention, rather than all of the embodiments. Those skilled in the art can also obtain other embodiments based on the embodiments without creative work, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The coding region of the thick-shelled mussel byssus adhesion protein Mfp5, characterized in that: It includes a gene sequence numbered as McMfp5 coding region, and the nucleotide sequence of the gene sequence is shown as SEQ ID No.

1.

2. A SNP marker primer pair for detecting population diversity of thick-shelled mussels and marker-assisted selection breeding, characterized in that: The gene sequence of the McMfp5 coding region according to claim 1 is designed.

3. The SNP marker primer pair according to claim 2, characterized in that: The sequences of the primer pairs designed for the gene sequence of the McMfp5 coding region are shown in SEQ ID No. 2 and SEQ ID No. 3 respectively.

4. The labeled primer pair according to claim 3, characterized in that: The primer pair was used to obtain three SNP markers through PCR sequencing, namely McMfp5_1, McMfp5_2 and McMfp5_3.

5. Use of the thick-shelled mussel byssus adhesion protein Mfp5 coding region according to claim 1 or the SNP marker primer pair according to any one of claims 2 to 4 in population genetic analysis and / or germplasm resource identification of thick-shelled mussel.

6. A method for detecting SNP polymorphism in thick-shelled mussels, characterized in that: The method comprises the following steps: using the genomic DNA of thick-shelled mussel as a template, using primer pairs designed for the gene sequence of the thick-shelled mussel byssus adhesion protein Mfp5 coding region according to claim 1 or the SNP marker primer pairs according to any one of claims 2 to 4 to prepare a PCR amplification system, performing PCR amplification, performing genotyping on the amplified products, and performing population genetic analysis and / or germplasm resource identification according to the typing results.

7. The method according to claim 6, characterized in that: The template includes genomic DNA from gill filament tissue of thick-shelled mussel.

8. The method according to claim 6, characterized in that The PCR amplification system is based on 25 μL, including: 1~2 μL template, 0.5 μL upstream primer, 0.5 μL downstream primer, 0.5 μL dNTP, 2.5 μL 10×PCR Buffer, 0.2 μL Taq Plus DNA polymerase and the remaining amount of sterile deionized water.

9. The method according to claim 6 or 8, characterized in that The PCR amplification procedure includes: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 40 s, 35 cycles; and extension at 72°C for another 10 min.

Images