Polynucleotides encoding bifunctional antibodies that bind CTLA4 and PD-1

Abstract

The invention belongs to the field of biological medicine, and particularly relates to polynucleotide for coding a bifunctional antibody combined with CTLA4 and PD-1, the polynucleotide is mRNA or saRNA, and the bifunctional antibody targeting CTLA4 and PD-1 contains an amino acid sequence shown in the 21st-284th site of SEQ ID NO: 46 or an amino acid sequence shown in the 19th-282nd site of SEQ ID NO: 47. The polynucleotide is high in expression quantity and long in expression time, and can be used for preparing medicines for treating cancers.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a polynucleotide encoding a bifunctional antibody that binds CTLA4 and PD-1, wherein the polynucleotide is mRNA or saRNA. Background Art

[0002] Over the past decade, immunotherapy has become an important component of the treatment of many cancers. [1] . Programmed cell death-1 (PD-1) receptors are mainly expressed on the surface of activated T lymphocytes. PD-1 binds to its ligands PD-L1 and PD-L2 to inhibit T cell proliferation and cytokine production. Cytotoxic T lymphocyte antigen-4 (CTLA-4) is expressed on the surface of activated CD4+ and CD8+ T cells. It binds to its ligands B7.1 and B7.2 to inhibit T cell activity. Therefore, CTLA-4 is a negative regulator of T cell activity. [2] PD-L1 and PD-L2 are upregulated in some tumor cells, and signaling through this pathway can inhibit the immune surveillance of tumors by activated T cells. PD-1 and CTLA-4 are co-expressed in tumor-infiltrating lymphocytes but not in normal peripheral tissue lymphocytes. [3] .

[0003] Monoclonal antibodies targeting the immune checkpoint PD-1 have been accepted as the standard of care for many tumor types. Many combination therapies with anti-PD-1 antibodies to improve the efficacy of PD-1 monotherapy have been extensively studied. Current clinical studies have shown that combination therapy with anti-CTLA-4 and anti-PD-1 antibodies can produce significant immune responses and improve the efficacy of some difficult-to-treat cancer types, such as renal cell carcinoma, gastric cancer, and small cell lung cancer, but its application is limited due to severe toxicity. [4] Bispecific antibodies are a new generation of therapeutic antibodies that improve the efficacy and safety of cancer patients. Currently, Kangfang Bio's PD-1 & CTLA4 dual antibody has been approved for the treatment of cervical cancer in China. [2] .

[0004] However, bispecific antibodies are expensive to use in therapy, have a short half-life in serum, and most bispecific antibodies face manufacturing challenges, including poor stability in long-term storage, easy aggregation over time, and the presence of various impurities. [5] .

[0005] mRNA has been shown to be a promising way to consistently express antibodies due to its simple production, rapid preparation process, and the lack of complex and expensive laboratory facilities for protein purification. [6], which can accelerate the clinical development of new bispecific antibodies. In addition, compared with mRNA technology, self-replicating mRNA (saRNA) technology is considered to have more advantages, such as low dosage, fewer side effects, and long-term expression. [7] , producing more protein in the body.

[0006] In order to promote the expression of bispecific antibodies in vivo, the inventors now provide a series of polynucleotides with high expression levels to accelerate the application of nucleic acid-based immunotherapy in the field of cancer treatment.

[0007] References:

[0008] [1] Wojtukiewicz MZ, Rek MM, Karpowicz K, et al. Inhibitors of immune checkpoints–PD-1, PD-L1, CTLA-4–new opportunities for cancer patients and a new challenge for internists and general practitioners. Cancer Metastasis Rev. 2021; 40(3):949–82.

[0009] [2]Akeso Inc. Cadonilimab: Chinese prescribing information. Zhongshan: Akeso Inc; 2022

[0010] [3]Wu XH,Ji JF,Lou HM,et al.Efficacy and safety of cadonilimab,ananti-PD-1 / CTLA4 bi-specific antibody,in previously treated recurrent ormetastatic(R / M)cervical cancer:A multicenter,open-label,single-arm,phase IItrial[abstract].Society of Gynecologic Oncology(SGO)Meeting.2022

[0011] [4] Larkin J, Chiarion-Sileni V, Gonzalez R, Grob JJ, Cowey CL, Lao CD, Schadendorf D, Dummer R, Smylie M, Rutkowski P, et al. Combined nivolumab andipilimumab or monotherapy in MABS 9untreated melanoma. N Engl J Med. 2015; 373:23–34.

[0012] [5]Vasilenko EA,Mokhonov VV,Gorshkova EN,et al.BispecificAntibodies:Formats and Areas of Application[J].Molekuliarnaia biologia,2018,52(3):380-393.

[0013] [6] Stadler CR, Bahr-Mahmud H, Celik L, et al. Elimination of largetumors in mice by mRNA-encoded bispecific antibodies (vol 23, pg 815, 2017) [J]. Nature medicine, 2017(10):23.

[0014] [7]Huang C, Duan Summary of the invention

[0015] The object of the present invention is to provide a polynucleotide encoding a bifunctional antibody that binds to CTLA4 and PD-1, wherein the polynucleotide has a high expression level and a long duration.

[0016] The specific technical solutions are as follows:

[0017] A polynucleotide encoding a bifunctional antibody that binds to CTLA4 and PD-1, wherein the bifunctional antibody contains the amino acid sequence shown at positions 21-284 of SEQ ID NO:46 or the amino acid sequence shown at positions 19-282 of SEQ ID NO:47.

[0018] In a specific embodiment, the polynucleotide can be any one of mRNA and saRNA.

[0019] The mRNA is messenger RNA, which is translated into Chinese as "messenger ribonucleic acid". It is a type of single-stranded ribonucleic acid that is transcribed using a strand of DNA as a template, carries genetic information and can guide protein synthesis.

[0020] The saRNA is a self-replicating mRNA, which is based on the traditional mRNA protein-encoding gene and adds a replicase-encoding gene from an alphavirus. After the saRNA is introduced into the cell, it can initiate RNA replication.

[0021] In some embodiments, the bifunctional antibody further comprises: an Fc region; preferably, the Fc region is an Fc region of IgG1, IgG2, IgG3 or IgG4. For example, the amino acid sequence of the Fc region is shown in positions 285-513 of SEQ ID NO:46.

[0022] In some embodiments, the Fc region further comprises a mutation that reduces the affinity constant of the bispecific antibody to FcγRIIIa and / or C1q.

[0023] Preferably, the Fc region is an Fc region of IgG1, and according to the EU numbering system, the Fc region has one or more mutations selected from the following: L234A, L235A, G237A; or the Fc region is an Fc region of IgG4, and according to the EU numbering system, the Fc region has one or more mutations selected from the following: S228P, E233P, F234V, L235A, D254A, L309V, R409K.

[0024] In some embodiments, the amino acid sequence of the bifunctional antibody is as shown in positions 21-513 of SEQ ID NO:46 or positions 21-511 of SEQ ID NO:47.

[0025] In some embodiments, the bifunctional antibody further contains a signal peptide at the N-terminus, and the amino acid sequence of the signal peptide is, for example, as shown at positions 1-20 of SEQ ID NO:46.

[0026] In a specific embodiment, the amino acid sequence of the bifunctional antibody is as shown in SEQ ID NO:46 or as shown in SEQ ID NO:47.

[0027] In some embodiments, the mRNA sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO:46, positions 21-284, is shown in any one of SEQ ID NO:1-20, positions 61-852, or SEQ ID NO:21, positions 113-904, preferably SEQ ID NO:19, positions 61-852, or SEQ ID NO:21, positions 113-904;

[0028] The mRNA sequence encoding the bifunctional antibody is shown in positions 19-282 of SEQ ID NO: 47, and the mRNA sequence is shown in any one of positions 55-846 of SEQ ID NO: 22-41, preferably positions 55-846 of SEQ ID NO: 22.

[0029] In some embodiments, the mRNA sequence encoding the Fc region is as shown in any one of positions 853-1539 of SEQ ID NO: 1-20, positions 905-1591 of SEQ ID NO: 21, positions 847-1533 of SEQ ID NO: 22-41, positions 868-1554 of SEQ ID NO: 42, or positions 847-1533 of SEQ ID NO: 43,

[0030] Preferably, it is SEQ ID NO: 19, positions 853-1539, SEQ ID NO: 21, positions 905-1591, SEQ ID NO: 22, positions 847-1533, SEQ ID NO: 42, positions 868-1554 or SEQ ID NO: 43, positions 847-1533.

[0031] In some specific embodiments, the mRNA sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO: 46, positions 21-513, is shown in any one of SEQ ID NO: 1-20, positions 61-1539, or SEQ ID NO: 21, positions 113-1591, preferably SEQ ID NO: 19, positions 61-1539, or SEQ ID NO: 21, positions 113-1591;

[0032] The mRNA sequence encoding the bifunctional antibody is shown in positions 19-511 of SEQ ID NO: 47, and the mRNA sequence is shown in any one of positions 55-1533 of SEQ ID NO: 22-41, preferably positions 55-1533 of SEQ ID NO: 22.

[0033] In other specific embodiments, the mRNA sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO:46 is shown in any one of SEQ ID NOs:1-21, preferably SEQ ID NO:19 or SEQ ID NO:21;

[0034] The mRNA sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO: 47 is shown in any one of SEQ ID NOs: 22-41.

[0035] In some more specific embodiments, the mRNA sequence may further contain a regulatory motif, preferably, the nucleotide sequence thereof is as shown in SEQ ID NO:48, CAACCGCGGUUCGCGGCCGCU.

[0036] The regulatory motif is located between the polynucleotides encoding the antibody fragment binding to CTLA4 and the antibody fragment binding to PD-1, or is located at the end of the polynucleotide encoding the Fc region, and is connected by a polynucleotide encoding a linker.

[0037] As described above, the nucleotide sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO:47 is selected from any one of SEQ ID NO:42 or SEQ ID NO:43.

[0038] In some embodiments, the invention also provides a saRNA sequence encoding a bifunctional antibody having an amino acid sequence as shown in SEQ ID NO: 47, positions 19-282, as shown in any one of SEQ ID NO: 44-45, positions 7650-8441, preferably SEQ ID NO: 45, positions 7650-8441.

[0039] In some embodiments, the saRNA sequence encoding the Fc region amino acid sequence of SEQ ID NO:47 is shown as positions 8442-9128 of SEQ ID NO:44 or positions 8442-9146 of SEQ ID NO:45.

[0040] In some specific embodiments, the saRNA sequence encoding the bifunctional antibody of the amino acid sequence as shown in SEQ ID NO: 47 at positions 19-511 is shown in SEQ ID NO: 44 at positions 7650-9128 or SEQ ID NO: 45 at positions 7650-9146, preferably SEQ ID NO: 45 at positions 7650-9146.

[0041] In some more specific embodiments, the saRNA sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO: 47 is as shown in any one of SEQ ID NOs: 44-45, preferably SEQ ID NO: 45.

[0042] It should be understood that the types of nucleosides in the polynucleotides of the present invention may be conventional nucleosides, such as adenine, uridine, cytidine and guanosine; or they may be corresponding modified nucleotides or oxidized nucleotides and other common unconventional nucleosides. The modified nucleotides may be selected from one or more of 7-methyl-guanosine, 2'-oxymethyl-guanosine, pseudouridine, 1-methyl-pseudouridine, 5-methyl-cytidine, 4-acetyl-cytidine and 6-methyl-adenine.

[0043] In some embodiments, the polynucleotide can be prepared by in vitro transcription (IVT).

[0044] The present invention also provides a pharmaceutical preparation containing a polynucleotide, which contains any of the polynucleotides described above.

[0045] In specific embodiments, the pharmaceutical preparation further comprises a delivery system.

[0046] In some embodiments, the delivery system of the drug preparation comprises any one of lipids, liposomes, cationic liposomes, lipid nanoparticles (LNP), polymeric compounds, peptides, proteins, cells, nanoparticle mimics, nanotubes or conjugates, preferably liposomes, cationic liposomes, lipid nanoparticles.

[0047] Lipid nanoparticles (LNPs) are nanocarriers for delivering nucleic acid substances to cells, containing ionizable lipids, auxiliary lipid molecules, cholesterol or cholesterol derivatives, polymer-conjugated lipid molecules. For example, as described in PCT / CN2022 / 118198. The entire text of PCT / CN2022 / 118198 is incorporated herein by reference.

[0048] Cationic liposomes generally comprise (1) a cationic lipid, and (2) one or both of a helper lipid and cholesterol. Optionally, the cationic liposomes may also include polymer-conjugated lipid molecules.

[0049] In some embodiments, cationic liposomes contain DOTMA, DOPE and cholesterol, such as described in CN 109331176 B. Cationic (positively charged) liposomes and anionic (negatively charged) nucleic acids form "lipoplexes (LPX)", which can deliver nucleic acids into cells.

[0050] The invention also provides the polynucleotide as described above, and the use of a pharmaceutical preparation containing the polynucleotide in the preparation of a drug for preventing and / or treating cancer.

[0051] The drug is a vaccine, preferably a therapeutic vaccine, which can be used alone as a nucleic acid vaccine, or combined with DC cells to be further prepared as a DC tumor vaccine.

[0052] The cancer may be melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, etc., kidney tumors, prostate cancer, bladder cancer, colorectal cancer, gastrointestinal cancer, liver cancer, non-small cell lung cancer and ovarian cancer.

[0053] The invention also provides DC cells containing the polynucleotides described above. The method for preparing the DC cells comprises the step of incubating the DC cells with lipid nanoparticles encapsulating the polynucleotides described above.

[0054] The beneficial effects of the present invention are:

[0055] Provided are polynucleotides encoding bifunctional antibodies that bind to CTLA4 and PD-1, including mRNA and saRNA. The expression level of the mRNA sequence can reach 800ng / ml, and the in vivo expression time can last for about 3 weeks. The expression level of the saRNA sequence can exceed 2800ng / ml, which is about 3 times that of the mRNA sequence, and the expression time can also last for about 3 weeks. The above sequences achieve continuous high-dose expression of bifunctional antibodies, providing a basic advantage for the clinical application of bifunctional antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 The secretion amount of mRNA sequences 1-21 encoding dual antibody 1194-NLA+12Z1-Fc in CHO cells is shown.

[0057] Figure 2 The secretion amount of mRNA sequence 22-43 encoding dual antibody Z15+12Z1-Fc in CHO cells is shown.

[0058] Figure 3 The amount of IL2 secreted after co-culture of mRNA sequences 22 and 26 encoding the dual antibody Z15+12Z1-Fc with freshly sorted CD4+T cells is shown.

[0059] Figure 4 The expression levels of mRNA sequence 22 and sequence 43 encoding dual antibody Z15+12Z1-Fc in C57 BL / 6 mice are shown.

[0060] Figure 5 The secretion levels of saRNA sequences 44 and 45 encoding dual antibody Z15+12Z1-Fc in CHO cells are shown. DETAILED DESCRIPTION

[0061] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0062] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0063] Example 1 Synthesis of polynucleotides encoding bifunctional antibodies

[0064] The bifunctional antibodies binding to CTLA4 and PD-1 are 1194-NLA+12Z1-Fc, and the amino acid sequence is shown in SEQ ID NO: 46; Z15+12Z1-Fc, and the amino acid sequence is shown in SEQ ID NO: 47. Using Baidu RNA sequence optimization online tool propeller PaddieHelix (https: / / rna.baidu.com / ), the parameters Beam Size: 100-400; Double-stranded (stacking) Length Limit: S1≤33; S2≤15; CAIλ: 1-4; Less Structuresat 5'-end were selected online to generate a polynucleotide sequence encoding the PD1&CTLA4 bifunctional antibody, and then the corresponding endonuclease recognition sites NcoI, AflII, and BspQI were removed by synonymous codon replacement and linearization, and the sequences of mRNA and saRNA were obtained as shown in Table 1.

[0065] Among them, mRNA sequence 1-21 encodes 1194-NLA+12Z1-Fc, mRNA sequence 22-43 encodes Z15+12Z1-Fc, and saRNA sequence 44-45 encodes Z15+12Z1-Fc.

[0066] The above polynucleotides are prepared using an in vitro transcription (IVT) process, and the IVT system comprises a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, and a polymerase. NTPs may be selected from, but are not limited to, natural and non-natural (modified) NTPs described herein. Polymerases may be selected from, but are not limited to, T7 RNA polymerase, T3 RNA polymerase, and mutant polymerases, such as, but not limited to, polymerases capable of incorporating modified nucleic acids. Any number of RNA polymerases or variants may be used to synthesize the polynucleotides of the present invention.

[0067] Table 1 Polynucleotide sequences encoding bifunctional antibodies

[0068]

[0069] Example 2 Verification of expression of mRNA encoding bifunctional antibody

[0070] 2.1 mRNA electroporation into CHO cells

[0071] (1) Preparation before the experiment: CHO culture medium was prepared by mixing DMEM culture medium and RPMI 1640 culture medium in a ratio of 1:1, and adding 10% fetal bovine serum, 1% glutamine, 1% HT, and 1% P / S.

[0072] (2) Cell harvesting: CHO-K1 cells in the logarithmic growth phase were digested and terminated with trypsin. The digested cells were added to a 50 mL centrifuge tube and centrifuged at 400 g for 5 min. The supernatant was discarded and an appropriate amount of CHO culture medium was added to resuspend the cell pellet. The cells were mixed and counted.

[0073] (3) Washing: According to the counting results, the cells were divided into 1.5 mL EP tubes at 1.5E6 cells / tube, centrifuged at 400 g for 5 min, and the supernatant was discarded. 1 mL PBS was added to each tube for washing again, and centrifuged at 400 g for 5 min. The supernatant was discarded until only the cell pellet remained.

[0074] (4) Preparation of electroporation mixture: Add 100 μL of Lonza 2B electroporation solution (solution I:solution II=82:18) and 20 μg of the corresponding mRNA to each EP tube, mix well on a vortex shaker and set aside.

[0075] (5) Electroporation: Add the electroporation mixture in step (4) to the cell pellet collected in step (3) above, mix well and add to a Lonza 2B electroporation cup. Place the cup in a Lonza 2B electroporator and select the CHO-K1 (ATCC) high viability (H-014) program for electroporation.

[0076] (6) Cultivation: After electroporation, use the micropipette in the kit to aspirate the preheated culture medium and the electroporation suspension and mix them evenly. Quickly transfer the mixture to a 6-well plate containing 3 mL of preheated culture medium. Mix well and place the plate in a 37°C, 5% CO2 incubator for culture.

[0077] (7) Supernatant collection: After electroporation, culture for 24 h. Collect 500 uL of supernatant from each group and store at -20°C for later use.

[0078] 2.2 ELISA detection of mRNA

[0079] (1) Antigen coating: 10 mL coating solution + 100 uL human PD-1, His Tag (100 ug / mL), add 100 μL / well to the ELISA plate using a dispenser and incubate at 4°C overnight.

[0080] (2) Take out the supernatant prepared in 2.1 from -20°C in advance, thaw it, and centrifuge it at 400g for 5 min.

[0081] (3) Wash the plate three times with PBST, 300 μL / well, shaking for 30 seconds each time. After washing, pat dry with absorbent paper.

[0082] (4) Blocking: Add 300 μL of blocking solution (PBST + 3% BSA) to each well and incubate in a 37°C biochemical incubator for 2 hours.

[0083] (5) Wash the plate three times with PBST, 300 μL / well, shaking for 30 seconds each time. After washing, pat dry with absorbent paper.

[0084] (6) Dilution of standards and samples: The standards and samples were diluted with diluent (PBST + 3% BSA). The Z15-12Z1-Fc standard was diluted 2-fold from below 12.5 ng / mL into 7 gradients and 0 ng / mL. The 1194NLA-Z12-Fc standard was diluted 2-fold from below 3.125 ng / mL into 7 gradients and 0 ng / mL. The samples were diluted 50X and 500X.

[0085] (7) Add the diluted standards and samples to the corresponding wells, 100 μL / well, set up 2 replicate wells, and incubate at 37°C for 1.5 h.

[0086] (8) Wash the plate three times with PBST, 300 μL / well, shaking for 30 seconds each time. After washing, pat dry with absorbent paper.

[0087] (9) Add detection antibody: Use diluent to dilute the detection antibody (MonoRab TMRabbit Anti-Camelid VHHAntibody (83E7 Clone) [HRP], mAb) was diluted 1:10000, mixed and added to the corresponding well plate, 100 μL / well, and incubated in a 37°C biochemical incubator for 1 h.

[0088] (10) Wash the plate three times with PBST (300 μL / well), shaking for 30 seconds each time. After washing, pat dry with absorbent paper.

[0089] (11) Add TMB colorimetric solution (100 μL / well) and develop the color for 5-10 min at room temperature in the dark.

[0090] (12) Add 50 μL / well of stop solution to terminate the reaction. After the reaction is terminated, read the result on the analyzer within 15 minutes.

[0091] 2.3 mRNA expression results in CHO cells

[0092] The designed 41 mRNAs encoding bifunctional antibodies were expressed in CHO cells. Figure 1 , Figure 2 In the mRNA encoding 1194-NLA+12Z1-Fc ( Figure 1 ), sequences 19 and 21 had the highest expression levels, reaching 800 ng / mL; the remaining sequences 1, 3, 4, 5, 6, 8, 9, 12, 13, 15, 16, 18, and 20 all had expression levels exceeding 100 ng / mL.

[0093] In the mRNA encoding Z15+12Z1-Fc ( Figure 2 ), the expression levels of sequences 42 and 43 can reach 800 ng / mL, and the expression levels of the remaining sequences 22, 27, 28, 33, 35, 36, 37, 38, and 39 all exceed 100 ng / mL.

[0094] Comparing the in vitro bifunctional antibody secretion amounts of sequences 22, 42, and 43, relative to sequence 22, adding a polypeptide mRNA sequence (i.e., the regulatory motif CAACCGCGGUUCGCGGCCGCU (SEQ ID NO.48)) to the mRNA sequence encoding the bifunctional antibody can significantly increase the secretion amount of the bifunctional antibody.

[0095] Example 3 In vitro mixed lymphocyte reaction of mRNA encoding bifunctional antibodies

[0096] 3.1 Preparation of mDC cells

[0097] Donor mDCs were prepared according to CN107574149B.

[0098] 3.2 CD4+ T cell sorting

[0099] CD4+ T cells were isolated from peripheral blood mononuclear cells of another donor using a human CD4+ T cell isolation kit (Milteniy Biotech, Bergisch Gladbach, Germany).

[0100] 3.3 Mixed Lymphocyte Reaction

[0101] 1) Activate 2*10 5 The DC / well culture medium was discarded, washed once with DPBS, and then 300 μL of serum-free Opti-MEM culture medium was added to each well.

[0102] 2) LNP encapsulated mRNA incubation: prepare 200 μL of Opti-MEM and LNP encapsulated mRNA mixed solution, and the final mRNA content of LNP added to each well is 0-2000 ng. The LNP encapsulation steps are as follows: See PCT / CN2022 / 118198, the ionizable lipid compound Target-1 is dissolved in ethanol with DOPE, cholesterol and DSPE-PEG2000 (all purchased from Avituo (Shanghai) Pharmaceutical Technology Co., Ltd.) at a molar ratio of 35:16:46.5:2.5 to prepare an ethanol lipid solution, and dilute the mRNA encoding the bifunctional antibody in 20 mM citrate buffer (pH = 6.1) to obtain an mRNA aqueous solution. By using a microfluidic device (Maianna (Shanghai) Instrument Technology Co., Ltd., model: INano TM L) The ethanol lipid solution and the mRNA aqueous solution were mixed in a volume ratio of 1:3, and liposomes were prepared with a weight ratio of total lipid to mRNA of about 10:1. The solution was replaced by ultrafiltration, the ethanol was removed and the volume was fixed with DPBS. Finally, the lipid nanoparticles were filtered through a 0.2 μm sterile filter to obtain an LNP preparation encapsulating mRNA with ionizable lipid / DOPE / cholesterol / DSPE-PEG2000 (35 / 16 / 46.5 / 2.5 mol%). The size and polydispersity index PDI of the lipid nanoparticles were determined by dynamic light scattering using a Malvern Zetasizer Nano ZS (Malvern UK) in a 173° backscattering detection mode. The results showed that the parameters were as follows: particle size 90.5, PDI 0.133, encapsulation efficiency 95.21%, cell viability 95.0%, positive rate 90.2%, and fluorescence intensity 1.00.

[0103] 3) Add 200 μL of liposome mixed solution dropwise along the top of each well. Shake the well plate crosswise. Incubate in a 37°C, 5% CO2 incubator.

[0104] 4) After 4 hours of culture, add 8*105 CD4+T cells were co-cultured. On day 5, the culture supernatant was collected and the secretion of IL2 was detected using Human IL2 ELISA Kit (Sino-Qiao) according to the kit protocol.

[0105] 3.4 Experimental Results

[0106] The results of in vitro mixed lymphocyte reaction showed that ( Figure 3 ), DC cells transfected with mRNA, with the increase of mRNA dose, the effect of stimulating T cells to secrete cytokine IL-2 is gradually enhanced, and the stimulating effect of sequence 22 is better than that of sequence 26.

[0107] Example 4 Verification of the expression of mRNA encoding bifunctional antibodies in plasma levels of C57BL / 6 mice 4.1 Expression of bifunctional antibodies and mRNA encoding corresponding antibodies in C57BL / 6 mice

[0108] Thirty-six C57BL / 6 mice were divided into 9 groups and injected into the tail vein. The grouping was shown in Table 2. LNP encapsulation was as described in Example 3.

[0109] Table 2 Experimental groups

[0110]

[0111] Blood was collected from the eye sockets of all mice before administration. At 6h, 24h, D2, D3, D4, D5, D6, D7, D9, D11, D13, D15, D17, D20, D22, D24, and D26 after administration, with a blood volume of 0.1mL. Serum was separated from the blood samples and the blood samples were post-processed according to the standard. The antibody content in the serum samples was detected by ELISA, and the detection method was the same as 2.2.

[0112] 4.2 Experimental Results

[0113] From the expression level ( Figure 4 ), Z15-12Z1-0-2 5mg / kg=Z15-12Z1-0 5mg / kg>

[0114] LNP Z15-12Z1-0-2mRNA 1mg / kg>LNP Z15-12Z1-0mRNA 1mg / kg>Z15-12Z1-0-20.5mg / kg=Z15-12Z1-0 0.5mg / kg>LNP Z15-12Z1-0-2mRNA 0.2mg / kg>

[0115] LNP Z15-12Z1-0 mRNA 0.2mg / kg. The results showed that the expression of the antibody was proportional to the amount of nucleic acid, and the expression of sequence 43 was better than sequence 22 overall, among which LNP Z15-12-Z1-0-2mRNA 1mg / kg≈3 times LNP Z15-12-Z1-0 mRNA 1mg / kg.

[0116] From the perspective of sustainability ( Figure 4 ), the protein expression persistence of LNP encapsulated Z15+12Z1-FC_0 and Z15+12Z1-FC_0-2 mRNA was greater than that of Z15-12Z1-Fc and Z15-12Z1-Fc-0-2 proteins, indicating that LNP encapsulated mRNA can reduce the frequency of administration.

[0117] Example 5 Expression verification of saRNA encoding bifunctional antibodies

[0118] 4.1 Expression verification of saRNA encoding bifunctional antibodies in CHO cells

[0119] Referring to steps 2.1 and 2.2 in Example 2, the synthesized saRNA sequence was verified for cell expression.

[0120] 4.2 Experimental Results

[0121] From the expression results of CHO cells ( Figure 5 ), the dual antibody secretion of sequence 44 can last for about 1 week, and the expression level of sequence 45 is higher and lasts longer, and the dual antibody secretion can be maintained for about 3 weeks.

Claims

1. A polynucleotide encoding a bifunctional antibody that binds CTLA4 and PD-1, characterized in that: The bifunctional antibody contains the amino acid sequence shown at positions 21-284 of SEQ ID NO:46 or the amino acid sequence shown at positions 19-282 of SEQ ID NO:

47.

2. The polynucleotide according to claim 1, wherein The polynucleotide is any one of mRNA and saRNA.

3. The polynucleotide according to any one of claims 1 to 2, characterized in that The bifunctional antibody further comprises an Fc region. Preferably, the amino acid sequence of the Fc region is as shown in positions 285-513 of SEQ ID NO:

46.

4. The polynucleotide according to any one of claims 1 to 3, characterized in that The amino acid sequence of the bifunctional antibody is shown in SEQ ID NO:46 or SEQ ID NO:

47.

5. The polynucleotide according to any one of claims 1 to 4, characterized in that The mRNA sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO:46, positions 21-284, is shown in any one of SEQ ID NO:1-20, positions 61-852, or SEQ ID NO:21, positions 113-904, preferably SEQ ID NO:19, positions 61-852, or SEQ ID NO:21, positions 113-904; The mRNA sequence encoding the bifunctional antibody is shown in positions 19-282 of SEQ ID NO: 47, and the mRNA sequence is shown in any one of positions 55-846 of SEQ ID NO: 22-41, preferably positions 55-846 of SEQ ID NO:

22.

6. The polynucleotide according to claim 3, wherein The mRNA sequence encoding the Fc region is shown in any one of positions 853-1539 of SEQ ID NO: 1-20, positions 905-1591 of SEQ ID NO: 21, positions 847-1533 of SEQ ID NO: 22-41, positions 868-1554 of SEQ ID NO: 42, or positions 847-1533 of SEQ ID NO: 43, Preferably, it is SEQ ID NO: 19, positions 853-1539, SEQ ID NO: 21, positions 905-1591, SEQ ID NO: 22, positions 847-1533, SEQ ID NO: 42, positions 868-1554 or SEQ ID NO: 43, positions 847-1533.

7. The polynucleotide according to any one of claims 1 to 6, characterized in that The mRNA sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO:46 is shown in any one of SEQ ID NOs:1-21, preferably SEQ ID NO:19 or SEQ ID NO:21; The mRNA sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO: 47 is shown in any one of SEQ ID NOs: 22-41.

8. The polynucleotide according to claim 7, wherein The mRNA sequence also contains a regulatory motif, and preferably, its nucleotide sequence is shown in SEQ ID NO:

48.

9. The polynucleotide according to claim 8, wherein The regulatory motif is located between the polynucleotides encoding the antibody fragment that binds to CTLA4 and the antibody fragment that binds to PD-1, or at the end of the polynucleotide encoding the Fc region. Preferably, the nucleotide sequence encoding the bifunctional antibody with an amino acid sequence as shown in SEQ ID NO:47 is selected from SEQ ID NO:42 or SEQ ID NO:

43.

10. The polynucleotide according to any one of claims 1 to 4, characterized in that The saRNA sequence encoding the bifunctional antibody as shown in SEQ ID NO: 47, positions 19-282 is shown in any one of SEQ ID NO: 44-45, positions 7650-8441, preferably SEQ ID NO: 45, positions 7650-8441.

11. The polynucleotide according to claim 10, wherein The saRNA sequence encoding the bifunctional antibody having an amino acid sequence as shown in SEQ ID NO: 47 is shown in any one of SEQ ID NOs: 44-45, preferably SEQ ID NO:

45.

12. A pharmaceutical preparation containing a polynucleotide, characterized in that: The pharmaceutical preparation comprises the polynucleotide according to any one of claims 1-11.

13. The pharmaceutical preparation according to claim 12, characterized in that The pharmaceutical preparation also contains a delivery system.

14. The pharmaceutical preparation according to claim 13, characterized in that The delivery system of the drug preparation comprises any one of lipids, liposomes, cationic liposomes, lipid nanoparticles (LNP), polymeric compounds, peptides, proteins, cells, nanoparticle mimics, nanotubes or conjugates, preferably liposomes, cationic liposomes, lipid nanoparticles.

15. Use of the polynucleotide according to any one of claims 1 to 11, or the pharmaceutical preparation according to any one of claims 12 to 14 in the preparation of a drug for preventing and / or treating cancer.

16. The use according to claim 15, characterized in that The drug is a vaccine, preferably a therapeutic vaccine.

17. The use according to any one of claims 15 to 16, characterized in that: The cancer is selected from melanoma, lung cancer, head and neck cancer, renal cell carcinoma, urothelial carcinoma, non-Hodgkin's lymphoma, etc., kidney tumors, prostate cancer, bladder cancer, colorectal cancer, gastrointestinal cancer, liver cancer, non-small cell lung cancer and ovarian cancer.

18. A DC cell comprising the polynucleotide according to any one of claims 1 to 11.

19. The method for preparing DC cells according to claim 18, comprising the step of incubating DC cells with lipid nanoparticles encapsulating the polynucleotide according to any one of claims 1 to 11.

Images