Application of variable-shear NAC transcription factor OsNTL5 in high-environment temperature response of rice

Abstract

The invention discloses an application of a variable shear NAC transcription factor OsNTL5 in high environment temperature response of rice. According to the invention, a key factor for regulating and controlling the plant growth and development of the rice at the high environment temperature is identified for the first time, and a method for cultivating the rice variety adapting to the high environment temperature by performing gene editing and overexpression on the OsNTL5.1 and the OsNTL5.2 on the variable shear NAC transcription factor OsNTL5 is disclosed. Therefore, gene resources and a research basis are provided for cultivation of excellent rice varieties adapting to high environment temperature.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a NAC transcription factor capable of variable splicing. OsNTL5 Application in rice response to high ambient temperature. Background Art

[0002] The 2023 World Meteorological Organization's "Global Climate Status in 2022" report pointed out that due to record levels of greenhouse gases, the global average temperature in 2022 will be about 1.15°C higher than before industrialization. The global warming process is accelerating, and the suitable temperature for crop growth and development cannot be changed in a short period of time, posing a huge threat to food security. Studies have shown that without considering fertilization, crop adaptability and genetic improvement, if the global average temperature rises by 1°C, the yields of wheat, corn, rice and soybeans are expected to decrease by 6%, 3.2%, 7.4% and 3.1% respectively (Zhao et al., 2017). Therefore, it is very important to study the perception and response of plants to high temperatures in the context of global warming.

[0003] Heat stress can cause cells to accumulate a large number of improperly folded toxic proteins in a short period of time. It is more advantageous to remove these toxic proteins than to restore their activity (Zhang et al., 2019). The ubiquitin / 26S proteasome is an important protein degradation complex responsible for degrading ubiquitinated proteins (Xu and Xue, 2019). Researchers cloned the QTL for heat resistance in African rice TT1 , TT1 Encoding 26S proteasome α2 subunit, superior allele from African rice OgTT1 It can effectively remove ubiquitination-mediated denatured proteins and maintain cellular protein homeostasis at high temperatures (Li et al., 2015). TOGR3 The β4 subunit of the 26S proteasome in rice promotes growth response to high ambient temperature by enhancing carbon fixation and inhibiting carbon metabolism to maintain carbon balance (Guo Feifei, 2020). However, it is still unclear how the proteasome regulates high temperature response. Therefore, genetic screening of inhibitors of temperature-responsive proteasome mutants helps to deeply understand the molecular mechanism of its involvement in temperature response, thereby providing a theoretical basis and new genetic resources for breeding rice varieties adapted to high ambient temperatures. Summary of the invention

[0004] The purpose of the present invention is to provide a NAC transcription factor with variable splicing OsNTL5 Application in rice response to high ambient temperature.

[0005] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a NAC transcription factor with variable splicing OsNTL5Application in rice response to high ambient temperature.

[0006] In the present invention, OsNTL5 The genomic DNA sequence is: i) the nucleotide sequence shown in SEQ ID NO: 1; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C and the membrane is washed with the solution; or iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function.

[0007] Further, OsNTL5 Contains four alternatively spliced ​​transcripts OsNTL5.1 , OsNTL5.2 , OsNTL5.4 and OsNTL5.5 ;in, OsNTL5.1 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO: 2, or a DNA sequence that has more than 90% homology with the DNA sequence shown in SEQ ID NO: 2 and encodes a protein with the same function; OsNTL5.2 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO: 3, or a DNA sequence having more than 90% homology with the DNA sequence shown in SEQ ID NO: 3 and encoding a protein with the same function; OsNTL5.4 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO: 4, or a DNA sequence having more than 90% homology with the DNA sequence shown in SEQ ID NO: 4 and encoding a protein with the same function; OsNTL5.5 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO: 5, or a DNA sequence that has more than 90% homology with the DNA sequence shown in SEQ ID NO: 5 and encodes a protein with the same function.

[0008] Furthermore, by OsNTL5 The modification is made to make it functionally ineffective, thereby improving the adaptability of rice to high ambient temperatures.

[0009] Genome editing technologies such as CRISPR, TALEN, and ZFN can be used to modify genes. OsNTL5 Carry out transformation.

[0010] Furthermore, by overexpressing OsNTL5.1 and OsNTL5.2 , thereby improving the adaptability of rice to high ambient temperatures.

[0011] In a second aspect, the present invention provides a method for improving the adaptability of rice to high environmental temperature, the method comprising: using genetic engineering means to weaken or knock out a gene in rice. OsNTL5 .

[0012] Further, OsNTL5 As the target, a sgRNA sequence based on CRISPR / Cas9 is designed, a DNA fragment containing the sgRNA sequence is connected to a vector carrying CRISPR / Cas9, and rice is transformed to obtain OsNTL5 Loss-of-function transgenic rice.

[0013] Preferably, the nucleotide sequence of the sgRNA action site is 5'-GTACAGGTCCACCTCCGCGATGG -3' and 5'-GTACGGAGCTCCTTTTGTTGAGG -3'.

[0014] Furthermore, the transformation is carried out using Agrobacterium-mediated method.

[0015] For example, the expression cassette containing the above two target sequences is simultaneously connected to pYLCRISPR / cas9 Vector ( pYLCRISPR / cas9 The vector was kindly provided by Liu Yaoguang's laboratory, College of Agriculture, South China Agricultural University) to transform rice temperature response defective mutants togr3 , can recover togr3 High temperature response defects.

[0016] In a third aspect, the present invention provides a method for improving the adaptability of rice to high environmental temperature, the method comprising: using genetic engineering means to overexpress in rice OsNTL5.1 and OsNTL5.2 For example, in rice mutants defective in temperature response togr3 Overexpression OsNTL5.1 and OsNTL5.2 , can recover togr3 High temperature response defects.

[0017] Furthermore, the overexpression method may be selected from the following 1) to 5), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the plant chromosome; 3) by changing the promoter sequence of the gene on the plant chromosome; 4) by operably linking a strong promoter to the gene; 5) By introducing enhancers.

[0018] In a fourth aspect, the present invention provides the use of the transgenic rice obtained according to the method in plant breeding.

[0019] Furthermore, breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0020] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention identifies for the first time a key factor regulating rice plant growth and development under high ambient temperature, and discloses a NAC transcription factor that regulates rice plant growth and development under high ambient temperature. OsNTL5 Gene editing and overexpression OsNTL5.1 and OsNTL5.2 Methods for breeding rice varieties that adapt to high environmental temperatures, thereby providing genetic resources and research basis for breeding excellent rice varieties that adapt to high environmental temperatures. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 In the preferred embodiment of the present invention togrs1 Phenotypic identification of ZH11 grown in Hainan and Beijing. togr3 , togr3 togrs1 and togrs1 , B and C, plant height (n≥16) and tiller number statistics (n≥16) of each genotype of rice in A. D, ZH11 grown in Beijing, togr3 , togr3 togrs1 and togrs1 Panicle phenotypes, E and F, Panicle extension length (n=12) and flag leaf width (n=12) of each genotype in D were counted. G, ZH11 planted in 25℃ / 20℃ and 35℃ / 30℃ incubators for 16 days, togr3 , togr3 togrs1 and togrs1 , H, The third leaf (25℃ / 20℃) and the fourth leaf (25℃ / 20℃) after three weeks of growth were magnified for observation. I, The seedling height of each genotype of rice in G was statistically analyzed (n=26). J, The leaf width of each genotype of rice in H was statistically analyzed (n=16). The scales of A, D and H are 10 cm, and the scale of G is 20 cm. The values ​​are expressed as mean ± standard deviation, and the significance analysis was performed by one-way analysis of variance. Multiple comparisons were performed by Tukey-Test. Different letters indicate significant differences.

[0022] Figure 2 The length of rice internode cells in the preferred embodiment of the present invention is measured. A, Beijing filling period ZH11, togr3 , togr3 togrs1 andtogrs1 Stem, red arrows indicate the position of internodes. B, Relative length percentage of each internode of each genotype of rice in A (n≥11). C, Length statistics of each internode of each genotype of rice in A (n≥11). D, Resin section observation of the middle part of the last internode of each genotype of rice in A. E, Length statistics of each genotype of rice in D (n=9). F, Count of the number of rice cells of each genotype in D (n=9). Scale: A is 10cm, D is 100uM. Data are expressed as mean ± standard deviation, significance analysis was performed by one-way analysis of variance, multiple comparisons were performed by Tukey-Test, and different letters indicate significant differences.

[0023] Figure 3 In the preferred embodiment of the present invention TOGRS1 A, TOGRS1 Map-based cloning was performed using 68 exchangeable strains and M1-M6 marker primers. TOGRS1 The candidate gene is located at the end of the long arm of chromosome 8. B, According to RGAP annotation, the candidate gene OsNTL5 Contains 5 transcripts, white boxes are non-coding regions, gray boxes are exons, horizontal lines are introns, and arrows indicate togrs1 Mutation and premature termination position. C, OsNTL5.1 protein structure diagram, the orange box represents the NAM domain, and the green box represents the transmembrane domain. D, Presumed togrs1 Protein sequence.

[0024] Figure 4 In the preferred embodiment of the present invention TOGRS1 Candidate genes OsNTL5 Genetic validation. A, ZH11, togr3 , togr3 togrs1 , togrs1 and different genetically modified materials planted in Beijing, togr3 osntl5g Indicated in togr3 Background import osntl5 Driven by its own promoter osntl5 Genome sequence, togr3 osntl5c Indicated in togr3 Background import ACTIN Promoter driven osntl5 CDS sequence, togr3 osntl5cri Indicated in togr3 CRISPR editing was performed in the background. The scale bar is 10 cm. B, Statistics of rice plant height of each genotype in A (n≥16). C, Statistics of rice tiller number of each genotype in A (n≥16). Values ​​are expressed as mean ± standard deviation, significance analysis was performed using one-way ANOVA, multiple comparisons were performed using Tukey-Test, and different letters indicate significant differences.

[0025] Figure 5 In the preferred embodiment of the present invention OsNTL5 CRISPR CAS9 gene editing mutation types. OsNTL5.1 For reference, the red and blue arrows indicate the locations of the two designed targets, the first and second exons, respectively, and the red box is the PAM sequence. osntl5-cri-1 A 3 bp deletion occurred at 160-162 bp and a 1 bp deletion occurred at 550 bp. osntl5-cri-2 A 1 bp insertion occurred at 161 bp and a 343 bp insertion occurred at 551-894 bp.

[0026] Figure 6 RT-qPCR detection in the preferred embodiment of the present invention OsNTL5 A, RT-qPCR detection OsNTL5 Expression levels in different tissues of rice, including leaves, leaf sheaths, nodes, internodes, roots, florets before flowering, florets after flowering, and leaves and roots of rice seedlings grown for 14 days in Beijing fields at flowering stage. B, RT-qPCR analysis of ZH11 grown in two temperature incubators at 25℃ / 20℃ and 35℃ / 30℃ for 2 weeks, togr3 , togr3 togrs1 and togrs1 Detection of different transcripts of OsNTL5 was performed.

[0027] Figure 7 The yeast self-activation in the preferred embodiment of the present invention verifies that OsNTL5.1 has transcriptional activation activity.

[0028] Figure 8 In the preferred embodiment of the present invention, the four variants of OsNTL5 are localized in tobacco subcellular compartments, and mcherry-HDEL is a marker localized in the endoplasmic reticulum. DETAILED DESCRIPTION

[0029] The present invention provides a NAC transcription factor with variable splicing OsNTL5 And its application in rice response to high ambient temperature.

[0030] The inventors of the present invention have a mutant defective in responding to high ambient temperature. togr3 Perform suppressor screening and name one of the suppressors togrs1 ( togr3 suppressor 1 ), togr3 At low ambient temperatures, the plant is similar to the wild type, but at high ambient temperatures, it becomes significantly dwarfed. togrs1 Can significantly inhibit togr3 High temperature dwarfing phenotype. TOGR3 Encodes the β4 subunit of the rice 26S proteasome, togrs1 yestogr3 inhibitor, indicating TOGRS1 Involved in the proteasome-mediated high temperature response pathway.

[0031] The present invention is identified by positional cloning and transgenic experiments TOGRS1 Encodes NAC transcription factor OsNTL5 , and its gene number is Os08g0562200 (RAP number) LOC_Os08g44820 (MSU number).

[0032] The present invention provides OsNTL5 The genomic DNA sequence includes an upstream promoter and a downstream 3'UTR, and the sequence is shown in SEQ ID NO: 1.

[0033] The present invention provides OsNTL5 The four alternative splicing nucleotide sequences were named OsNTL5.1 , OsNTL5.2 , OsNTL5.4 , OsNTL5.5 The nucleotide sequences correspond to SEQ ID NO: 2, 3, 4, 5, respectively, or have more than 90% homology with SEQ ID NO: 2, 3, 4, 5, and encode proteins with the same transcription factor function.

[0034] The present invention provides OsNTL5 The amino acid sequences of proteins encoded by different splicing forms are named OsNTL5.1 , OsNTL5.2 , OsNTL5.4 and OsNTL5.5 , the amino acid sequences correspond to SEQ ID NO: 6, 7, 8, 9, respectively, or the amino acid sequences shown in SEQ ID NO: 6, 7, 8, 9 are substituted, deleted or added with one or more amino acids and are proteins derived from SEQ ID NO: 6-9 that have the same transcription factor function as the proteins shown in SEQ ID NO: 6, 7, 8, 9. The N-terminus of the OsNTL5.1 protein includes a NAM domain and the C-terminus includes a transmembrane domain.

[0035] The present invention provides a method of OsNTL5 Methods for gene editing to regulate rice's high temperature response. Specifically, the targeted OsNTL5 sgRNA, using CRISPR / CAS9 technology OsNTL5 Insertions / deletions / substitutions at specific locations were performed to obtain rice plants with altered genomes. togr3 In, yes OsNTL5 Gene editing can significantly restore togr3 High temperature response.

[0036] The present invention provides a OsNTL5.1 and OsNTL5.2 A method for regulating the high temperature response of rice by overexpression. pACTIN:EGFP-OsNTL5.1 and pACTIN:EGFP-OsNTL5.2 Transformation of recombinant vector into temperature response defective mutant togr3 Significant recovery togr3 High temperature response.

[0037] The present invention provides the above recombinant vector, and host cells containing the recombinant vector, such as Escherichia coli, Agrobacterium and rice cells.

[0038] The present invention also provides a vector, which comprises two vectors, one vector is a plant expression vector comprising the polynucleotide sequence, and the other vector is a plant gene editing vector comprising a target sequence for gene editing the polynucleotide sequence.

[0039] The present invention also provides a host cell containing the vector, wherein the host cell is selected from bacteria, fungi or plant cells, preferably Escherichia coli ( Escherichia coli ) cells, Agrobacterium ( Agrobacterium tumefaciens ) cells or plant cells.

[0040] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0041] Example 1 Isolation and genetic analysis of genes controlling rice's adaptability to high ambient temperature togr3 It is a temperature response defective mutant screened by our laboratory in the early stage (corresponding to the mutant in CN114410603B togr3 - 1 ), its plant height in Hainan with low ambient temperature is similar to that of the wild type, but it is more severely dwarfed in Beijing with higher temperature. togr3 The molecular mechanism involved in temperature response, the inventors togr3 EMS mutagenesis was performed, and its suppressor was screened, and one of them was named togrs1 ( togr3 suppressor 1 ).exist togr3 togrs1 In the double mutant, togrs1 In Beijing, it can significantly inhibit togr3 The phenotypes are shorter plant height, shorter ear length, shorter ear extension from the leaf sheath, and narrower leaves ( Figure 1 , AF). In order to eliminate the interference of other environmental factors in the field, the above materials were planted in 25℃ and 35℃ incubators to observe the phenotypes. Similar to the above results, at 25℃, togr3Similar to the wild type, at 35°C, togr3 Severe dwarfing, togrs1 Can inhibit togr3 The phenotype of shorter plant height and narrower leaves ( Figure 1 , GJ).

[0042] togr3 Plant height was seriously dwarfed in Beijing. The internode length was counted and it was found that the internode of ZH11 was significantly shorter than that of ZH11. togr3 togrs1 The length ratio of each internode is similar to that of ZH11 ( Figure 2 , AC). In order to explore togr3 and togrs1 To understand the role of the mitochondria, we performed resin sectioning on the inverted internode and counted the cell length and number. togr3 The cell length was significantly shortened, the cell number was significantly increased, and togr3 togrs1 Cell length and cell number are similar to those of ZH11 ( Figure 2 , DF), indicating togr3 Reduce cell elongation, togrs1 Can inhibit togr3 The cell length is reduced.

[0043] To clone TOGRS1 The genes encoding togr3 and togr3 togrs1 The F1 hybrids showed close to the wild type, and the F2 offspring were planted in Beijing to observe the phenotype. togr3 The chi-square test results showed that the above phenotype plants were in line with the 3:1 separation, so togrs1 is a dominant single gene controlled mutant. togr3 togrs1 68 F2 populations were selected from the ZH11 background and NJ6 (Nanjing 6) togr3 The genotype of the plant was identified by polymorphic molecular markers, and it was found that the chromosome 8 M6 marker was closely linked to the phenotype ( Figure 3 , A). We further togr3 and togr3 togrs1 Resequencing was performed and togr3 Compared with the sequence, togr3 togrs1 Only one gene near M6 had a mutation in the coding region, namely, a CCGC insertion at 208-211bp in the first exon of LOC_Os08g44820.1, which caused a frameshift and premature termination of translation. According to the annotation of the rice RGAP database, this gene was named OsNTL5 , contains 5 transcripts and is a NAC family transcription factor). The OsNTL5.1 protein contains a conserved NAM domain at the N-terminus and a transmembrane domain at the C-terminus ( Figure 3, B~D). Therefore, we identified this gene as TOGRS1 candidate genes.

[0044] Example 2 TOGRS1 Candidate genes OsNTL5 Transgenic verification and rice genetic transformation Example 1 The results show togrs1 is a dominant mutation, so osntl5 ( togrs1 Mutations in osntl5 )genome sequence (including its own promoter sequence, genome sequence and 3' non-coding region sequence) pCAMBIA2300 Vector (laboratory preservation), construction pCAMBIA2300-osntl5genome The steps of vector construction are as follows: first, use OsNTL5-pro-EcorⅠ and OsNTL5-pro-BamHI to amplify the 2kb sequence upstream of ATG as the promoter sequence, and use the restriction enzyme digestion method of EcorⅠ and BamHI to connect to the vector ( pCAMBIA2300-pro ), and then OsNTL5-F-BamHI and OsNTL5-R-SalⅠ were used to amplify about 1 kb downstream of the ATG stop codon, and BamHI and SalⅠ were used to digest and ligate to pCAMBIA2300-pro Vector, primer sequences are as follows (5′-3′): OsNTL5-pro-EcorⅠ: CCGGAATTCCAGGCTCCAAGACATCAAAC (SEQ ID NO:12) OsNTL5-pro-BamHI: CGCGGATCCGTGCCCTAGATTGGGATTGG (SEQ ID NO:13) OsNTL5-F-BamHI: CGCGGATCCATGAGCCACCCCTCGTCGTC (SEQ ID NO:14) OsNTL5-R-SalⅠ: ACGCGTCGACGTGAAGCTGAATTGCTCGCC (SEQ ID NO:15) Will pCAMBIA2300-osntl5genome Sequence conversion to togr3 Significant recovery togr3 At high ambient temperatures, the dwarf phenotype ( Figure 4 , AC).

[0045] In addition, early termination togrs1 CDS sequence (SEQ ID NO: 10) was linked in by seamless cloning pCAMBIA2300-proACTIN-EGFP In, obtain pCAMBIA2300-proACTIN-EGFP-togrs1 , the primer sequences are as follows (5′-3′): togrs1 -F: GCATGGACGAGCTGTACAAGATGAGCCACCCCTCGTCGTC (SEQ ID NO:16) togrs1 -R: TAAAGCAGGGCATGCCTGCAGTCAACAAAAGGAGCTCCGTACTG (SEQ ID NO:17) Will pCAMBIA2300-proACTIN-EGFP-togrs1 Convert to togr3 , observed the phenotype in Beijing and found that it can also recover togr3 High temperature response defects ( Figure 4 , AC).

[0046] In addition, the inventors OsNTL5 Two CRISPR CAS9 editing targets were designed ( Figure 5 ), the target sequence is as follows (5′-3′): OsNTL5-CRI#1: GTACAGGTCCACCTCCGCGATGG (SEQ ID NO:18) OsNTL5-CRI#2: GTACGGAGCTCCTTTTGTTGAGG (SEQ ID NO:19) The expression cassette containing the above two target sequences was simultaneously connected to pYLCRISPR / cas9 Vector ( pYLCRISPR / cas9 The vector was kindly donated by Liu Yaoguang Laboratory, College of Agriculture, South China Agricultural University. togr3 , and can also restore togr3 High temperature response defects ( Figure 4 , A~C).

[0047] The inventors have amplified OsNTL5.1 and OsNTL5.2 CDS sequences were linked in by seamless cloning pCAMBIA2300-proACTIN-EGFP Vector, primer sequences are as follows (5′-3′): OsNTL5.1CDS-F: GACGAGCTGTACAAGTCTAGAATGAGCCACCCCTCGTCG (SEQ ID NO:20) OsNTL5.1CDS-R: TAAAGCAGGGCATGCCTGCAGCTACTTGCCATAGATGCACATGC (SEQ IDNO:21) OsNTL5.2CDS-F: GACGAGCTGTACAAGTCTAGAATGAGCCACCCCTCGTCG (SEQ ID NO:22) OsNTL5.2CDS-R: TAAAGCAGGGCATGCCTGCAGTTAATGGCCAGGCAATGAGAA (SEQ ID NO:23) Will pCAMBIA2300-proACTIN-EGFP-OsNTL5.1 / 5.2 Conversion togr3 , observed the phenotype and found that they were able to recover togr3 Temperature response defects ( Figure 4 , AC).

[0048] The rice genetic transformation method is as follows: the above-constructed vector is transformed into E.coli In DH5α competent cells, positive clones were screened using kanamycin. Plasmids were extracted and sequenced to obtain positive clones with completely correct sequences in the cloning vector. The plasmids of the positive clones were then electroporated into EHA105 Agrobacterium competent cells (prepared by conventional methods according to Plant Genetic Engineering, Wang Guanlin, Fang Hongjun, Science Press, 2004, 2nd edition). The successfully transformed clones were then infected with Agrobacterium to obtain the clones. togr3 Perform transgenic manipulation for the recipient.

[0049] The genetic modification operation method is as follows: (1) Seed sterilization: Weigh 20-30 g of dried rice seeds and remove the seed husks using a small laboratory huller. Soak the hulled seeds in 70% ethanol for 1 minute, then soak them in 30% sodium hypochlorite (the stock solution is 10% effective chlorine, add 1 drop of Tween20 for every 50 mL) for 30 minutes and shake them gently on a shaker. Then rinse them with sterile water for 5-6 times; then disinfect them once with 30% sodium hypochlorite (without Tween20) and rinse them with sterile water for 5-6 times. Transfer the seeds to filter paper in the clean bench and air dry them.

[0050] (2) Inducing callus: Transfer the seeds to the N6D medium prepared in advance, and then culture them in a light incubator at 32°C and 24 hours of continuous light for 5-7 days until the seeds grow golden callus.

[0051] (3) Agrobacterium infection: Agrobacterium containing a specific plasmid is introduced into EHA105 Streak culture on YEB medium containing antibiotics rifampicin (Rif 25-50 mg / L) and kanamycin (Kan 50 mg / L), then place in an oven at 28°C for dark culture for 2-3 days; pick a single clone strain into 5-6 mL of liquid YEB medium containing the same resistance, and shake overnight in a shaker at 28°C and 220 rpm for about 12 hours. Inoculate the bacterial liquid into 50 mL of AAM medium at a ratio of 1:100, and shake overnight in a shaker at 28°C and 220 rpm until OD600 About 0.1; soak the callus in good condition in the Agrobacterium solution for 2 minutes, then quickly take out the callus with tweezers and place it on sterile filter paper to air dry. After the callus is air-dried, transfer it to N6D-As medium covered with sterile filter paper (soaked in AAM) in advance, wrap the culture dish containing the callus with sealing film and tin foil, and culture it in the dark at 25℃ for 2-2.5 days.

[0052] (4) Screening and differentiation: First, rinse the callus co-cultured with Agrobacterium in sterile double distilled water for 3-4 times, then rinse it 2-3 times with sterile double distilled water containing carboxybenzyl (500 mg / L) and then soak it for 30 minutes each time, repeat 3-5 times, and try to clean the Agrobacterium on the surface of the callus. Use sterile filter paper to absorb the water of the washed callus and air-dry it, then transfer it to N6DS medium containing antibiotics hygromycin B (50 mg / L) and carboxybenzyl (400 mg / L), and culture it in a light incubator at 32°C with 24 hours of continuous light for 2-3 weeks. The calli with good growth were transferred to regeneration RE medium containing hygromycin B (50 mg / L) and carbobenzyl (250 mg / L), and cultured in a 32°C incubator for 1 month to induce differentiation. The RE medium was replaced approximately every two weeks until green seedlings appeared. The calli that differentiated into green seedlings were transferred to MS (sucrose 30 g / L) medium containing hygromycin B (50 mg / L) and carbobenzyl (200 mg / L) to induce rooting. When the seedlings grew to a certain size, they were transferred to MS medium without antibiotics for culture.

[0053] The culture medium related to rice transformation by Agrobacterium infection is shown in Table 1.

[0054] Table 1 Culture media related to rice transformation by Agrobacterium infection

[0055] Example 3 OsNTL5 Analysis of the response of alternative splicing transcripts to temperature Combined with the rice database annotation, it was detected by RT-PCR OsNTL5.1 , OsNTL5.2 , OsNTL5.4 and OsNTL5.5 Four alternatively spliced ​​transcripts, but none were detected OsNTL5.3 The expression of all transcripts was detected by qPCR using primers that can amplify all transcripts (OsNTL5total-qPCR-F / R). tubulin The expression pattern analysis was performed with tubulin-qPCR-F / R as the internal reference. OsNTL5 The highest expression was in the leaves of 14-day-old seedlings, followed by roots, internodes and leaf sheaths of mature plants. It was also expressed in leaves, nodes and panicles ( Figure 6, A). In order to study the response of different transcripts to temperature, five pairs of RT-qPCR primers were designed, including OsNTL5.2 (OsNTL5.2-qPCR-F / R), OsNTL5.4 (OsNTL5.4-qPCR-F / R), and OsNTL5.5 (OsNTL5.5-qPCR-F / R) single transcripts, as well as primers that can simultaneously amplify OsNTL5.1 + OsNTL5.2 The RNA level of rice materials grown at two temperatures was detected by using the universal primers (OsNTL5.1and5.2-qPCR-F / R) and all four transcripts (OsNTL5total-qPCR-F / R). OsNTL5.1 and OsNTL 5.2 Expression Figure 6 , B). The primer sequences are as follows (5′-3′): OsNTL5total-qPCR-F: CAACCATTCTGAAGACGTGG OsNTL5total-qPCR-R: GTTCCCAGCATTGGCACTAG OsNTL5.2-qPCR-F: GTCTCCAGCATTGGCACTAG OsNTL5.2-qPCR-R: TCCATGATGGATCAGCACTA OsNTL5.4-qPCR-F: GCTATGTACTGTGGATGCTGAC OsNTL5.4-qPCR-R: AGGGGTCTCAGAAGTTGGTA OsNTL5.5-qPCR-F: CCTACACTGTTTCGGGGAAA OsNTL5.5-qPCR-R: TGGCATCGCATTATCAGCAG OsNTL5.1and5.2-qPCR-F: CCGTCGGCATGAAGAAGACC OsNTL5.1and5.2-qPCR-R: ATACGGCACACGACGAATGA tubulin-qPCR-F: GGAAATACATGGCTTGCTGCTT tubulin-qPCR-R: TCTCTTCGTCTTGATGGTTGCA Example 4 Yeast transcriptional autoactivation assay and OsNTL5Observation on subcellular localization of alternative splicing transcripts The full-length and truncated forms of OsNTL5.1 were ligated into pGBKT7 (Clontech), transformed into yeast strain Y2HGold, and cultured in triple-deficient medium (SD / -Trp / -Ade / -His). The results showed that OsNTL5.1 has transcriptional activation activity, and the transcriptional activation domain is not in the conserved N-terminal NAM domain, but in the C-terminal ( Figure 7 ).

[0056] When eGFP-OsNTL5.1 was transiently expressed in tobacco, its fluorescence signal was localized in the nucleus and endoplasmic reticulum by confocal fluorescence microscopy. When OsNTL5.1-eGFP was transiently expressed, the fluorescence signal was only localized in the endoplasmic reticulum, which is consistent with previous studies, that is, the C-terminal transmembrane domain of OsNTL5.1 will be cut from the endoplasmic reticulum to release its N-terminus to enter the nucleus to play a transcriptional regulatory role. In addition, the localization of the other three transcripts was also focused on. OsNTL5.2 was localized in the endoplasmic reticulum and the nucleus, and its C-terminus also contained a transmembrane domain localized in the endoplasmic reticulum. OsNTL5.4 and OsNTL5.5 were only localized in the endoplasmic reticulum. It is speculated that the loss of the NAM domain at the N-terminus caused them to lose the nuclear localization signal. togrs1 Only the N-terminal 53 amino acids and 161 frameshifted amino acids of OsNTL5.1 (SEQ ID NO: 11) were retained, and localized in the cytoplasm and nucleus ( Figure 8 ).

[0057] Rice is one of the most important food crops in my country, and its normal adaptive response to environmental temperature is the basis for normal growth, development and maturity. The present invention cloned the key factors that control the adaptability of rice to high environmental temperature, providing important guidance for improving the adaptability of rice to environmental temperature through rice genetic engineering and molecular breeding.

[0058] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

[0059] References: [1] Guo Feifei (2020) Carbon balance regulation of thermomorphogenesis mediated by rice 26S proteasome β4 subunit OsPBD1[D]. Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0060] [2]Li X M, Chao D Y, Wu Y, Huang X, Chen K, Cui L G, Su L, Ye W W,Chen H, Chen H C, Dong N Q, Guo T, Shi M, Feng Q, Zhang P, Han B, Shan J X,Gao J P, and Lin H X. Natural alleles of a proteasome α2 subunit genecontribute to thermotolerance and adaptation of African rice. Nat Genet.2015:47(7):827-833. [3]Xu F Q, and Xue H W. The ubiquitin-proteasome system in plantresponses to environments. Plant Cell Environ. 2019:42(10):2931-2944. [4]Zhang J, Li X M, Lin H X, and Chong K. Crop Improvement ThroughTemperature Resilience. Annu Rev Plant Biol. 2019:70(753-780. [5]Zhao C, Liu B, Piao S, Wang X, Lobell D B, Huang Y, Huang M, YaoY, Bassu S, Ciais P, Durand J L, Elliott J, Ewert F, Janssens I A, Li T, LinE, Liu Q, Martre P, Müller C, Peng S, Peñuelas J, Ruane A C, Wallach D, WangT, Wu D, Liu Z, Zhu Y, Zhu Z, and Asseng S. Temperature increase reducesglobal yields of major crops in four independent estimates. Proc Natl AcadSci U S A. 2017:114(35):9326-9331。

Claims

1. A NAC transcription factor with variable splicing OsNTL5 Application in rice response to high ambient temperature; OsNTL5 The genomic DNA sequence is: i) the nucleotide sequence shown in SEQ ID NO: 1; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C and the membrane is washed with the solution; or iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function; OsNTL5 Contains four alternatively spliced ​​transcripts OsNTL5.1 , OsNTL5.2 , OsNTL5.4 and OsNTL5.5 ;in, OsNTL5.1 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO: 2, or a DNA sequence that has more than 90% homology with the DNA sequence shown in SEQ ID NO: 2 and encodes a protein with the same function; OsNTL5.2 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO: 3, or a DNA sequence having more than 90% homology with the DNA sequence shown in SEQ ID NO: 3 and encoding a protein with the same function; OsNTL5.4 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO: 4, or a DNA sequence having more than 90% homology with the DNA sequence shown in SEQ ID NO: 4 and encoding a protein with the same function; OsNTL5.5 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO: 5, or a DNA sequence that has more than 90% homology with the DNA sequence shown in SEQ ID NO: 5 and encodes a protein with the same function.

2. The use according to claim 1, characterized in that: Through the rice OsNTL5 The modification is made to make it functionally ineffective, thereby improving the adaptability of rice to high ambient temperatures.

3. The use according to claim 1, characterized in that: By overexpression in rice OsNTL5.1 and OsNTL5.2 , thereby improving the adaptability of rice to high ambient temperatures.

4. A method for improving the adaptability of rice to high environmental temperature, characterized in that: The method comprises: using genetic engineering means to weaken or knock out the OsNTL5 ; OsNTL5 As described in claim 1.

5. The method according to claim 4, characterized in that by OsNTL5 As the target, a sgRNA sequence based on CRISPR / Cas9 is designed, a DNA fragment containing the sgRNA sequence is connected to a vector carrying CRISPR / Cas9, and rice is transformed to obtain OsNTL5 Loss-of-function transgenic rice; Preferably, the nucleotide sequence of the sgRNA action site is 5'-GTACAGGTCCACCTCCGCGATGG -3' and 5'-GTACGGAGCTCCTTTTGTTGAGG -3'.

6. The method according to claim 5, characterized in that The transformation is carried out by Agrobacterium-mediated method.

7. A method for improving the adaptability of rice to high environmental temperature, characterized in that: The method comprises: using genetic engineering to overexpress in rice OsNTL5.1 and OsNTL5.2 ; OsNTL5.1 and OsNTL5.2 As described in claim 1; The overexpression method is selected from the following 1) to 5), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the plant chromosome; 3) by changing the promoter sequence of the gene on the plant chromosome; 4) by operably linking a strong promoter to the gene; 5) By introducing enhancers.

8. Use of the transgenic rice obtained by the method according to any one of claims 4 to 7 in plant breeding.

9. The use according to claim 8, characterized in that: Breeding methods include transgenic, hybridization, backcrossing, selfing or asexual reproduction.

Images