Wheat transcription factor gene TaWRKY65 and application thereof in regulation and control of ethylene synthesis and drought resistance

Abstract

The invention discloses a wheat transcription factor gene TaWRKY65 and application of the wheat transcription factor gene TaWRKY65 in regulation and control of ethylene synthesis and drought resistance, and the nucleotide sequence of the wheat transcription factor gene TaWRKY65 is as shown in SEQ ID NO. 1. The wheat TaWRKY65 gene encodes a WRKY transcription factor, can be directly combined with a promoter of an ethylene synthesis gene TaACS, activates the expression of the wheat TaWRKY65 gene to promote the biosynthesis of ethylene, positively regulates the drought resistance of wheat, and has an important application value for drought-resistant breeding of wheat.

Description

Technical Field

[0001] The invention relates to the fields of agriculture and botany, and specifically to a wheat transcription factor gene TaWRKY65 and its application in regulating ethylene biosynthesis and drought-resistant breeding. Background Art

[0002] Wheat is one of the most important food crops in the world, providing about 20% of the energy intake and protein source for billions of people worldwide (Miransari and Smith, 2019). Drought is the main abiotic factor affecting the stable yield of wheat. In drought years, the drought-affected area in the Huanghuai winter wheat area and the northern winter wheat area accounts for about 40% of the cultivated area, and the yield reduction can reach 10% to 70% (Piao et al., 2010; Li et al., 2018). The frequent droughts caused by climate change and unstable rainfall have led to the continued intensification of the drought situation, and the drought-affected area has gradually expanded to wheat areas such as the southwest, posing a serious threat to wheat production. In recent decades, breeders have steadily increased wheat yields through selective breeding, but the drought resistance of wheat varieties still needs to be further improved (Abberton et al., 2016). Continuously improving drought resistance is an important goal of breeding new wheat varieties. Mining key genes for wheat drought resistance is of great significance for breeding drought-resistant wheat varieties.

[0003] WRKY transcription factors are a plant-specific gene family with many members that regulate target gene expression by binding to the W-box motif in the promoter region. In Arabidopsis and rice, many studies have reported that WRKYs are involved in regulating drought resistance (Chen et al., 2017; Ye et al., 2021). In addition, WRKY also plays a very important role in the interaction between plant hormones (Javed and Gao, 2023). AtWRKY70 is a core gene in the joint regulation of disease resistance by JA and SA (Li et al., 2004). HvWRKY38 regulates seed germination by coordinating ABA, SA and gibberellins (GAs) signals (Xie et al., 2007). AtWRKY57 is a convergence node where JA and auxin pathways intersect (Jiang et al., 2014). Therefore, WRKY may be a key node gene in the network that regulates the intersection of hormone pathways and thus regulates plant growth, development and resistance. However, few drought resistance-related WRKYs have been identified in wheat, and there are no reports on their direct regulation of hormone pathways and thus drought resistance. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a wheat transcription factor gene TaWRKY65 and its application in regulating ethylene synthesis and drought resistance. Through virus-mediated gene silencing (VIGS) and drought resistance identification, it is found that reducing the expression of the TaWRKY65 gene will lead to a significant decrease in the expression level of wheat endogenous hormone ethylene synthesis-related gene TaACS, the content of ethylene precursors and drought resistance. It is further proved that the TaWRKY65 gene can directly bind to the promoter of the ethylene synthesis gene TaACS and activate its expression, and is a new key activation gene for regulating ethylene synthesis.

[0005] The wheat transcription factor gene TaWRKY65 in the present invention, the nucleic acid sequence of the wheat transcription factor gene TaWRKY65 is shown as SEQ ID NO.1.

[0006] The wheat transcription factor gene TaWRKY65 gene of the present invention encodes a WRKY transcription factor, and the sequence has a WRKY domain, but is not homologous or similar to other wheat WRKY transcription factors regulating drought resistance.

[0007] The application of the wheat transcription factor gene TaWRKY65 in the present invention in regulating ethylene synthesis and drought resistance is an application in wheat variety breeding or drought resistance genetic improvement.

[0008] The amino acid sequence of the wheat transcription factor gene TaWRKY65 is shown in SEQ ID NO.2.

[0009] The primer sequences for amplifying the full-length coding sequence of TaWRKY65 are:

[0010] WRKY65-1:ATGTCGGACTGCAGCACGGGC;

[0011] WRKY65-2:TCAGGAGCAGGGCGCGGTGG;

[0012] WRKY65 VIGS fragment amplification primer sequences:

[0013] OHL851:CACCTACTCCTACGATCAC; OHL852:CTCATGTTCCTCCTCCTG.

[0014] The TaWRKY65 nucleic acid sequence of the present invention is 846 bp in length, encodes 281 amino acids, and the protein has a predicted molecular weight of 30.7 kDa.

[0015] The present invention designs primers based on wheat genome data, uses the cDNA of wheat variety Fielder as a template, clones, and obtains the full-length sequence. Design gene silencing primers, connect the silencing fragment into the VIGS vector based on barley streak mosaic virus, and perform gene silencing. Drought resistance identification found that reducing the expression of TaWRKY65 gene will lead to a significant decrease in wheat drought resistance; the results of gene expression level and endogenous hormone content identification showed that TaWRKY65 positively regulates the biosynthesis of ethylene; yeast single hybrid and dual luciferase reporter system experiments further proved that TaWRKY65 has a transcriptional activation effect on TaACS.

[0016] The wheat TaWRKY65 gene in the present invention encodes a WRKY transcription factor, which is a new transcription factor regulating ethylene synthesis and drought resistance, and has important application value for wheat breeding and improving wheat drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Statistical diagram of TaWRKY65 positively regulating ethylene biosynthesis and drought resistance.

[0018] Figure 1 Middle: A shows that the expression of TaWRKY65 is induced by drought treatment; B shows that the expression of TaWRKY65 in TaWRKY65-silenced plants is significantly lower than that in control plants; C shows that the expression of TaACS in TaWRKY65-silenced plants is significantly lower than that in control plants; D shows the W-box domain in the promoter region of TaACS; E shows that TaWRKY65 can directly bind to the M1 W-box in the promoter region of TaACS; F and G show that TaWRKY65 can activate the expression of TaACS; H shows the comparison of the drought resistance phenotypes between TaWRKY65-silenced plants and control plants; I shows the comparison of the content of ethylene precursor ACC in plants after TaWRKY65 silencing; J shows the comparison of the survival rate of TaWRKY65-silenced plants and control plants after drought. DETAILED DESCRIPTION

[0019] The content of the invention of the present invention will be further described in detail below in conjunction with specific embodiments:

[0020] The materials and reagents used are as follows:

[0021] Plant material: Fielder wheat (from the laboratory of Chengdu Institute of Biology, Chinese Academy of Sciences)

[0022] Primer materials used:

[0023] (1) Primers for amplifying the full-length coding sequence of TaWRKY65

[0024] (2) TaWRKY65 VIGS fragment amplification primers

[0025] (3) TaWRKY65 fluorescence quantitative PCR primers

[0026] (4) TaACS fluorescent quantitative PCR primers

[0027] (5) TaACS promoter M1 W-box sequence primer

[0028] (6) TaACS promoter sequence primer

[0029] The sequences are detailed in Table 1 below.

[0030] Table 1 Primer list

[0031]

[0032] Reagents: Trizol kit for total RNA extraction was purchased from TIANGEN; DNA Marker, pEASY-T1 cloning Kit, pEASY-Blunt E1 Expression Kit, and QPCR mix were all products of Quanshijin; KOD high-fidelity enzyme and reverse transcription kit were all products of TOYOBO. In vitro RNA synthesis kit and dual luciferase detection kit were purchased from Promega. Restriction endonucleases were purchased from NEB.

[0033] Example 1

[0034] Plant total RNA extraction and reverse transcription:

[0035] (1) Soak wheat Fielder seeds in water and place them in a 4°C refrigerator for 2 days. Then, spread the seeds evenly on a continuously moist filter paper and place them in a 5-cm diameter culture dish. Let them germinate at room temperature of about 24°C and a 16h / 8h photoperiod.

[0036] (2) Leaves of seedlings 14 days after seeding were cut and ground in liquid nitrogen, and total RNA was extracted using a kit.

[0037] (3) Reverse transcription was performed according to the TOYOBO reverse transcription reagent method to synthesize cDNA.

[0038] Amplification of the full-length coding sequence and silent fragment of wheat TaWRKY65:

[0039] Using the reverse transcription product cDNA as a template, two different pairs of primers were used to amplify the full-length coding sequence of TaWRKY65 and the TaWRKY65 gene silencing fragment, respectively. The 384bp to 555bp segment of the TaWRKY65 full-length sequence was amplified to silence the TaWRKY65 gene to reduce the expression level of the TaWRKY65 gene. The primer sequence for amplifying the full-length coding sequence of TaWRKY65 is:

[0040] WRKY65-1:ATGTCGGACTGCAGCACGGGC;

[0041] WRKY65-2:TCAGGAGCAGGGCGCGGTGG;

[0042] TaWRKY65 VIGS fragment amplification primer sequence:

[0043] OHL851:CACCTACTCCTACGATCAC;

[0044] OHL852: CTCATGTTCCTCCTCCTG.

[0045] The amplification reaction system is as follows:

[0046]

[0047] The PCR amplification program conditions were 94°C for 2 min; 98°C for 10 s, 55-62°C for 30 s, 68°C for 1 min / kb, 38 cycles; and finally extension at 68°C for 10 min.

[0048] Example 2

[0049] TaWRKY65 VIGS vector construction and VIGS (virus-induced gene silencing) inoculation:

[0050] (1) BSMV-α, BSMV-β, BSMV-γ: GFP plasmids were placed in a -20°C refrigerator for later use.

[0051] (2) Enzyme digestion of target fragment and BSMV vector:

[0052] Enzyme cleavage target fragment (silent fragment with restriction site): the restriction site is NheⅠ.

[0053]

[0054] Enzyme digestion of BSMV-γ:GFP plasmid:

[0055]

[0056] The operation steps are: temperature 37°C, after 5 hours of enzyme digestion, run the gel to recover the product. The recovery steps are the steps in the instructions of the agarose gel electrophoresis kit. The enzyme digestion is a single enzyme digestion, and the following is the same. The enzyme digestion cuts the plasmid and linearizes it for subsequent connection.

[0057] The recycling steps are as follows:

[0058] The product was electrophoresed on a 1.5% agarose gel, the target band was cut off against the DNA marker, and transferred to a clean 2mL centrifuge tube. 600μL of gel recovery Binding Buffer was added for every 100mg of gel, and placed in a 60℃ water bath for 15 minutes, shaking and mixing every 2-3 minutes. The melted gel was transferred to the recovery column, and the recovery column was placed in the collection tube, and centrifuged at 10,000rpm for 1 minute at room temperature. Remove the recovery column, pour out the solution in the collection tube, put the recovery column back into the collection tube, add 700μL of Wash solution, centrifuge at 10,000rpm for 1 minute at room temperature, and then repeat the wash once. Place the recovery column in another clean 1.5mL centrifuge tube, add 30-50μL of Elution Buffer to the recovery column membrane, let it stand at room temperature for 2 minutes, and centrifuge at 10,000rpm for 1 minute.

[0059] (3) Ligation of the target fragment (silent fragment recovered after NheⅠ digestion) and BSMV vector:

[0060] The silencing fragment recovered by NheI digestion was connected to the BSMV-γ:GFP vector (BSMV silencing vector) recovered by NheI digestion. The reaction system is as follows:

[0061]

[0062] The operation steps are as follows: after standing in a metal bath at a temperature of 16°C for 2 to 3 hours, the ligation product is used to transform E. coli, and the positive clones are selected for plasmid extraction.

[0063] E. coli transformation steps: transfer 5 μL of the ligation reaction solution into 200 μL of E. coli competent cells, mix well, avoid shaking, and place on ice for 30 minutes. Heat shock the competent cells in a 42°C water bath for 90 seconds, ice bath for 5 minutes, then quickly add 1 mL of LB liquid culture medium, place the centrifuge tube horizontally on a 37°C shaker and shake slowly for 45 minutes. Centrifuge at 4,000 rpm for 5 minutes at room temperature, leaving about 100 μL of supernatant, resuspend the cells with a sterile pipette tip, and apply the bacterial suspension to an LB solid plate containing ampicillin (100 μg / mL). In order to allow the bacterial solution to be fully absorbed, place the plate for about 1 minute, cover it, invert it, and culture it at 37°C. Colonies can be observed growing after 12-16 hours.

[0064] Plasmid extraction: Extract according to the instructions of Tiangen Plasmid Extraction Kit.

[0065] (4) BSMV viral plasmid linearization and recovery:

[0066]

[0067] The temperature was 37°C and the time was 8 hours;

[0068]

[0069]

[0070] 37℃, 8 hours digestion.

[0071] Finally, the recovery of viral vector after linearization:

[0072] Extract once with phenol:chloroform:isoamyl alcohol (25:24:1), add an equal volume of isopropanol, place at -20℃ for 1 hour, centrifuge at 12,000g for 10 minutes at 4℃, carefully pour off the supernatant, wash the precipitate once with 70% alcohol, centrifuge at 6,000rpm at room temperature, place until the alcohol evaporates, add 30-50μL of RNase free water to dissolve the precipitate, and place at -20℃ for 1 hour. ℃ save.

[0073] (5) Production and inoculation of BSMV total viral RNA:

[0074] BSMV virus was produced using the Promega Ribomax RNA large-scale production kit (20 μL system).

[0075]

[0076] The amplification temperature was 37°C and the amplification time was 3h.

[0077] Mixing of virus impregnation solution: Mix the raw materials in the following system.

[0078]

[0079] The 2×GKP buffer formula is as follows:

[0080] 50 mM glycine, 30 mM potassium phosphate dibasic, pH 9.2, 1% bentonite, 1% celite.

[0081] Wheat seedlings at the two-leaf and one-heart stage were selected, and the BSMV virus vector (TaWRKY65 VIGS vector) was used to silence the TaWRKY65 gene of wheat plants. The silencing operation steps were to repeatedly apply gloves to the base of the second leaf to create a wound to allow the virus to enter. Two weeks after inoculation with BSMV virus, plants with BSMV-infected leaves were selected, and stripes appeared on the new leaves. The TaEF gene (elongation factor-1) was used as an internal reference gene, and the expression level of TaWRKY65 in the leaves of TaWRKY65-silencing plants (plants after BSMV infection phenotype) and control plants (infected with viruses without TaWRKY65 silencing fragments) was detected by fluorescent quantitative PCR.

[0082] Result analysis: Fluorescence quantitative results showed that Figure 1 As shown in B and C, compared with the control plants, the expression of TaWRKY65 and TaACS genes in TaWRKY65-silencing plants was significantly reduced, with the expression levels reduced by about 80% and 90%, respectively.

[0083] Example 3

[0084] Yeast one-hybrid assay:

[0085] (1) Vector construction:

[0086] The W-box (M1-M3) sequence of the TaACS promoter was connected to the pHis2 vector to construct a bait vector, and the TaWRKY65 coding sequence was connected to the pRec2 vector to construct a bait vector.

[0087] (1) Yeast transformation

[0088] Take 100μL of Y187 competent cells melted on ice, add pre-cooled bait and bait plasmid (1-2μg each), 10μL of Carrier DNA (95-100℃, 5min, quick ice bath, repeat once), 500μL of PEG / LiAc and pipette several times to mix, and place in a 30℃ water bath for 30min (invert 6-8 times at 15min to mix). Place the tube in a 42℃ water bath for 15min (invert 6-8 times at 7.5min to mix). Centrifuge at 5000rpm for 40s and discard the supernatant, resuspend in 400μL of ddH2O, centrifuge for 30s and discard the supernatant. Resuspend with 50μL of ddH2O, plate on SD / -Leu / -Trp plate, and culture at 30℃ for 3-5d (at the same time, streak the Y187 positive-negative strain on the SD / -Leu / -Trp plate to activate it).

[0089] (2) Mutual Verification

[0090] After the above transformation is successful, pick a fresh single colony (2-3mm) from each sample and resuspend it in 1mL sterile water, and adjust OD600 to 0.2 (SD / -Leu / -Trp liquid culture medium can also be used to culture until OD600 = 0.2). Then dilute 10 times, 100 times, and 1000 times with sterile water in sequence (i.e. OD600 = 0.2, 0.02, 0.002, 0.0002). In the order of experimental group first and control group, 10 μL is plated on SD / -Leu / -Trp, SD / -His / -Leu / -Trp+3-AT plates (3-AT concentrations are 0, 30mM, 60mM and 90mM, respectively). Culture at 30°C for 2-3 days, and observe the growth of each group of recombinant yeast on the corresponding self-activated 3-AT concentration plate to determine whether there is interaction.

[0091] The results showed that on the SD-LHT plate with 60 mM 3-AT, only yeast containing TaWRKY65+M1 could maintain growth, while yeast containing YFP+M1 was inhibited, indicating that TaWRKY65 can bind to M1. In addition, M2 and M3 have serious self-activation phenomena, and this system cannot verify whether TaWRKY65 can bind to them.

[0092] Example 4

[0093] Luciferase reporter system experiment:

[0094] (1) Vector construction: A TaACS promoter sequence of approximately 1950 bp was amplified from genomic DNA and seamlessly cloned into the pGreenII 0800-LUC vector after digestion with BamHI and HindIII to generate the reporter plasmid 35S::REN-TaACSPro::LUC. The full-length coding fragment of TaWRKY65 was amplified and inserted into the pCambia1300 vector via KpnⅠ to obtain the effector plasmid 35S::TaWRKY65.

[0095] (2) Transformation and injection: The effector and reporter plasmids were transformed into Agrobacterium strain GV3101 containing the pSoup plasmid. Agrobacterium carrying the effector and reporter plasmids were evenly mixed and inoculated into 4-week-old Nicotiana benthamiana leaves. After 48 hours of inoculation, the back of the leaves was sprayed with 1 mM luciferin substrate D-luciferin potassium salt reaction solution, and images were captured using a chemiluminescence imaging system.

[0096] (3) Fluorescence value determination: The Ren and Luc fluorescence values ​​were detected using a dual luciferase reporter assay system with a GLOMAX96 microplate luminometer (Promega).

[0097] The results showed that TaWRKY65 could activate the TaACS promoter, leading to upregulation of LUC expression, and the LUC / REN value was significantly higher than that of the control.

[0098] Example 5

[0099] Drought resistance identification:

[0100] Gene-silenced wheat and control wheat were sown and cultivated in homogenized soil at the same time, and watered uniformly. When the seedlings grew to 3-4 leaves, watering was stopped and drought treatment was carried out. The state of the plants was carefully observed during the drought period. After about 3-4 weeks, drought was stopped and water was restored. The wheat survival rate was counted 3 days after rehydration.

[0101] TaWRKY65-silencing plants and control plants were subjected to drought treatment and the survival rate after drought was statistically analyzed. The results showed that the drought resistance of TaWRKY65-silencing plants was significantly reduced compared with the control. The above results indicate that TaWRKY65 gene silencing leads to a decrease in the drought resistance of plants, and TaWRKY65 plays a positive regulatory role in wheat drought resistance. Figure 1 .

[0102] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which will fall within the scope of the present invention to be protected. The scope of the present invention to be protected is defined by the attached claims and their equivalents.

Claims

1. Wheat transcription factor gene TaWRKY65, characterized in that: The nucleotide sequence of the wheat transcription factor gene TaWRKY65 is shown in SEQ ID NO.

1.

2. The wheat transcription factor gene TaWRKY65 according to claim 1, characterized in that: The amino acid sequence of the wheat transcription factor gene TaWRKY65 is shown in SEQ ID NO.

2.

3. The wheat transcription factor gene TaWRKY65 according to claim 1 or 2, characterized in that: The primer sequences for amplifying the full-length coding sequence of the wheat transcription factor gene TaWRKY65 are as follows: WRKY65-1:ATGTCGGACTGCAGCACGGGC; WRKY65-2:TCAGGAGCAGGGCGCGGTGG.

4. The wheat transcription factor gene TaWRKY65 according to claim 1 or 2, characterized in that: The sequences of the WRKY65 VIGS fragment amplification primers for the wheat transcription factor gene TaWRKY65 are as follows: OHL851:CACCTACTCCTACGATCAC; OHL852: CTCATGTTCCTCCTCCTG.

5. Use of the wheat transcription factor gene TaWRKY65 in regulating ethylene synthesis in plants according to any one of claims 1 to 4, characterized in that: The wheat transcription factor gene TaWRKY65 is used in regulating ethylene synthesis in plants.

6. Use of the wheat transcription factor gene TaWRKY65 in regulating plant drought resistance according to any one of claims 1 to 4, characterized in that: The wheat transcription factor gene TaWRKY65 is used to regulate plant ethylene synthesis to achieve regulation of plant drought resistance.

7. Use of the wheat transcription factor gene TaWRKY65 in regulating plant drought resistance according to any one of claims 1 to 4, characterized in that: Application in drought resistance breeding.

Images