StSAM-MT gene and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and relates to an StSAM-MT gene and application thereof. The invention provides a StSAM-MT gene. The StSAM-MT gene comprises the following steps: a1) encoding a StSAM-MT protein; and b1) has a nucleotide sequence as shown in SEQ ID NO: 2. The invention reveals that the StSAM-MT gene plays an important role in negative regulation of the resistance of potatoes to phytophthora infestans, provides a theoretical basis and a new technical thought for identification of potato susceptible genes, and has important guiding significance for creating potato germplasm with broad-spectrum resistance and stable yield by accurately controlling the expression of the genes.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and relates to StSAM-MT Genes and their applications. Background Art

[0002] As an important dual-purpose food and vegetable crop in the world, potato has long been attacked by various pathogens, among which Phytophthora infestans ( Phytophthora infestans ) is particularly serious, threatening potato production and may even lead to a total loss of production.

[0003] When plants deal with external adverse factors, they have evolved two levels of molecular immune systems for defense. The first level of the plant immune system directly recognizes pathogen-associated molecular patterns (PAMPs) released by pathogens through pattern recognition receptors (PRRs) on the cell membrane, thereby triggering pattern-triggered immunity (PTI). This mechanism is the first line of defense for plants against pathogen infection and can effectively resist the invasion of some pathogens. However, when pathogens break through the first level of the immune system, plants will activate a stronger second level of the immune system, namely effector-triggered immunity (ETI) (Jones et al., 2006). This system relies on disease-resistant genes in plant cells ( R These proteins can recognize effector molecules released by pathogens and trigger a stronger immune response. R Genes are often used to develop crops that are resistant to specific pathogens. R Genes encode leucine-rich repeat-containing proteins that directly or indirectly recognize pathogenic effector proteins and trigger immunity. R Gene-mediated disease resistance is species-specific, and pathogens can evade plant immune defenses by mutating their effector genes.

[0004] Given that R Gene-mediated disease resistance has its limitations. In recent years, scientists have begun to explore the destruction of plant disease-susceptibility genes as a new strategy for breeding disease-resistant plants. Disease-susceptibility genes are host genes necessary for pathogens to infect and cause disease. Compared with disease-resistant genes, resistance mediated by mutations in disease-susceptibility genes is usually persistent and broad-spectrum. For example, MLO The gene is a typical disease susceptibility gene, and its loss-of-function mutation can significantly enhance the plant's broad-spectrum resistance to powdery mildew (Li et al., 2022). Similarly, the disease susceptibility gene in wheat TaPsIPK1 The edited lines also showed high resistance to stripe rust in field trials without affecting the main agronomic traits of wheat (Wang et al., 2022).

[0005] SAM-MT is an important enzyme in the secondary metabolism of plants. It can transfer the methyl group of S-adenosylmethionine (SAM) to the structure of one or more secondary metabolites, thereby changing the structure and biological activity of these compounds. For example, in the synthesis of compounds such as lignin, phenylpropanes and flavonoids, SAM-MT can catalyze methylation reactions to generate secondary metabolites with specific structures and functions. In addition, SAM-MT also affects the synthesis and signal transduction of plant hormones such as jasmonic acid through methylation modification, thereby regulating the growth and development process of plants. SAM-MT also plays an important role in the initiation and regulation of plant defense mechanisms. It can affect methylation reactions, thereby affecting the disease resistance and insect resistance of plants. Some literature reports indicate that, WUSCHEL It can inhibit the expression of S-adenosyl-L-methionine-dependent methyltransferases (including possible SAM-MT) in some plants, thereby inhibiting the synthesis of viral proteins (Haijun et al., 2020). TaSAM Genes have been shown to contribute to wheat resistance to Fusarium head blight (Malla et al., 2024). Based on these findings, the applicants speculate that in potatoes, S-adenosyl-L-methionine-dependent methyltransferase genes (particularly those discovered by the applicants) StSAM-MT ) may play an important role in potato resistance to late blight. The applicant's research results show that StSAM-MT It is a potato late blight susceptibility gene.

[0006] In summary, the discovery and use of disease-susceptibility genes provides a new approach to breeding disease-resistant plant varieties. By destroying or editing disease-susceptibility genes, plant varieties with persistent and broad-spectrum resistance can be bred, thereby more effectively responding to the threat of pathogens. This strategy helps to improve plant disease resistance and provide a sustainable and environmentally friendly disease prevention and control solution for agricultural production. In the future, the applicant will further analyze StSAM-MT The mechanism of action in plant immunity can provide new strategies and methods for breeding potato varieties resistant to late blight. Summary of the invention

[0007] The purpose of the present invention is to further explore key genes that regulate potato resistance to Phytophthora infestans, and to adopt effective means to expand the application of functional genes in improving potato resistance to late blight. To this end, the present invention provides the application of S-adenosyl-L-methionine-dependent methyltransferase StSAM-MT to provide new technical ideas for enriching disease-resistant gene resources and molecular-assisted breeding and creating disease-resistant materials.

[0008] The inventors of the present application successfully isolated and cloned a potato S-adenosyl-L-methionine-dependent methyltransferase gene from a potato cDNA library (StSAM-MT gene), and verified StSAM-MT Role of genes in immune regulation in potato response to infection by Phytophthora infestans.

[0009] To achieve this technical purpose, the present invention adopts the following technical solution.

[0010] In a first aspect, the present invention provides StSAM-MT Gene, the StSAM-MT Gene: a1) Encoding StSAM-MT protein; b1) having the nucleotide sequence shown in SEQ ID NO:2.

[0011] In a second aspect, the present invention provides a StSAM-MT protein, wherein the StSAM-MT protein: 1) having the amino acid sequence shown in SEQ ID NO: 1; 2) a derivative amino acid sequence obtained by substituting, deleting and / or adding one or more amino acids to the amino acid sequence in 1), wherein the derivative amino acid sequence has the activity of the amino acid sequence shown in 1); or 3) An amino acid sequence having at least 80% homology to the amino acid sequence in 1).

[0012] Preferably, the StSAM-MT Genes associated with immune regulation in potato-infesting Phytophthora infestans.

[0013] Preferably, the StSAM-MT The gene plays a negative regulatory role in the immune response of potato against Phytophthora infestans.

[0014] Preferably, overexpression of StSAM-MT Gene reduces host plant resistance to Phytophthora infestans Phytophthora infestans resistance.

[0015] Preferably, the StSAM-MT The gene has a specific gene fragment with a nucleotide sequence as shown in SEQ ID NO: 3, and silencing the specific gene fragment can enhance the host plant's resistance to Phytophthora infestans. Phytophthora infestans resistance.

[0016] In a third aspect, an expression vector is provided, wherein the expression vector contains the StSAM-MT Gene.

[0017] In addition, it provides resistance to Phytophthora infestans Phytophthora infestans A method for breeding plant varieties, comprising transferring the expression vector of the present invention into a host plant and silencing StSAM-MT Gene steps.

[0018] Furthermore, the present invention also provides StSAM-MT Gene or the expression vector of the present invention in the resistance to Phytophthora infestans Phytophthora infestans Application in plant variety breeding.

[0019] Preferably, it includes: a2) Silence StSAM-MT Nucleotide sequence of a gene that enhances host plant resistance to Phytophthora infestans Phytophthora infestans or b2) Reduce the activity and / or expression of StSAM-MT proteins to enhance the host plant's resistance to Phytophthora infestans Phytophthora infestans resistance.

[0020] In the present invention, reducing the activity and / or expression level of a specific protein in plants can be achieved by methods well known in the art such as VIGS, RNA interference, homologous recombination, and gene site editing to reduce the activity and / or expression level of a specific protein in plants.

[0021] In the present invention, those skilled in the art can easily adopt known methods, such as directed evolution and point mutation methods, to modify the present invention. StSAM-MT Therefore, the present invention claims protection for the S-adenosyl-L-methionine-dependent methyltransferase gene StSAM-MT Application in breeding and creating germplasm resources resistant to potato pathogenic fungus. StSAM-MT The nucleotide sequence of a gene with 75% or higher identity is StSAM-MT The genes have the same function and are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0022] In the present invention, the term "nucleotide sequence" or "polynucleotide" refers to a linear polymer of natural or synthetic nucleotide residues connected by phosphodiester bonds or their analogs. It can be single-stranded or double-stranded, and includes RNA, DNA (e.g., genomic, cDNA or synthetic), analogs thereof, or combinations thereof. It should be understood by those skilled in the art that the order of representation of nucleotide sequences is usually 5'-3' order from left to right, and, unless otherwise indicated, "A" refers to deoxyadenosine, "C" refers to deoxycytidine, "G" refers to deoxyguanosine, "T" refers to deoxythymidine, and "U" refers to the ribonucleoside, uridine. Typically, nucleotide sequences contain four natural deoxynucleotides or four natural ribonucleotides; however, they may also contain non-natural nucleotide analogs.

[0023] In the present invention, the term "amino acid sequence" refers to the order in which amino acids are arranged in a protein. This sequence is determined by genetic information, specifically, by genes in DNA or RNA through the process of transcription and translation. Amino acid sequences are usually represented by a string of letters, each letter representing a specific amino acid. These sequences are arranged in the direction from the N-terminus (amino terminus) to the C-terminus (carboxyl terminus). In biology, there are 20 different standard amino acids, each of which has a specific single-letter or three-letter abbreviation. For example, the three-letter and single-letter abbreviations for methionine (Lysine) are Lys and K, respectively.

[0024] In the present invention, the term "gene" is the main substance of genetic variation. It is the basic unit that controls traits and is composed of many different base pair arrangements on deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) molecules that determine biological traits. Genes express the genetic information they carry by guiding the synthesis of proteins, thereby controlling the expression of traits of individual organisms. Specifically, genes are located on chromosomes and are arranged linearly. They are genetic units that occupy a certain position on chromosomes. Genes have duality, that is, they can faithfully replicate themselves to maintain the basic characteristics of organisms; at the same time, they may mutate during reproduction. Mutated genes can also continue to replicate and pass on to offspring. Genes can not only pass genetic information to the next generation through replication, but also express genetic information on the molecular structure of proteins. Therefore, genes are the basic units that control traits. A gene has only one DNA molecule, but a DNA molecule contains multiple genes. Genes are fragments on DNA molecules that have genetic effects and determine the expression of traits.

[0025] In the present invention, the term "protein" refers to protein, which is the material basis of life, an organic macromolecule, the basic organic matter constituting cells, and the main bearer of life activities. Without protein, there is no life. Amino acids are the basic building blocks of protein. It is a substance closely associated with life and various forms of life activities.

[0026] Compared with the prior art, the beneficial effects of the present invention are: (1) The present invention discloses an S-adenosyl-L-methionine-dependent methyltransferase gene that is susceptible to potato late blight, namely StSAM-MT Gene. Using Agrobacterium-mediated transient expression and virus-induced gene silencing (VIGS) technology, we revealed StSAM-MT Genes play an important role in enhancing potato resistance to pathogenic Phytophthora, providing a theoretical basis and new technical ideas for the identification of potato blight-resistant genes, and providing resistance gene resources for potato blight-resistant breeding.

[0027] (2) The present invention providesStSAM-MT The gene was transiently overexpressed in Nicotiana benthamiana using an Agrobacterium-mediated transient expression system, confirming StSAM-MT Genes that promote infection of plants by Phytophthora infestans and reduce plant resistance to Phytophthora infestans; silenced in Nicotiana benthamiana by virus-induced gene silencing (VIGS) NbSAM-MT Gene, confirmed NbSAM-MT The gene promotes the infection of Phytophthora infestans to plants and weakens the resistance of plants to Phytophthora infestans. At the same time, the Agrobacterium-mediated potato genetic transformation system is used to stably overexpress StSAM-MT Gene, stable transformation StSAM-MT Transgenic potato plants with a gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 for StSAM-MT Gel electrophoresis of genes.

[0029] Figure 2 For transient overexpression in Nicotiana benthamiana StSAM-MT Gene resistance verification diagram. a is the leaf infection diagram; b is the statistical analysis result diagram of the lesion area; among them, GFP-GUS For comparison, GFP-StSAM-MT For overexpression StSAM-MT Gene expression vector.

[0030] Figure 3 for TRV - NbSAM - MT Gel electrophoresis of gene fragments during vector construction.

[0031] Figure 4 Nicotiana benthamiana NbSAM-MT The results of significantly inhibiting the infection of Phytophthora infestans were obtained. a is the leaf infection diagram; b is the statistical analysis result diagram of the lesion area; TRV-GFP For comparison, TRV-NbSAM-MT For silence NbSAM-MT Gene expression vector.

[0032] Figure 5 for StSAM-MT Identification diagram of transgenic plants overexpressing the gene in potato. a is the phenotypic diagram; b is the DNA identification diagram; c is the qPCR identification diagram; among them, Atlantic refers to the untransformed potato variety, GFP-StSAM-MT-OE-2 Refers to conversion GFP-StSAM-MT Transgenic potato lines containing 2 genes.

[0033] Figure 6 For StSAM-MTResistance verification diagram of transgenic plants overexpressing the gene in potato. a is the leaf infection diagram; b is the statistical analysis result diagram of the lesion area; among them, Atlantic refers to the potato variety used for genetic transformation, GFP- StSAM-MT-OE-2 Overexpression GFP-StSAM-MT Gene-expressing potato transgenic lines 2. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] The technical scheme of the present invention is described below in conjunction with the examples, but the present invention is not limited to the following examples. The experimental methods and detection methods described in each example are conventional methods unless otherwise specified; the reagents and materials are available on the market unless otherwise specified, and the % in the following examples are all mass percentages unless otherwise specified.

[0036] Example 1 This example describes the potato S-adenosyl-L-methionine-dependent methyltransferase StSAM-MT Isolation and cloning of genes.

[0037] The potato variety Atlantic was used as the material for RNA extraction. RNA extraction, potato leaf RNA was extracted using an RNA extraction kit, the integrity of RNA was identified by agarose gel electrophoresis, and then the purity and concentration of RNA were measured on a spectrophotometer. The cDNA of potato infected by Phytophthora infestans was obtained using a reverse transcription kit. Upstream and downstream primers were designed according to the full-length coding sequence of PGSC0003DMP400018799, and potato cDNA was used as a template for amplification. The reaction conditions were: 95℃ pre-denaturation, 5min; 95℃ 30 s, 58℃ 30 s, 72℃ 5 min, 30 cycles; 72℃ supplementary extension for 5 min; the amplified PCR product was connected to the pART27 vector (containing a GFP tag at the N-terminus), transformed into Escherichia coli DH5α competent cells, and positive single clones were detected. The single clones were streaked into liquid LB medium and incubated at 37℃ 220 rpm overnight culture, and the plasmid was extracted using a plasmid extraction kit (Beijing Bomade Biotechnology Co., Ltd., 79661555, DP102-01) and named GFP-StSAM-MT- pART27 Cloned potato S-adenosyl-L-methionine-dependent methyltransferase StSAM-MT Gene (abbreviated asStSAM-MT ) Figure 1 As shown, StSAM-MT The nucleotide sequence obtained by gene sequencing is shown as SEQ ID NO:2, and the amino acid sequence of the StSAM-MT protein encoded by it is shown as SEQ ID NO:1.

[0038] StSAM-MT The primer sequences of the genes are as follows: StSAM-MT kpn1F: GGGGTACCATGGCAAATTTGTTCATTAAGCAAG; StSAM-MT xba1R: GCTCTAGATCAATCCAAATTTCCAACTTTTCC.

[0039] Example 2 This example describes the overexpression of potato S-adenosyl-L-methionine-dependent methyltransferase in Nicotiana benthamiana. StSAM-MT Functional verification of genes.

[0040] according to Figure 2 As shown, this example uses Agrobacterium-mediated transient expression technology to transiently express in tobacco StSAM-MT Gene to increase the accumulation of StSAM-MT protein in plants. The specific implementation is as follows: Will GFP - StSAM-MT-pART27 The plasmid was transformed into Agrobacterium strain GV3101. A monoclonal plaque was picked up with a sterilized pipette tip in a clean bench and placed in 5 mL of liquid culture medium. The culture was shaken at 28°C and 200 rpm for 10-16 h. The bacteria were collected by centrifugation at 3000 xg for 5 min at room temperature. The prepared MES resuspension solution (200 mM acetosyringone was added and diluted 1:1000) was added to gently resuspend the bacterial pellet. The culture was placed at room temperature for 1-3 h and the OD of the bacterial solution was measured. 600 Value and dilute to prepare OD 600 =0.3 of the target bacterial solution, and selected the middle leaves of Nicotiana benthamiana that had grown for about 5 weeks. Use a 1 mL syringe to inject the target bacterial solution on the back of the leaf surface, and conduct subsequent experiments 24 hours after expression.

[0041] Then take the expression GFP - StSAM-MT After 24 hours, wash away impurities on the surface of Nicotiana benthamiana leaves, absorb excess water with filter paper, wrap the petiole with moistened absorbent cotton, place it in a white plastic plate covered with wet filter paper, inoculate about 1000 zoospores of Phytophthora infestans on the back of the leaves, cover the mouth of the plastic plate with plastic wrap, and place it in a 16℃ incubator away from light for about 5-6 days to take pictures, measure the lesions, and perform data analysis.

[0042] The results showed that Agrobacterium-mediated transient expression combined with detached leaf inoculation demonstrated the S-adenosyl-L-methionine-dependent methyltransferase StSAM-MT Genes that reduce plant resistance to late blight.

[0043] Example 3 This embodiment describes NbSAM-MT Transient gene silencing and disease resistance identification in Nicotiana benthamiana.

[0044] Through sequence alignment (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and specificity analysis, it was found that NbSAM-MT A gene fragment with high sequence specificity (nucleotide sequence as shown in SEQ ID NO:3) is constructed based on this specific gene fragment. NbSAM-MT Gene silencing vectors. NbSAM-MT The construction process of the gene silencing vector is described in Example 1. NbSAM-MT Gene-specific primers amplified NbSAM-MT The specific silencing fragment of the gene, namely SEQ ID NO: 3, was connected with the TRV vector and transformed into E. coli DH5α competent cells. A positive single clone was detected and a single clone was streaked into liquid LB medium and cultured overnight at 37°C and 220 rpm. The plasmid was extracted using a plasmid extraction kit and named TRV - NbSAM-MT (Abbreviated as TRV - SAM-MT ), the nucleotide sequence obtained by sequencing is shown in SEQ ID NO: 3. NbSAM-MT Gene gel electrophoresis gel Figure 3 shown.

[0045] NbSAM-MT The gene-specific primer sequences are as follows: TRV-NbSAM-MT Xba1F:GCTCTAGAATGGAGAGAGTCAGAAAACTG; TRV-NbSAM-MT BamH1: CGGGATCCAGGAGTAGCAATCTTGATGAAAC.

[0046] The correct sequence TRV - NbSAM-MTPlasmid transformation of Agrobacterium GV3101 strain. In the clean bench, pick up the plaque with a sterilized pipette tip and place it in 5 mL of liquid culture medium. Incubate at 28°C, 200 rpm on a shaker for 10-16 h. After taking it out, centrifuge at 3000 xg for 5 min at room temperature to collect the bacteria. Add the prepared MES resuspension solution (add 200 mM acetosyringone, dilute 1:1000) to gently resuspend the bacterial pellet, place it at room temperature for 1-3 h, and measure the OD of the bacterial solution. 600 Value and dilute to prepare OD 600 =0.3 target bacterial solution, select 2-week-old Nicotiana benthamiana for injection, and after two weeks of silence, PDS Indicator gene to determine the leaf position of silenced Nicotiana benthamiana leaves, compared with the control TRV-GFP Leaves at the same leaf position were inoculated with zoospores of Phytophthora infestans in vitro and placed in a 16°C incubator away from light for about 5-6 days. Afterwards, the leaves with different treatments were photographed, and the diameter of the leaf lesions was measured with a vernier caliper for data analysis.

[0047] Depend on Figure 4 Knowing, silence NbSAM-MT After gene TRV-GFP Compared with the control, the lesion area is significantly smaller than that of the control, indicating that the silent NbSAM-MT It can significantly inhibit the infection of Phytophthora infestans.

[0048] Example 4 This embodiment provides StSAM-MT Preparation and identification of genetically modified potato plants.

[0049] StSAM-MT Preparation of genetically modified potato plants: First, take out the GV3101 Agrobacterium strain containing the plasmid from the -80°C refrigerator, and then streak it on an LB plate containing spectinomycin (Spec), gentamicin (Gen), and rifampicin (Rif) resistance. Next, pick colonies from the plate and inoculate them into 5 mL of liquid LB containing Spec, Gen, and Rif, and culture them overnight on a horizontal shaker at 28°C at 200 rpm / min. When the OD value of the bacterial solution reaches 0.5, collect the bacterial solution and centrifuge it at a centrifugal force of 2500 xg for 10 min. Then add an equal volume of LB to the original bacterial solution to resuspend the bacteria to obtain the bacterial transformation solution. 24 h before Agrobacterium activation, use a scalpel to cut 2~5 mm potato stem segments as explants. These explants were transferred to kin medium (MS solid medium + 1 mg / L kinetin) for pre-culture (the conditions for pre-culture were 16 h of light culture at 23°C, 3000 lux of light intensity, and then 8 h of dark culture at 16°C). After pre-culture, the explants were transferred to the bacterial transformation solution and soaked for 5-10 min, and then blotted dry with sterile filter paper. Then, the explants were returned to the new R3B medium (MS solid medium + 2.0 mg / L naphthaleneacetic acid auxin + 1.0 mg / L 6-benzylaminopurine cytokinin) and sealed with sealing film to preliminarily induce the formation of callus tissue. After 48 h of culture under dark conditions, they were transferred to Zcvk medium (MS solid medium + 100 mg / L kanamycin + 200 mg / L cytomycin + 200 mg / L vancomycin hydrochloride + 1.0 mg / L trans-zeatin) to induce the differentiation of callus tissue and shoots. After half a month of cultivation, the Zcvk medium was replaced until transgenic plants were obtained ( Figure 5 Once buds are induced, they are transferred to MS30 medium (MS powder 4.43 g / L + sucrose 30 g / L + agar 8 g / L) containing kanamycin resistance for screening and identification.

[0050] StSAM-MT Identification of genetically modified potato plants: (1) PCR detection of transgenic plants Take 0.2 g of leaf tissue from the potato plant to be transformed. Grind the leaf tissue into a fine powder in a liquid nitrogen environment. Use a clean spatula to transfer the ground leaf powder to a 2 mL centrifuge tube. Add 800 μL of preheated CTAB buffer (preheated to an appropriate temperature) to the centrifuge tube. After gently mixing, place the centrifuge tube in a 65°C water bath for 30-40 min, and gently shake the tube from time to time to promote mixing. After the sample cools to room temperature, add about 640 μL of Tris-saturated phenol (pH 8.0, containing 1% volume of 2-mercaptoethanol). Invert the centrifuge tube to mix thoroughly, and then let it stand at room temperature for 10 min. Add 160 μL of chloroform, mix thoroughly again, and place the centrifuge tube on ice for 5 min. Centrifuge at 12,000 xg for 15 min at 4°C. Carefully transfer the supernatant to a new centrifuge tube (about 1 mL). Add 640 μL of isopropanol to the centrifuge tube containing the supernatant, mix gently, place the centrifuge tube in a -20°C environment, and precipitate the DNA for at least 1 hour. Then, centrifuge at 12,000 xg for 15 minutes at room temperature to recover the DNA precipitate. Wash the DNA precipitate with 80% volume fraction ethanol and centrifuge again at 12,000 ×g for 5 minutes. After discarding the supernatant, centrifuge briefly again for 10 seconds and carefully remove the remaining liquid with a pipette tip. Place the centrifuge tube in an ultra-clean workbench to dry for about 2 minutes. Dissolve the dried DNA in 20 μL of ddH 2 O. Take 1 μL of DNA solution as template and use specific primers for PCR amplification. The primers were synthesized by Beijing Aoke Company. The PCR reaction program was set as follows: 94℃ pre-denaturation for 8 min; 94℃ denaturation for 30 s, 52℃ annealing for 25 s, 72℃ extension for 30 s, and 30 cycles. The PCR reaction system included: 0.5 μg / μL DNA template 1 μL, 10×EasyTaqbuffer 2.5 μL, primers 0.5 μL each, 2 μL 2.5 mmol / L dNTPs, EasyTaq DNA polymerase 0.2μL, and ddH 2 O to a total volume of 25 μL. The expected amplicon size is approximately 795 bp. An untransformed Atlantic plant was used as a negative control ( Figure 5 (b)

[0051] Primer sequences: pKAN-F: CAATCCCACTATCCTTCGCA; StSAM-MT xba1R: GCTCTAGATCAATCCAAATTTCCAACTTTTCC.

[0052] (2) qRT-PCR detection of transgenic plants Plant total RNA extraction was performed in accordance with the instructions of the Plant RNA Kit and the reverse transcription kit (PrimeScript TM Reverse transcription was performed according to the instructions of FastStart Universal SYBR Green Master (ROX) (Cat. No. 04913914001), and the reaction and detection were performed on the Q5 real-time quantitative PCR instrument produced by Life Technologies with a 25 μL system ( Figure 5 (c).

[0053] Primer sequences: StSAM-MT qPCR F: AGTCAAGTGTAGATTTGGTAAC; StSAM-MT qPCR R:CAAATATTGCATCTACTGAGCT.

[0054] Depend on Figure 5 As can be seen from a, conversion GFP-StSAM-MT There is no significant difference in growth phenotype between potato transformants with the gene and non-transformed potatoes; Figure 5 From b, we can see that GFP-StSAM-MT-OE-2 The transformed strain is a positive transformed strain; Figure 5 From c, we can see that GFP-StSAM-MT-OE-2 Transformed strains StSAM-MT Upregulated gene expression.

[0055] Example 5 This embodiment describes the StSAM-MT Inoculation experiments on transgenic potatoes.

[0056] Take 2-month-old potato leaves, wash off floating impurities on the leaf surface, absorb excess water with filter paper, wrap the petiole with moistened absorbent cotton, place it in a white plastic plate covered with wet filter paper, inoculate about 1,000 zoospores of Phytophthora infestans on the back of the leaf, cover the plastic plate with plastic wrap, and place it in a 16°C incubator away from light for about 3-4 days. Then take photos of the leaves with different treatments, measure the diameter of the leaf lesions with a vernier caliper, and perform data analysis.

[0057] StSAM-MT Transgenic potato detached leaf inoculation demonstrated the expression of S-adenosyl-L-methionine-dependent methyltransferase genes StSAM-MT Reduce plant resistance to late blight ( Figure 6 ), Figure 6In GFP-StSAM-MT-OE-2 Abbreviated as OE-2 .

[0058] The above-described embodiments are part of the embodiments of the present invention, but not all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but rather represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. Resistance to Phytophthora infestans Phytophthora infestans A method for breeding a plant variety, characterized in that Including silence StSAM-MT genetic steps; Said StSAM-MT Gene: a1) encodes the StSAM-MT protein; and b1) having the nucleotide sequence shown in SEQ ID NO:

2.

2. The cultivation method according to claim 1, characterized in that The StSAM-MT protein has an amino acid sequence as shown in SEQ ID NO:

1.

3. The cultivation method according to claim 1, characterized in that Said StSAM-MT Genes associated with immune regulation in potato-infesting Phytophthora infestans.

4. The cultivation method according to claim 1, characterized in that Said StSAM-MT The gene plays a negative regulatory role in the immune response of potato against Phytophthora infestans.

5. The cultivation method according to claim 1, characterized in that: Overexpression StSAM-MT Gene reduces host plant resistance to Phytophthora infestans Phytophthora infestans resistance.

6. The cultivation method according to claim 1, characterized in that: Said StSAM-MT The gene has a specific gene fragment with a nucleotide sequence as shown in SEQ ID NO: 3, and silencing the specific gene fragment can enhance the host plant's resistance to Phytophthora infestans. Phytophthora infestans resistance.

7. StSAM-MT Phytophthora infestans Phytophthora infestans Application in plant variety breeding, characterized in that Said StSAM-MT Gene: a1) encodes the StSAM-MT protein; and b1) having the nucleotide sequence shown in SEQ ID NO:

2.

8. The use according to claim 7, characterized in that: include: a2) Silence StSAM-MT Nucleotide sequence of a gene that enhances host plant resistance to Phytophthora infestans Phytophthora infestans or b2) Reduce the activity and / or expression of StSAM-MT proteins to enhance the host plant's resistance to Phytophthora infestans Phytophthora infestans resistance.

Images