High-concentration malonate tolerant strain as well as construction method and application thereof

Abstract

The invention discloses a high-concentration malonate tolerant strain as well as a construction method and application thereof, and belongs to the technical field of molecular biology. The construction method of the tolerant strain comprises the following steps: integrating smatPQM, matB and mcr genes into a genome of an escherichia coli engineering strain E. coli MG1655 by virtue of a CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR associated protein 9) technology; performing gene optimization on polA in a strain genome to obtain a polA * gene; and a tolerant strain capable of tolerating high-concentration malonate is screened out. The strain can tolerate high-concentration malonate and can produce high-yield 3-hydracrylic acid at the same time. The construction method disclosed by the invention is high in universality, simple and effective, and can prevent the strain from resistance pressure; the finally obtained gene optimized strain can tolerate high-concentration malonate, and can be applied to efficient biosynthesis of 3-hydracrylic acid at the same time.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a high-concentration malonate-tolerant strain and a construction method and application thereof. Background Art

[0002] As an important intracellular intermediate metabolite of microorganisms, malonyl-CoA is a key precursor for the synthesis of a variety of high-value-added compounds such as fatty acids, flavonoids and polyketides. These products have important application value in many fields such as medicine, food, chemical industry and biofuels. Therefore, the construction of a high-yield platform strain of malonyl-CoA is crucial for the efficient and green biosynthesis of downstream derivatives. At present, the research mainly focuses on improving the ability of strains to produce downstream derivatives of malonyl-CoA through metabolic engineering strategies such as enhancing malonyl-CoA supply, reducing malonyl-CoA consumption and fine-tuning malonyl-CoA levels. However, the main malonyl-CoA synthesis pathway in model organisms such as Escherichia coli is the production of malonyl-CoA by acetyl-CoA carboxylase catalyzed by acetyl-CoA, and the synthesis of intracellular acetyl-CoA carboxylase is strictly and complexly regulated. Therefore, the supply capacity of malonyl-CoA is still insufficient, which has become one of the important limiting factors for the efficient synthesis of downstream derivatives. Malonic acid, also known as carrot acid, betaine acid or malic acid, is a C3-dicarboxylic acid. Its molecular structure contains both carboxyl and active methylene functional groups, so it can participate in various chemical reactions. It is the basic raw material for manufacturing various high-value-added chemicals and can be used as a substrate to enhance the synthesis of acetyl-CoA carboxylase-CoA and its derivatives. At the same time, malonate can act as a competitive inhibitor of succinate dehydrogenase in the tricarboxylic acid cycle, inhibiting the growth and metabolism of microbial cells, thereby limiting the further improvement of the target substance production and yield.

[0003] DNA polymerase I is an enzyme that uses parental DNA as a template to catalyze the polymerization of substrate dNTP molecules to form daughter DNA. It plays an extremely important role in DNA replication and transmission, and its characteristics are: 1) It has 5'→3' polymerase activity, which determines that DNA can only be synthesized along the 5'→3' direction; 2) DNA polymerase cannot catalyze the de novo synthesis of new DNA chains, but can only catalyze the addition of dNTP to the 3'-OH end of the nucleotide chain; 3) DNA polymerases are multifunctional enzymes that play the role of replication, proofreading, and repair at different stages of the DNA replication and repair process.

[0004] Studies have shown that after the DNA polymerase I of Escherichia coli is treated with subtilisin or trypsin, the original enzyme molecule is cut into two fragments, of which the C-terminal 605 amino acid residue fragment generated by partial hydrolysis is the Klenow fragment, which retains the 5'→3' polymerase and 3'→5' exonuclease activity of DNA polymerase I, but lacks the 5'→3' exonuclease activity of the complete enzyme, and is often used for cDNA second-strand synthesis and double-stranded DNA 3'-end labeling; another amino acid residue fragment after the DNA polymerase I (DNA-pol I) is disconnected, retains the 5'→3' exonuclease activity. Therefore, gene optimization technology can be used to construct an optimized strain that tolerates high concentrations of malonate and produces high 3-hydroxypropionic acid. Summary of the invention

[0005] The purpose of the present invention is to provide a high-concentration malonate tolerant strain and a construction method and application thereof. The present invention constructs an optimized strain that can tolerate high-concentration malonate and produce 3-hydroxypropionic acid in high yield, so as to achieve the purpose of improving the tolerance of the optimized strain and the 3-hydroxypropionic acid synthesis ability, and reducing the resistance pressure during strain growth, while filling the gap in the current method for constructing a high-concentration malonate tolerant strain.

[0006] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The present invention provides a method for constructing a high-concentration malonate-tolerant strain, which comprises the following steps: (1) Optimize separately matB、mcr、smatPQM、polA* Genes were then amplified to obtain optimized matB、mcr、 smartPQM、polA* Gene fragments; (2) Using the Escherichia coli genome as a template, amplify ilvG、efeU、lafU、polA Upstream and downstream homology arms of the gene fragment; (3) After optimization in step (1) matB、mcr、smatPQM、polA* The gene fragment and the step (2) ilvG、efeU、lafU、polA The upstream and downstream homologous arms of the gene fragment were used as templates to amplify overlapping fragments. livG- matB , Overlapping Clips efeU-mcr , Overlapping Clips lafU-smatPQM and overlapping fragments polA-polA* ; (4) Plasmid pGRB As a template, use livG、efeU、lafU、polA The gRNA primers designed for the gene fragment were amplified pGRB-gRNA Vector fragment; the amplified product is recovered, cloned, transformed and screened to obtain a plasmid pGRB- gRNA ; (5) Overlapping fragments livG-matB, Plasmid pGRB-gRNA Transform competent cells and obtain integrated strains after resistance screening ΔilvG::matB ; (6) Overlapping fragments efeU-mcr , Plasmid pGRB-gRNA Transformation and integration strains ΔilvG::matB , after resistance screening, the strains were obtained ΔilvG::matBΔefeU::mcr ; (7) Overlapping fragments lafU-smatPQM , plasmid pGRB-gRNA Transformed strains ΔilvG::matBΔefeU:: mcr , after resistance screening, the strains were obtained ΔilvG::matBΔefeU::mcrΔlafU::smatPQM ; (8) Overlapping fragments polA-polA* , Plasmid pGRB-gRNA Transformed strains ΔilvG::matBΔefeU::mcr ΔlafU::smatPQM After resistance screening, a high concentration of malonate tolerant strain was obtained. ΔilvG::matBΔefeU::mcr ΔlafU::smatPQMΔpolA::polA* .

[0007] Furthermore, the construction method comprises the following steps: (1) Optimize separately matB、mcr、smatPQM、polA* Genes were then amplified to obtain optimized matB、mcr、 smartPQM、polA* Gene fragments; (2) Escherichia coli E. coli The genome of MG1655 was used as a template to amplify (ilvG)-up、(ilvG)- down, (efeU)-up, (efeU)-down, (lafU)-up, (lafU)-down, (polA)-up, (polA)-down ; (3) After optimization in step (1) matB、mcr、smatPQM、polA* The gene fragment and the step (2) (ilvG)-up、(ilvG)-down、(efeU)-up、(efeU)-down、(lafU)-up、(lafU)-down、(polA)- up、(polA)-down As templates, overlapping fragments were amplified (livG)up -matB-(livG)down , overlapping fragments ( efeU)up – mcr- ( ifeU)down , overlapping fragments ( lafU)up -smatPQM- ( down and overlapping fragments ( polA)up - polA*- ( pollA)down ; (4) Plasmid pGRB As a template, use livG、efeU、lafU、polA The gRNA primers designed for the gene fragment were amplified pGRB-gRNA Vector fragment; the amplified product is recovered, cloned, transformed and screened to obtain the corresponding plasmid pGRB-gRNA1、pGRB-gRNA2、pGRB-gRNA3 and pGRB-gRNA4 ; (5) Overlapping fragments (livG)up -matB-(livG)down , Plasmid pGRB-gRNA1 Transform competent cells E. coli MG1655, integrated strain obtained after resistance screening E. coli MG1655ΔilvG::matB ; (6) Overlapping fragments (efeU)up – mcr-(efeU)down , Plasmid pGRB-gRNA2 Transformation and integration strains E. coli MG1655ΔilvG::matB, After resistance screening, the strains were obtained E. coli MG1655ΔilvG::matBΔ efeU::mcr ; (7) Overlapping fragments (lafU)up -smatPQM-(lafU)down , Plasmid pGRB-gRNA3 Transformed strains E. coli MG1655ΔilvG::matBΔefeU::mcr , after resistance screening, the strains were obtained E. coli MG1655ΔilvG:: matBΔefeU::mcrΔlafU::smatPQM ; (8) Overlapping fragments (polA)up - polA*-(polA)down , Plasmid pGRB-gRNA4 Transformed strains E. coli MG1655ΔilvG::matBΔefeU::mcrΔlafU::smatPQM After resistance screening, a high concentration of malonate tolerant strain was obtained. E. coli MG1655ΔilvG::matBΔefeU::mcrΔlafU::smatPQMΔpolA:: polA* .

[0008] Furthermore, the optimized matB、mcr、smatPQM、polA* The nucleotide sequences of the gene fragments are shown in SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8 respectively.

[0009] Furthermore, the sequences of the amplification primers in step (2) are shown as SEQ ID No.9 to SEQ ID No.24 respectively.

[0010] Furthermore, the overlapping segments in step (3) (livG)up -matB-(livG)down The amplification primer sequences are shown in SEQ ID No.9 and SEQ ID No.12; the overlapping fragments (efeU)up – mcr-(efeU)down The amplification primer sequences are shown in SEQ ID No.13 and SEQ ID No.16; the overlapping fragments (lafU)up -smatPQM- (lafU)down The amplification primer sequences are shown in SEQ ID No.17 and SEQ ID No.20; the overlapping fragments (polA)up - polA*-(polA)down The amplification primer sequences are shown in SEQ ID No.21 and SEQ ID No.24.

[0011] Furthermore, the sequences of the gRNA primers in step (4) are shown as SEQ ID No.33 to SEQ ID No.40 respectively.

[0012] The present invention also provides application of the tolerant strain constructed by the construction method in producing 3-hydroxypropionic acid.

[0013] Furthermore, the method for using the tolerant strain is: (1) activating the tolerant strain at 37° C.; (2) The activated tolerant strain is transferred to the fermentation medium at an inoculation rate of 1%-5%, and cultured at 37°C until the logarithmic growth phase, and then malonate is added, and the fermentation culture is continued at 37°C to obtain a fermentation broth; (3) The supernatant obtained by centrifuging the fermentation broth is ultrafiltered, and the concentration of 3-hydroxypropionic acid is determined by HPLC.

[0014] Furthermore, in the step (2), the malonate is sodium malonate, and its concentration is 300 mM to 500 mM; and the fermentation culture time after adding the malonate is 16-18 hours.

[0015] Furthermore, the formula of the fermentation medium is: K2HPO4 9.8 g / L, citric acid monohydrate 2.1 g / L, ammonium ferric citrate 0.3 g / L, beef extract 9 g / L, glucose 20 g / L, after high-pressure sterilization, cooling, adding 1 mL of 1000 times trace elements and 2 mL of magnesium sulfate storage solution, and mixing.

[0016] Furthermore, the conditions for determining the concentration of 3-hydroxypropionic acid by HPLC are: chromatographic column: Aminex HPX87 hydrogen column; mobile phase: 2.5 mM sulfuric acid; flow rate: 0.4 mL / min; column temperature: 50°C; differential detector temperature: 45°C.

[0017] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1. The present invention firstly uses genome integration technology to integrate the metabolic pathway of producing 3-hydroxypropionic acid with malonate as substrate into E. coli MG1655 was used to construct a chassis strain to achieve long-term stable gene expression and avoid the growth pressure of vector expression; then the reaction gene results were determined based on the growth of the optimized strain to verify the tolerance of the optimized strain to high concentrations of malonate; the optimized strain was cultured in shake flasks, and high-performance liquid chromatography was used to verify that the optimized strain had significantly increased 3-hydroxypropionic acid production compared to the wild-type strain.

[0018] 2. The strain construction method of the present invention includes genome integration of strain metabolic pathways, genome gene optimization, strain growth determination, shake flask fermentation culture and high performance liquid chromatography detection. By organically combining the five methods, the construction of optimized strains that tolerate high concentrations of malonate and produce high 3-hydroxypropionic acid is achieved. The method of the present invention is highly universal, simple and effective, and can effectively reduce the resistance pressure of strain growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Agarose gel electrophoresis results of gene fragments.

[0020] Figure 2 Agarose gel electrophoresis results of the integrated fragment prepared for PCR amplification.

[0021] Figure 3 This is the agarose gel electrophoresis result of colony PCR amplification.

[0022] Figure 4 OD of optimized strain and wild-type strain growth 600 Measurement results.

[0023] Figure 5 The results of 3-hydroxypropionic acid production determination of the optimized strain and the wild-type strain. DETAILED DESCRIPTION

[0024] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited by the embodiments.

[0025] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased.

[0026] Example 1: Establishment of 3-hydroxypropionic acid producing strain Through CRIPSR / Cas9 technology, genes matB、mcr、smatPQM、polA* Integration into gene ilvG、 fire, smoke, and smoke The site and integration method were carried out according to the method reported in the literature (Zhao, Zhengiang; Rao, Zhiming. Bioresource Technology, 2025, 416:131802-131802).

[0027] 1. Fragment amplification (ilvG)-up、(ilvG)-down、(efeU)-up、(efeU)-down、(lafU)-up、 (lafU)-down、(polA)-up、(polA)-down 1) E. coliThe MG1655 genome was used as a template, and the homologous sequences were amplified by in vitro polymerase chain reaction (PCR) using primers (ilvG)up-F / (ilvG)up-R, (ilvG)down-F / (ilvG)down-R, (efeU)up-F / (efeU)up-R, (efeU)down-F / (efeU)down-R, (lafU)up-F / (lafU)up-R, (lafU)down-F / (lafU)down-R, (polA)up-F / (polA)up-R, and (polA)down-F / (polA)down-R. (livG)up, (livG)down, (efeU)up、(efeU)down,(lafU)up、(lafU)down,(polA)up、(polA)down The PCR amplification system is shown in Table 1: Table 1 PCR amplification system

[0028] The PCR amplification program was as follows: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, extension at 72 °C for 19 s, 30 cycles, and final extension at 72 °C for 5 min.

[0029] The primer sequences are: (ilvG)up-F: GTGCAAGTGAAGTTGAGTTGTTCTGGCG (SEQ ID No. 9); (ilvG)up-R: AGTTAGTTCCCGTCCTGAATC (SEQ ID No. 10); (ilvG)down-F: TGCAACATCAGGTCAATGTATCGGC (SEQ ID No. 11); (ilvG)down-R:ACATCACCGACGAAGATCAG (SEQ ID No. 12); (efeU)up-F: CCTTAATGTGCCTCGCCATA (SEQ ID No. 13); (efeU)up-R: TAGCCGTCAAGCCACCCACCCTTAAACGTT (SEQ ID No. 14); (efeU)down-F: TGTAACAAATACGACGCAAACTCTTGC (SEQ ID No. 15); (efeU)down-R: TTCGATATCGCCTGCTTTAATCGCG (SEQ ID No. 16); (lafU)up-F: CCACCGCCAGCACGAACATAAT (SEQ ID No. 17); (lafU)up-R: CTGTTGACAATCAACTTTATTGTCGTCACC (SEQ ID No. 18); (lafU)down-F: AGTAAATGCTGAATCTTTACGCATTTCTC (SEQ ID No. 19); (lafU)down-R: GGCCGTTGGGTTTATTCATG (SEQ ID No. 20); (polA)up-F:TTGTCGTTAGTGGCTCGTGC (SEQ ID No. 21); (polA)up-R: GCCGTCAAATAGCCAAAGGGCCAGCCTT (SEQ ID No. 22); (polA)down-F: TGCAGTAATGATGAGCCGCTCCCGATGT (SEQ ID No. 23); (polA)down-R: CTCCGCAGCATTTCAGCTATCTG (SEQ ID No. 24).

[0030] The PCR amplification products were detected by 1% agarose gel electrophoresis, and a clear single target band was obtained. Taking (ilvG)up and (ilvG)down as examples, the band size was about 500 bp, which was consistent with the expected results ( Figure 1 ).

[0031] 2) For the source Rhodopseudomonas palustris The gene encoding malonyl-CoA synthetase ( matB ), derived from Chloroflexus aurantiacus The gene encoding malonyl-CoA reductase ( mcr ) and derived from Sinorhizobium TRAP-type transporter encoding genes (s matPQM ) were codon optimized; these genes were optimized to E. coli Preferred codons (http: / / www.jcat.de / ).

[0032] Among them, the optimized amino acid sequence of malonyl-CoA synthetase (MatB) is shown in SEQ ID No.1, and its nucleotide sequence is shown in SEQ ID No.5; the optimized amino acid sequence of malonyl-CoA reductase (Mcr) is shown in SEQ ID No.2, and its nucleotide sequence is shown in SEQ ID No.6; the amino acid sequence of TRAP-type transporter SmatPQM is shown in SEQ ID No.3, and its nucleotide sequence is shown in SEQ ID No.7; the optimized DNA polymerase I (PolA * )The amino acid sequence is shown in SEQ ID No.4, and the nucleotide sequence is shown in SEQ ID No.8. The optimized gene ( matB、mcr、 smartPQM ) Sent to Shanghai Jierui Company for chemical synthesis and connected to the pUC18 vector to form pUC18-matB, pUC18-mcr, pUC18-smatPQM Plasmid.

[0033] Plasmid pUC18-matB、pUC18-mcr、pUC18-smatPQM、E.coli The MG1655 genome was used as a template, and in vitro polymerase chain reaction (PCR) was performed using matB-F / matB-R, mcr-F / mcr-R, smatPQM-F / smatPQM-R, and polA-F / polA-R as primers to amplify the fragment. matB、mcr、smatPQM、polA* , and its PCR amplification system is shown in Table 2: Table 2 PCR amplification system

[0034] The PCR amplification program was as follows: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 54 °C for 15 s, extension at 72 °C for 47 s, amplification for 30 cycles, and final extension at 72 °C for 5 min.

[0035] The primer sequences are: matB-F: AAGGAGATGAACGCCAACCT (SEQ ID No. 25); matB-R: TTACTTGTAGATGTCCTTGTAGGTCTCGCGC (SEQ ID No. 26); mcr-F: CTAGCAAGGAGATGAGCGGAACAGGACGACT (SEQ ID No. 27); mcr-R: TTACACGGTAATCGCCCGTC (SEQ ID No. 28); smatPQM-F:TTGACGGCTAGCTCAGTCCT (SEQ ID No. 29); smatPQM-R:TTACTGCACGGTACCCAGCATC (SEQ ID No. 30); polA-F: ATGGTTCAGATCCCCCAAAATC (SEQ ID No. 31); polA-R:ACTGGGATCAGGCGCACTAA (SEQ ID No. 32).

[0036] The PCR amplification product was detected by 1% agarose gel electrophoresis to obtain a clear single target band. matB For example, the band size is about 1.5 kb, which is consistent with the expected result ( Figure 2 ).

[0037] 3) Overlapping fragment amplification The amplified (livG)up、matB、(livG)down ; (efeU)up、mcr、(efeU)down ; (lafU)up、smatPQM、(lafU)down ; (polA)up、polA*、(polA)down As templates, (ilvG)up-F / (ilvG)down-R; (efeU)up-F / (efeU)down-R; (lafU)up-F / (lafU)down-R; (polA)up-F / (polA)down-R were used as primers to perform in vitro polymerase chain reaction (PCR). (livG)up-matB- (livG)down , (efeU)up-mcr-(efeU)down , (lafU)up-smatPQM-(lafU)down , (polA)up- polA*-(polA)down The PCR amplification system is shown in Table 3: Table 3 PCR amplification system

[0038] The PCR amplification program was as follows: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 54 °C for 15 s, extension at 72 °C for 1 min 25 s, amplification for 10 cycles, adding 2 μL of each primer to the system, amplification for 30 cycles with the same PCR amplification program, and final extension at 72 °C for 5 min.

[0039] The primer sequences are: (ilvG)up-F: GTGCAAGTGAAGTTGAGTTGTTCTGGCG (SEQ ID No. 9); (ilvG)down-R:ACATCACCGACGAAGATCAG (SEQ ID No. 12); (efeU)up-F: CCTTAATGTGCCTCGCCATA (SEQ ID No. 13); (efeU)down-R: TTCGATATCGCCTGCTTTAATCGCG (SEQ ID No. 16); (lafU)up-F: CCACCGCCAGCACGAACATAAT (SEQ ID No. 17); (lafU)down-R: GGCCGTTGGGTTTATTCATG (SEQ ID No. 20); (polA)up-F:TTGTCGTTAGTGGCTCGTGC (SEQ ID No. 21); (polA)down-R: CTCCGCAGCATTTCAGCTATCTG (SEQ ID No. 24).

[0040] The PCR amplification product was detected by 1% agarose gel electrophoresis to obtain a clear single target band. (livG)up-matB-(livG)down For example, the size is about 2.5 kb, which is consistent with the expected result.

[0041] 4) Product recovery The PCR product was purified using a gel recovery purification kit (manufacturer Vazyme, catalog number DC301-01), and the steps were referred to the instruction manual.

[0042] 2. Plasmid construction 1) Fragment amplification Gene livG、efeU、lafU、polA gRNA primer design (https: / / chopchop.cbu.uib.no / ) and plasmid pGRB As templates, pg1-F / pg1-R, pg2-F / pg2-R, pg3-F / pg3-R, pg4-F / pg4-R were used as primers to perform in vitro polymerase chain reaction (PCR) to amplify the vector fragment. pGRB- gRNA , and its PCR amplification system is shown in Table 4: Table 4 PCR amplification system

[0043] The PCR amplification program was as follows: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 54 °C for 15 s, extension at 72 °C for 2 min, 30 cycles, and final extension at 72 °C for 5 min.

[0044] The primer sequences are: pg1-F:CCCCGGTGATGACTATCAACGTTTTAGAGCTAGAAATAGC (SEQ ID No. 33); pg1-R: GTTGATAGTCATCACCGGGGACTAGTATTATACCTAGGAC (SEQ ID No. 34); pg2-F: GGCGGTATTCGCCTCAATCTGTTTTAGAGCTAGAAATAGC (SEQ ID No. 35); pg2-R: AGATTGAGGCGAATACCGCCACTAGTATTATACCTAGGAC (SEQ ID No. 36); pg3-F: AAGAAATCCGCCACCGAGCTGTTTTAGAGCTAGAAATAGC (SEQ ID No. 37); pg3-R: AGCTCGGTGGCGGATTTCTTACTAGTATTATACCTAGGAC (SEQ ID No. 38); pg4-F: ACCATGACGAATACCATCCTGTTTTAGAGCTAGAAATAGC (SEQ ID No. 39); pg4-R: AGGATGGTATTCGTCATGGTACTAGTATTATACCTAGGAC (SEQ ID No. 40).

[0045] 2) Product recovery The PCR product was purified using a gel recovery purification kit (manufacturer Vazyme, catalog number DC301-01), and the steps were referred to the instruction manual.

[0046] 3) Plasmid construction Use seamless cloning kit (Vazyme, catalog number C112-01) to clone pGRB-gRNA1、pGRB-gRNA2、 pGRB-gRNA3、pGRB-gRNA4 Linearize the vector and perform fragment fusion. Please refer to the instructions for the steps.

[0047] 4) Seamless cloning product transformation First, take out the competent medium from -80 ℃, place it on an ice box to melt naturally, and handle it with care. Add the fusion product to the competent medium in a sterile operating table and place it on ice for 30 min. After that, heat shock it in a 42℃ water bath for 1 min 30 s and place it on ice for 2 min. Add 500 μL LB medium to the sterile operating table and culture it in a 37℃ shaker for 1 h. Centrifuge at 6000 rpm for 2 min, aspirate 600 μL of supernatant, and leave about 100 μL in the tube. Suspend the suspended bacteria. Spread the bacterial solution on a kanamycin-resistant LB plate and seal it. Invert it in a 37℃ incubator and culture it for 12 h-16 h.

[0048] 5) Screening of positive clones Positive clones were screened by colony PCR, and the PCR amplification products were detected by 1% agarose gel electrophoresis, and clear single target bands were obtained, with a size of approximately 3.1 kb, which was consistent with the expected results ( Figure 3 ).

[0049] Extract plasmids from positive clones pGRB-gRNA1、pGRB-gRNA2、pGRB-gRNA3、pGRB-gRNA4 , and sent the plasmid to Qingke Sequencing Company for sequencing identification.

[0050] 3. Preparation of competent cells for electroporation 1) Streaking strains E. coli MG1655 (engineered strain E. coli MG1655 was purchased from Beijing Qingke Biotechnology Co., Ltd., catalog number: DLC121, purchase time: June 2024), pick a single colony and activate it overnight; 2) Transfer the overnight activated strain to 50 mL liquid culture medium and grow to 0D 600 = 0.4, ice bath for 10 min, 4°C, 6000 rpm, centrifuge for 5 min, remove the culture medium, and resuspend the bacteria in 10% glycerol to prepare electroporation competent cells.

[0051] 4. Strain construction Take fragment (livG)up-matB-(livG)down 300 ng, plasmid pGRB-gRNA1 200 ng was added to the competent cells, washed and mixed, set to 1800 V for two times of electroporation, added 800 μL of liquid culture medium for 2 h of recovery, coated with spectinomycin and ampicillin double resistance plates, and inverted at 30°C. Positive strains were verified by colony PCR. The positive strains were cultured without resistance for 15 h, the bacterial solution was diluted and coated, and single colonies were picked and streaked on spectinomycin resistance plates, ampicillin resistance plates and non-resistance plates one by one, and then the genome integration strains that lost the CRISPR / Cas9 system were screened out to obtain the strains. E. coli MG1655 ΔilvG::matB .

[0052] Prepare electrocompetent cells according to the above genomic integration method E. coli MG1655 ΔilvG::matB, Take the fragment ( efeU)up – mcr- ( ifeU)down 300 ng, plasmid pGRB-gRNA2 200 ng construct strain E. coli MG1655 ΔilvG::matBΔefeU::mcr ; Preparation of electrocompetent cells E. coli MG1655 ΔilvG::matBΔefeU::mcr , take the fragment ( (lafU) up -smatPQM- ( down 300 ng, plasmid pGRB-gRNA3 200 ng construct strain E. coli MG1655 Δ ilvG::matBΔefeU::mcrΔlafU::smatPQM ; Preparation of electrocompetent cells E. coli MG1655 ΔilvG::matBΔefeU::mcrΔlafU:: smartPQM , take the fragment ( polA)up - polA*- ( pollA)down 300 ng, plasmid pGRB-gRNA4 200 ng construct strain E. coli MG1655 ΔilvG::matBΔefeU::mcrΔlafU::smatPQMΔpolA::polA* ; Finally, the optimized strain was obtained E. coli MG1655 ΔilvG::matBΔefeU::mcrΔlafU::smatPQM ΔpolA::polA* .

[0053] Example 2: Growth assay of optimized strains tolerant to high concentrations of malonate The optimized strain was tested for tolerance to high concentration of malonate by growth assay of optimized strain.

[0054] 1. Pick a single colony of the optimized strain obtained in Example 1, inoculate it into LB liquid culture medium, and activate it overnight at 37°C shaking in a 200 rpm incubator; 2. Transfer the optimized strain activated overnight to M9 medium at a 1% inoculation rate and culture at 37°C in a shaker at 200 rpm until OD 600 = 0.6 ~ 0.8; add 400 mM sodium malonate, 37°C, 200 rpm to measure the growth of the optimized strain; 3. Growth assay results ( Figure 4 ) showed that the constructed optimized strain had the same stress-free growth as the wild-type strain in a high-concentration malonate environment, indicating that the optimized strain achieved tolerance to high-concentration malonate.

[0055] Example 3: Application of optimized strains in 3-hydroxypropionic acid biosynthesis 1. Streak the optimized strain obtained in Example 1 onto an LB plate without antibiotics and culture it upside down at 37°C; 2. Pick a single bacterium from the streaked plate and inoculate it into LB liquid culture medium. Set up 3 biological parallels for each strain and activate it overnight at 37°C in a shaker at 200 rpm.

[0056] 3. Prepare fermentation medium: K2HPO4, 9.8 g / L, citric acid monohydrate, 2.1 g / L, ammonium ferric citrate, 0.3 g / L, beef extract, 9 g / L, glucose, 20 g / L, 115℃, autoclave for 20 min; after cooling, add 1 mL of trace elements (1000 times) and 2 mL of magnesium sulfate storage solution.

[0057] Among them, trace elements (1000 times): (NH4)6Mo7O 24 •4H2O, 0.37 g, ZnSO4•7H2O, 0.29 g, H3BO4, 2.47 g, CuSO4•5H2O, 0.25 g, MnCl2•4H2O, 1.58 g, make up to 100 mL with distilled water, and filter to sterilize.

[0058] Magnesium sulfate stock solution (246 g / L): Dissolve 24.6 g magnesium sulfate heptahydrate in ddH2O and make up to 100 mL, then sterilize by high pressure steam at 121°C.

[0059] 4. Transfer the overnight activated strain to the fermentation medium at a 1% inoculation rate and culture in a shaker at 37°C and 200 rpm until the OD 600 = 0.6 ~ 0.8.

[0060] 5. Fermentation: Add 400 mM sodium malonate and ferment in a shake flask at 37°C and 200 rpm for 16 h.

[0061] 6. HPLC determination: Take the fermentation broth to a 2 mL centrifuge tube, centrifuge at 10,000 rpm for 5 min, filter the supernatant through a 0.22 μm filter membrane into a 2 mL chromatographic vial for high performance liquid chromatography determination of 3-hydroxypropionic acid concentration. Set the HPLC detection conditions as follows: Chromatographic column: Aminex HPX87 hydrogen column. Mobile phase: 2.5 mM sulfuric acid. Flow rate: 0.4 mL / min. Column temperature: 50 °C. Differential detector temperature: 45 °C.

[0062] 7. Through growth assay and fermentation experiments, a positive strain that tolerates high concentrations of malonate and produces high 3-HP was obtained. Its 3-HP production increased by 4.75 times compared with the wild type, and the growth of the optimized strain reached the normal growth state of the wild type without stress under high concentrations of malonate ( Figure 4 and Figure 5 ).

[0063] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A method for constructing a high concentration malonate tolerant strain, characterized in that: The following steps are involved: (1) Optimize separately matB, mcr, smatPQM, polA Genes were then amplified to obtain optimized matB、mcr、 smatPQM, polA* Gene fragments; (2) Using the Escherichia coli genome as a template, amplify ilvG, efeU, lafU, polA Upstream and downstream homology arms of the gene fragment; (3) After optimization in step (1) matB, mcr, smatPQM, polA* The gene fragment and the step (2) ilvG, efeU, lafU, polA The upstream and downstream homologous arms of the gene fragment were used as templates to amplify overlapping fragments. livG- matB , Overlapping Clips efeU-mcr , Overlapping Clips lafU-smatPQM and overlapping fragments polA-polA* ; (4) Plasmid pGRB As a template, use livG, efeU, lafU, polA The gRNA primers designed for the gene fragment were amplified pGRB-gRNA Vector fragment; the amplified product is recovered, cloned, transformed and screened to obtain the corresponding plasmid pGRB-gRNA1, pGRB-gRNA2, pGRB-gRNA3 and pGRB-gRNA4 ; (5) Overlapping fragments livG-matB , plasmid pGRB-gRNA1 Transform competent cells and obtain integrated strains after resistance screening ΔilvG::matB ; (6) Overlapping fragments efeU-mcr , plasmid pGRB-gRNA2 Transformation and integration strains ΔilvG::matB , after resistance screening, the strains were obtained ΔilvG::matBΔefeU::mcr ; (7) Overlapping fragments lafU-smatPQM , Plasmid pGRB-gRNA3 Transformed strains ΔilvG::matBΔefeU::mcr , after resistance screening, the strains were obtained ΔilvG::matBΔefeU::mcrΔlafU::smatPQM ; (8) Overlapping fragments polA-polA* , plasmid pGRB-gRNA4 Transformed strains ΔilvG::matBΔefeU::mcrΔ lafU::smatPQM After resistance screening, a high concentration of malonate tolerant strain was obtained. ΔilvG::matBΔefeU::mcrΔ lafU::smatPQMΔpolA::polA* .

2. The construction method according to claim 1, characterized in that: After optimization in step (1) matB、mcr、 smatPQM, polA* The nucleotide sequences of the gene fragments are shown in SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8 respectively.

3. The construction method according to claim 1, characterized in that: The overlapping segments in step (3) livG-matB The amplification primer sequences are shown in SEQ ID No.9 and SEQ ID No.12; the overlapping fragments efeU-mcr The amplification primer sequences are shown in SEQ ID No.13 and SEQ ID No.16; the overlapping fragments lafU-smatPQM The amplification primer sequences are shown in SEQ ID No.17 and SEQ ID No.20; the overlapping fragments polA-polA* The amplification primer sequences are shown as SEQ ID No.21 and SEQ ID No.

24.

4. The construction method according to claim 1, characterized in that: The sequences of the gRNA primers in step (4) are shown in SEQ ID No.33 to SEQ ID No.40 respectively.

5. Use of the tolerant strain constructed by the construction method according to any one of claims 1 to 4 in the production of 3-hydroxypropionic acid.

6. The use according to claim 5, characterized in that: The method for using the tolerant strain is as follows: (1) activating the tolerant strain at 37° C.; (2) The activated tolerant strain is transferred to the fermentation medium at an inoculation rate of 1%-5%, and cultured at 37°C until the logarithmic growth phase, and then malonate is added, and the fermentation culture is continued at 37°C to obtain a fermentation broth; (3) The supernatant obtained by centrifuging the fermentation broth is ultrafiltered, and the concentration of 3-hydroxypropionic acid is determined by HPLC.

7. The use according to claim 6, characterized in that: In the step (2), the malonate is sodium malonate, and its concentration is 300 mM to 500 mM; and the fermentation culture time after adding the malonate is 16 to 18 hours.

8. The use according to claim 6, characterized in that: The formula of the fermentation medium in step (2) is: 9.8 g / L K2HPO4, 2.1 g / L citric acid monohydrate, 0.3 g / L ammonium ferric citrate, 9 g / L beef extract, and 20 g / L glucose. After high-pressure sterilization, cool it, add 1 mL of 1000-fold trace elements and 2 mL of magnesium sulfate storage solution, and mix well.

9. The use according to claim 6, characterized in that: The conditions for the HPLC determination of the concentration of 3-hydroxypropionic acid are: chromatographic column: Aminex HPX87 hydrogen column; mobile phase: 2.5 mM sulfuric acid; flow rate: 0.4 mL / min; column temperature: 50°C; differential detector temperature: 45°C.

Images