Application of ZmPHR1 protein and coding gene thereof in regulation and control of plant drought resistance

Abstract

The invention discloses application of a ZmPHR1 protein and a coding gene thereof in regulation and control of plant drought resistance. Detection on drought resistance of a ZmPHR1 overexpression corn strain and a zmphr1 mutant shows that the leaf water content of the ZmPHR1 overexpression corn strain under a drought condition is remarkably higher than that of a wild type, and meanwhile, the leaf wilting degree, the transpiration rate, the stomatal conductance and the stomatal opening are remarkably reduced; the transpiration rate, the stomatal conductance and the stomatal opening degree of the zmphr1 mutant are obviously higher than those of the wild type. It is found for the first time that the corn ZmPHR1 protein can positively regulate the drought resistance of plants, and the drought resistance of the plants can be effectively improved by increasing the expression quantity of the ZmPHR1 gene. The discovery of the drought-resistant function of the ZmPHR1 not only provides a new gene target and a new resource for cultivating new varieties of drought-resistant plants, but also provides a theoretical basis for illuminating a molecular mechanism of drought stress signal response of the plants.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to application of ZmPHR1 protein and its encoding gene in regulating plant drought resistance. Background Art

[0002] Drought is the main abiotic stress that affects crop yield and quality, and is one of the main challenges facing global agricultural production. Water stress inhibits crop vegetative and reproductive growth, resulting in shorter plant height, wilting leaves, reduced photosynthesis, decreased organic matter accumulation and fruit set rate, and incomplete seeds or fruits, which seriously affects crop yield and quality. Corn is one of the three major food crops in the world, with a wide planting area. It originated in humid and hot tropical regions and is not drought-resistant. Corn requires a large amount of water supply during its growth and development. Drought stress affects all aspects of corn growth and development and is the most important environmental factor causing corn production reduction. In addition, drought stress also seriously reduces the quality of corn kernels.

[0003] Corn is the largest grain variety in my country, accounting for 42% of the grain planting area. It is planted all over China, especially in Northeast China, North China and Southwest China. Breeding new drought-resistant varieties can effectively cope with yield losses caused by drought stress and improve water use efficiency. How to use new technologies and methods to improve the drought resistance of corn through genetic modification of important genes and ultimately obtain new stress-resistant varieties is one of the common goals of modern basic biology and agricultural breeding. Overexpression and mutation of important genes through genetic engineering is an important part of modern molecular breeding. In crops, the common method is to overexpress one or several genes involved in important physiological processes, or to mutate genes through gene editing technologies such as CRISPR / Cas9 to obtain new stress-resistant varieties. Summary of the invention

[0004] The problem to be solved by the present invention is how to regulate the drought resistance of plants and cultivate drought-resistant plant varieties.

[0005] In order to solve the above technical problems, the present invention first provides a new use of ZmPHR1 protein or biomaterials related to ZmPHR1 protein.

[0006] The present invention provides the use of ZmPHR1 protein or biomaterials related to ZmPHR1 protein in any of the following S1)-S6):

[0007] S1) Regulates plant drought resistance;

[0008] S2) regulating the transpiration rate and / or stomatal conductance of plant leaves;

[0009] S3) regulating the stomatal aperture of plant leaves;

[0010] S4) regulates the movement of stomatal pores in plant leaves;

[0011] S5) application in cultivating transgenic plants with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture;

[0012] S6) Plant genetic breeding or plant germplasm improvement;

[0013] The ZmPHR1 protein is a1) or a2) or a3) or a4):

[0014] a1) the amino acid sequence is the protein shown in SEQ ID NO: 3;

[0015] a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3;

[0016] a3) a protein related to plant drought resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3;

[0017] a4) a protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 3, derived from corn and associated with plant drought resistance;

[0018] The biological material is any one of the following A1) to A8):

[0019] A1) a nucleic acid molecule encoding a ZmPHR1 protein;

[0020] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0021] A3) a recombinant vector containing the nucleic acid molecule described in A1);

[0022] A4) a recombinant vector containing the expression cassette described in A2);

[0023] A5) a recombinant microorganism containing the nucleic acid molecule described in A1);

[0024] A6) a recombinant microorganism containing the expression cassette described in A2);

[0025] A7) a recombinant microorganism containing the recombinant vector described in A3);

[0026] A8) A recombinant microorganism containing the recombinant vector described in A4).

[0027] In the protein described in a2) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a MYC tag, a GST tag and / or a SUMO tag, etc.

[0028] In the protein described in a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0029] In the protein described in a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively and searching 1, the identity of the amino acid sequence is calculated, and then the value of the identity (%) can be obtained. The identity includes amino acid sequences having 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more homology with the amino acid sequence shown in Sequence 4 of the present invention.

[0030] The protein described in a1) or a2) or a3) or a4) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0031] In the above A1), the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0032] The nucleic acid molecule may specifically be the gene shown in B1) or B2) or B3) below:

[0033] B1) DNA molecule shown in sequence 1;

[0034] B2) DNA molecule shown in sequence 2;

[0035] B3) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in B1) or B2) and encodes the ZmPHR1 protein.

[0036] Those skilled in the art can easily mutate the nucleotide sequence encoding the ZmPHR1 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides with 75% or higher identity to the nucleotide sequence encoding the ZmPHR1 protein are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the ZmPHR1 protein and have the same function.

[0037] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 3 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0038] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0039] In the above A2), the expression cassette (ZmPHR1 gene expression cassette) refers to a DNA capable of expressing the ZmPHR1 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of ZmPHR1, but also a terminator for terminating transcription of ZmPHR1. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters; tissue, organ and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and nopaline and octopine synthase terminators.

[0040] In A3) and A4), the vector may be a plasmid, a clay, a phage or a viral vector. The recombinant vector may be a vector containing the nucleic acid molecule or the expression cassette obtained by constructing an existing plant expression vector. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb. The plant expression vector may also contain the 3′ non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as the non-translated region transcribed at the 3' end of the Agrobacterium crown gall induction (Ti) plasmid gene (such as the nopaline synthase gene Nos) and the plant gene (such as the soybean storage protein gene) all have similar functions. When using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene that confers resistance to kanamycin and related antibiotics, bar gene that confers resistance to the herbicide phosphinothricin, hph gene that confers resistance to the antibiotic hygromycin, dhfr gene that confers resistance to methotrexate, EPSPS gene that confers resistance to glyphosate) or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and transformed plants can be directly screened by adversity.

[0041] In the above A5)-A8), the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium. The recombinant microorganism may be a microorganism containing the above nucleic acid molecule or the above expression cassette or the above recombinant vector.

[0042] The regulation of plant drought resistance described in S1) above is to improve plant drought resistance, which is specifically manifested in that the higher the ZmPHR1 protein content and / or activity in the plant or the higher the ZmPHR1 gene expression level, the better the growth and development of the plant under drought conditions, the lower the degree of leaf wilting, the higher the leaf water content, and the higher the survival rate.

[0043] The regulating the transpiration rate of plant leaves in S2) is to reduce the transpiration rate of plant leaves; the regulating the stomatal conductance of plant leaves is to reduce the stomatal conductance of plant leaves.

[0044] The regulating of the stomatal aperture of plant leaves in S3) is to reduce the stomatal aperture of plant leaves.

[0045] The regulating of plant leaf stomatal movement in S4) is to inhibit the opening of plant leaf stomatals or promote the closing of plant leaf stomatals.

[0046] The purpose of the plant genetic breeding or plant germplasm resource improvement described in S6) is to cultivate drought-resistant plant varieties.

[0047] In order to solve the above technical problems, the present invention provides a new use of a substance that inhibits ZmPHR1 protein;

[0048] The present invention provides the use of a substance that inhibits ZmPHR1 protein in any of the following T1)-T6):

[0049] T1) Reduce plant drought resistance;

[0050] T2) increasing the transpiration rate and / or stomatal conductance of plant leaves;

[0051] T3) Increase the stomatal aperture of plant leaves;

[0052] T4) Promote the movement of stomatal pores in plant leaves;

[0053] T5) application in cultivating transgenic plants with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture;

[0054] T6) Plant genetic breeding or plant germplasm improvement.

[0055] The purpose of the plant genetic breeding or plant germplasm resource improvement described in T6) above is to cultivate transgenic plants with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture.

[0056] Furthermore, the substance that inhibits the ZmPHR1 protein may be a substance that inhibits the activity of the ZmPHR1 protein, or a substance that inhibits the expression of a gene encoding the ZmPHR1 protein, or a substance that knocks out a gene encoding the ZmPHR1 protein.

[0057] The substance inhibiting the activity of ZmPHR1 protein can be any substance capable of causing the loss of ZmPHR1 protein activity in plants, such as proteins, polypeptides or small molecule compounds (such as protein activity inhibitors) that inhibit the synthesis of ZmPHR1 protein, promote the degradation of ZmPHR1 protein or inhibit the function of ZmPHR1 protein.

[0058] The substance that inhibits the expression of the gene encoding the ZmPHR1 protein can be any substance that can prevent the gene encoding the ZmPHR1 protein in plants from being expressed, such as a substance that silences the gene encoding the ZmPHR1 protein in plants (such as miRNA, siRNA, dsRNA, shRNA, etc.).

[0059] The substance for knocking out the gene encoding ZmPHR1 protein can be a substance that achieves the host cell not producing the functional protein product of the ZmPHR1 gene in any way, such as removing all or part of the coding gene sequence, introducing a frameshift mutation so that no functional protein is produced, removing or changing the regulatory component (such as promoter editing) so that the coding gene sequence is not transcribed, and preventing translation by binding to mRNA. Usually, the knockout is performed at the genomic DNA level, so that the offspring of the cell also permanently carry the knockout. Further, the substance for knocking out the gene encoding ZmPHR1 protein can be any substance that can cause the gene encoding ZmPHR1 protein in the plant to mutate (the mutation form can be a deletion mutation and / or an insertion mutation and / or a base substitution) so as to lose activity, such as a zinc finger protein ZFN gene editing system or a TALENs gene editing system or a CRISPR / Cas9 gene editing system.

[0060] Furthermore, the substance for knocking out the gene encoding the ZmPHR1 protein is a vector for knocking out the gene encoding the ZmPHR1 protein.

[0061] In order to solve the above technical problems, the present invention also provides a method for cultivating transgenic plants with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture.

[0062] The method for cultivating transgenic plants with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture provided by the present invention comprises the following steps: increasing the content and / or activity of ZmPHR1 protein in a recipient plant to obtain a transgenic plant; the drought resistance of the transgenic plant is higher than that of the recipient plant, and the transpiration rate and / or stomatal conductance and / or stomatal aperture are lower than those of the recipient plant.

[0063] Furthermore, the method for increasing the content and / or activity of the ZmPHR1 protein in the recipient plant is to overexpress the ZmPHR1 protein in the recipient plant.

[0064] The drought resistance of the transgenic plant is higher than that of the recipient plant, which is specifically embodied in any one of the following X1)-X4):

[0065] X1) under drought conditions, the transgenic plant grows better than the recipient plant;

[0066] X2) under drought conditions, the degree of leaf wilting of the transgenic plant is lower than that of the recipient plant;

[0067] X3) under drought conditions, the water content of leaves of the transgenic plant is higher than that of the recipient plant;

[0068] X4) Under drought conditions, the survival rate of the transgenic plants is higher than that of the recipient plants.

[0069] Furthermore, the overexpression method is to introduce the gene encoding the ZmPHR1 protein into the recipient plant.

[0070] In order to solve the above technical problems, the present invention finally provides a method for cultivating transgenic plants with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture.

[0071] The method for cultivating transgenic plants with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture provided by the present invention comprises the following steps: reducing the content and / or activity of ZmPHR1 protein in a recipient plant to obtain a transgenic plant; the drought resistance of the transgenic plant is lower than that of the recipient plant, and the transpiration rate and / or stomatal conductance and / or stomatal aperture are higher than that of the recipient plant.

[0072] Furthermore, the method for reducing the content and / or activity of ZmPHR1 protein in the recipient plant is to introduce the above-mentioned substance that inhibits the activity of ZmPHR1 protein or the substance that inhibits the expression of the gene encoding ZmPHR1 protein or the substance that knocks out the gene encoding ZmPHR1 protein into the recipient plant.

[0073] Furthermore, the substance for knocking out the gene encoding the ZmPHR1 protein is a vector for knocking out the gene encoding the ZmPHR1 protein.

[0074] In any of the above-mentioned applications or methods, the transgenic plants are understood to include not only the first generation transgenic plants obtained by transforming the ZmPHR1 gene into a recipient plant, but also its progeny. For transgenic plants, the gene can be propagated in the species, or the gene can be transferred into other varieties of the same species, especially commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, complete plants and cells.

[0075] In any of the above applications or methods, the plant may be a dicotyledon or a monocotyledon, including but not limited to corn, rice, wheat, cotton or soybean. Preferably, the monocotyledon is a grass plant. More preferably, the grass plant is corn.

[0076] The present invention detects the drought resistance of ZmPHR1 overexpression corn strains and zmphr1 mutants and finds that under normal watering, the growth of the ZmPHR1 overexpression corn strains is similar to that of the wild type, with no significant difference; under drought conditions, the growth of the ZmPHR1 overexpression corn strains is significantly better than that of the wild type, the leaf water content is significantly higher than that of the wild type (increased by 38%-62%), and the leaf wilting degree, transpiration rate (reduced by 28.57%), stomatal conductance (reduced by 32.21%) and stomatal aperture (reduced by 15.87%) are all significantly reduced; especially in the presence of ABA, the stomatal aperture of the ZmPHR1 overexpression corn strains is reduced by 42.42% compared with that of the wild type corn plants, while the transpiration rate, stomatal conductance and stomatal aperture of the zmphr1 mutant are significantly higher than those of the wild type. This indicates that the ZmPHR1 protein can positively regulate plant drought resistance and can regulate corn resistance to drought stress through the ABA signaling pathway. By increasing the expression of the ZmPHR1 gene, the water loss of plants can be effectively reduced and the drought resistance of plants can be improved. Compared with traditional breeding methods, the method for breeding drought-resistant plants provided by the present invention has the advantages of short breeding time and strong purpose, which significantly shortens the breeding cycle and improves breeding efficiency. The discovery of the drought-resistant function of ZmPHR1 not only provides new gene targets and resources for breeding new varieties of drought-resistant plants, but also provides a theoretical basis for clarifying the molecular mechanism of plant drought stress signal response. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 The present invention relates to detection of ZmPHR1 gene expression in the ZmPHR1 overexpression strain in Example 2 (a) and sequencing detection of mutation positions and mutation sequences of ZmPHR1 knockout mutants zmphr1-1 and zmphr1-2 (b); wherein WT represents wild-type corn plants, OE1, OE2 and OE3 represent ZmPHR1 overexpression strains, and zmphr1-1 and zmphr1-2 represent knockout mutants of ZmPHR1 edited by CRISPR / Cas9 method.

[0078] Figure 2 The plant growth conditions of the ZmPHR1 overexpressing corn lines in Example 3 of the present invention after normal watering and drought treatment; wherein WT represents wild-type corn plants, and the ZmPHR1 overexpressing lines are OE1, OE2 and OE3 respectively.

[0079] Figure 3The results of leaf water content measurement of ZmPHR1 overexpressing maize lines in Example 3 of the present invention are shown in Table 3; WT represents wild-type maize plants, and ZmPHR1 overexpressing lines are OE1, OE2 and OE3, respectively. Statistical analysis was performed using the ANOV analysis method, and capital letters indicate P<0.01.

[0080] Figure 4 The plant growth conditions of the ZmPHR1 overexpressing corn lines in Example 3 of the present invention when watering was restored after normal watering and drought treatment; wherein WT represents wild-type corn plants, and the ZmPHR1 overexpressing lines are OE1, OE2 and OE3 respectively.

[0081] Figure 5 The results of transpiration rate and stomatal conductance measurement of ZmPHR1 overexpressing corn strains in Example 4 of the present invention; wherein (a) is transpiration rate, (b) is stomatal conductance; WT represents wild-type corn plants, ZmPHR1-OE1 and ZmPHR1-OE2 represent ZmPHR1 gene overexpressing corn strains, and zmphr1-1 and zmphr1-2 represent knockout mutants of ZmPHR1 gene edited by CRISPR / Cas9 method. Statistical analysis was performed using ANOV analysis method, and capital letters indicate P<0.01.

[0082] Figure 6 The phenotype and measurement results of stomatal density and stomatal aperture of ZmPHR1 overexpressing corn strains in Example 5 of the present invention; wherein, (a) is stomatal density, (b) is a photo of corn stomatal aperture, and (c) is stomatal aperture; WT represents wild-type corn plants, ZmPHR1-OE1 and ZmPHR1-OE2 represent ZmPHR1 gene overexpressing corn strains, and zmphr1-1 and zmphr1-2 represent knockout mutants of ZmPHR1 gene editing by CRISPR / Cas9 method. Statistical analysis adopted ANOV analysis method, lowercase letters represent P<0.05, and uppercase letters represent P<0.01. DETAILED DESCRIPTION

[0083] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0084] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0085] The maize inbred line B73 involved in the following examples is described in the document “Wei et al. The Physical and Genetic Framework of the Maize B73 Genome. PLoS Genetics 2009, 5: e1000715.” (named Maize B73 in the document).

[0086] The pBCXUN vector in the following example is a vector obtained by replacing the hygromycin resistance gene hptII (corresponding to the 9925-10950 position of the sequence shown in FJ905215.1 in GenBank) in the commercial vector pCXUN (the nucleotide sequence of the vector is shown in GenBank as FJ905215.1, 06-JUL-2009) with the herbicide resistance gene bar (encoding phosphinothricin acetyltransferase, the nucleotide sequence of the gene is shown in GenBank as AYD60114.1, 02-OCT-2018). The pBCXUN vector contains the Ubi promoter of the maize ubiquitin gene, which can be used to drive the transcription of downstream overexpressed genes.

[0087] The Agrobacterium strain EHA105 involved in the following examples is described in the document “Nyaboga et al. Agrobacterium-mediated genetic transformation of yam (Dioscorea arotundata): an important tool for functional study of genes and crop improvement. Frontiers in Plant Science 2014, 5: 463.”

[0088] The main reagents involved in the following embodiments and their sources are as follows: restriction endonucleases, DNA polymerases, and T4 ligases from biological companies such as NEB and Toyobo; reverse transcription kits from Thermo; RNA extraction kits from Magen; quantitative PCR reagents from Taraka; plasmid extraction kits and DNA recovery kits from Tiangen; MS culture medium, agar powder, agarose, ampicillin, kanamycin, gentamicin sulfate, and rifampicin from Sigma; various other chemical reagents are all imported or domestic analytical grade reagents.

[0089] The primer synthesis and sequencing involved in the following examples were completed by Yingjun Company.

[0090] The pore conductance in the following embodiments refers to the ability of gas (including water vapor) to diffuse through the pores, which can be expressed by measuring the size of the pore diameter or measuring the gas loss rate of water vapor.

[0091] The pore opening in the following embodiments refers to the size of the pore diameter. The pore opening can affect the pore conductivity. The larger the pore opening, the greater the pore conductivity.

[0092] The stomatal movement in the following embodiments refers to the opening or closing of the stoma, and the opening and closing of the stoma directly affect the stomatal conductance.

[0093] Example 1. Construction and detection of ZmPHR1 gene overexpression vector and CRISPR-Cas9 knockout vector

[0094] 1. Construction of ZmPHR1 gene overexpression vector

[0095] First, total RNA was extracted from corn (Zea mays L.), and cDNA was obtained by reverse transcription. Then, the ZmPHR1 gene was amplified using cDNA as a template and F and R as primers (primers with restriction sites). Finally, the amplified product was digested and connected to the overexpression vector to obtain the ZmPHR1 gene overexpression vector. The specific construction method is as follows:

[0096] 1. Use the RNA extraction kit of Magen to extract total RNA from maize inbred line B73. Refer to the instructions of the kit for specific steps.

[0097] 2. Use Thermo's reverse transcription kit to reverse transcribe RNA into cDNA. For specific steps, refer to the kit instructions.

[0098] 3. Using cDNA as template and F and R as primers, PCR amplification was performed to obtain PCR amplification product (ZmPHR1 gene cDNA), and the PCR amplification product was recovered by gel electrophoresis. The recovery method was referred to the kit of Tiangen Company. The PCR amplification product was supplemented with A at the blunt end using Taq enzyme to obtain a PCR amplification product with A sticky ends.

[0099] The primer sequences used for ZmPHR1 gene amplification are as follows:

[0100] F:tataagcttATGAGGAACTTTAATCTGATGCAGT;

[0101] R: gctctagaTTAACTATCTTGCAGTTTGCGC.

[0102] 4. Use restriction endonuclease XcmI (NEB) to digest vector pBCXUN to obtain linearized vector pBCXUN. Linearized vector pBCXUN has T sticky ends.

[0103] 5. Connect the PCR amplification product with A sticky ends and the linearized vector pBCXUN by TA cloning method, and transform 5μL of the reaction system into competent E. coli. Screen on LB plates containing 50μg / mL kanamycin. Identify single clones by colony PCR, and select positive clones for sequencing. The recombinant expression vector with correct sequencing was named pBCXUN-ZmPHR1. The universal primers for colony PCR and sequencing are as follows:

[0104] UbiP-seq:ATGAGGAACTTTAATCTGATGCAGT;

[0105] NosR-seq: TTAACTATCTTGCAGTTTGCGC.

[0106] 2. Construction of CRISPR-Cas9 knockout vector for ZmPHR1 gene

[0107] 1. Design of gRNA target sequence

[0108] Based on the CDS sequence of ZmPHR1, guide RNAs (gRNAs) were designed using CRISPR-P, and the final designed gRNA target sequence was as follows: CCAGAGTATACGTCCTGCTATG.

[0109] 2. Preparation of CRISPR-Cas9 knockout vector for ZmPHR1 gene

[0110] The gRNA target sequence of the CRISPR / Cas9 binary vector pBUE411 derived from pCAMBIA3300 in Additional file 2: Methods S1 of the literature “Xing et al. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014, 14: 327.” was replaced with the gRNA target sequence in step 1, and the ZmPHR1 gene CRISPR-Cas9 knockout vector CRISPR-ZmPHR1 was obtained by sequencing verification.

[0111] Example 2: Construction and detection of ZmPHR1 gene overexpression strains and mutant strains

[0112] 1. Construction of transgenic plants

[0113] The pBCXUN-ZmPHR1 and CRISPR-ZmPHR1 plasmids constructed in Example 1 were transformed into competent Agrobacterium EHA105, and positive clones were identified by colony PCR. The correctly identified single Agrobacterium colony was inoculated into 2 mL of liquid culture medium containing 100 μg / mL kanamycin and 50 μg / mL rifampicin, and cultured with shaking at 28°C overnight. The next day, it was transferred to a large amount of liquid culture medium containing antibiotics and cultured with shaking. The cells were collected when they grew to the logarithmic phase and resuspended to OD 600 Between 0.8-1.0, that is, recombinant Agrobacterium suspension. Under sterile conditions, the immature embryos of B73 maize were peeled off and infected with recombinant Agrobacterium suspension to induce maize embryo callus to seedlings. The seeds were harvested by self-pollination to obtain T1 transgenic plants. After self-pollination of transgenic plants, T3 transgenic plants were obtained for subsequent experiments.

[0114] II. Obtaining ZmPHR1 gene overexpression strains and mutant strains

[0115] 1. Construction of ZmPHR1 gene overexpression strain

[0116] RNA was extracted from three transgenic inbred lines (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3) transformed with pBCXUN-ZmPHR1 plasmid and the wild-type maize inbred line B73, and cDNA was reverse transcribed. Quantitative PCR was used to detect the expression of ZmPHR1 gene.

[0117] Test results such as Figure 1 As shown in (a), the results showed that the three strains (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3) were all overexpression strains of the ZmPHR1 gene. The expression level of the ZmPHR1 gene in the transgenic plants was about 10-19 times that of the non-transgenic wild-type control plants, which was much higher than that of the non-transgenic control plants.

[0118] 2. Construction of mutant strains

[0119] DNA was extracted from two mutant inbred lines (zmphr1-1, zmphr1-2) transformed with CRISPR-ZmPHR1 plasmid and the wild-type maize inbred line B73, and PCR amplification and sequencing were performed on the target sites.

[0120] The sequencing results are as follows Figure 1 As shown in (b), the results showed that both mutant lines were maize mutants with homozygous mutations in the ZmPHR1 gene (the same mutation occurred in both chromosomes).

[0121] The difference between the zmphr1-1 mutant strain and the wild-type maize inbred line B73 genome sequence is that the eight bases CAGAGTAT from position 445 to 452 are missing in the gene encoding the ZmPHR1 protein (sequence 2). The difference between the zmphr1-2 mutant strain and the wild-type maize inbred line B73 genome sequence is that a base G is inserted between positions 449 and 450 of the gene encoding the ZmPHR1 protein (sequence 2). The mutation forms of the two mutants both cause frameshift mutations in the mRNA of ZmPHR1 during translation, resulting in loss of protein function.

[0122] Example 3: Drought phenotype detection of ZmPHR1 gene overexpressing maize lines

[0123] Drought treatment experiments were conducted on the T3 generation ZmPHR1 gene overexpression maize lines (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3) constructed in Example 2 and the wild-type maize inbred line B73. The specific method is as follows:

[0124] 1. Seed disinfection and plant growth: Disinfect corn seeds of different test materials with 75% ethanol for 3 minutes, rinse the residual alcohol with pure water, and evenly spread the seeds on the culture dish with the embryo side facing up using tweezers, cover with a layer of absorbent paper, spray an appropriate amount of water to keep the absorbent paper moist, and place in the dark greenhouse for 2-3 days. When the radicle grows to about 1 cm, select the seeds with consistent growth after germination and move them into a soil culture small pot (10 cm in diameter, 10 cm deep) containing about 150g of matrix (mix sieved flower soil, imported nutrient soil and vermiculite in a ratio of 1:1:1 as the matrix for corn culture), 4 seeds per pot, and a tray is provided at the bottom of each pot. The matrix is ​​soaked with water through the bottom, and then placed in the greenhouse under light conditions for continued cultivation. The greenhouse culture conditions are: 27±1℃, photoperiod of 16 hours of light / 8 hours of darkness, and air humidity of about 40%.

[0125] 2. Soil drought treatment: When the seedlings grow to the two-leaf and one-heart stage, keep 3 seedlings with the same growth status, add 1L of water to the tray, pour out the water in the tray after 8 hours, and start drought treatment (continue to cultivate in the 27℃ greenhouse, and no water will be given during the cultivation process). At the same time, normal watering (the normal watering treatment method is as follows: add 1L of water-immersed basin to the tray every 3-4 days, and pour out the water after 8 hours) is used as a control to observe the growth of different test materials under drought treatment, the degree of leaf wilting and other phenotypes. After drought treatment for about one week, the leaf water content of different test materials is measured. The survival rate experiment is about 12 days after the treatment. After the substrate absorbs enough water through bottom infiltration, it is placed in the greenhouse for normal cultivation. After 4-5 days, take photos to count the survival rate. Plant 3-6 pots of different test materials as biological replicates, and place them randomly. Adjust the position of the small pots regularly every day to reduce the influence of position effect.

[0126] The relative water content of the leaves is determined as follows: Take the leaves of the same leaf position of the materials with phenotypic differences, cut them into appropriate sizes with scissors, weigh them and record them as w1. Place the leaves in distilled water and absorb water overnight (at least 12 hours) until the leaves are saturated with water and fully unfolded, wipe off the water on the surface of the leaves, weigh them and record the saturated weight as w2. Put the leaves in an oven at 80°C and dry them to constant weight, weigh them and record the dry weight as w3. Calculate the relative water content (RWC) according to the following formula: RWC = (w1-w3) / (w2-w3)×100%.

[0127] The results showed that after one week of drought treatment, the growth of ZmPHR1 overexpression lines (OE1-OE3) was significantly better than that of wild-type maize plants, and the degree of leaf wilting was significantly lower than that of wild-type maize plants ( Figure 2 ); The leaf water content of ZmPHR1 overexpression lines (OE1-OE3) was significantly higher than that of wild-type corn plants, and the leaf water content of ZmPHR1 overexpression lines was 38%-62% higher than that of wild-type corn plants ( Figure 3 After two weeks of drought treatment, wild-type corn plants basically died, while ZmPHR1 overexpression lines basically survived and maintained a good growth condition ( Figure 4 ). The above results indicate that transgenic maize plants overexpressing ZmPHR1 are more drought resistant than wild-type maize plants.

[0128] Example 4: Measurement of transpiration rate and stomatal conductance of maize lines overexpressing the ZmPHR1 gene

[0129] The transpiration rate and stomatal conductance of the T3 generation ZmPHR1 gene overexpressing corn strains (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3), zmphr1 mutants (zmphr1-1 and zmphr1-2) and wild-type corn inbred line B73 constructed in Example 2 were measured as follows:

[0130] Different test materials were planted in the field and grown to the tasseling stage. The transpiration rate and stomatal conductance were measured in clear and cloudless weather with direct sunlight from 9:00 to 11:00 a.m. The PAR was controlled at 1500 μE·m -2 ·s -1 Wild-type corn, ZmPHR1 gene overexpression corn lines (OE1-OE3) and zmphr1 mutants (zmphr1-1 and zmphr1-2) with consistent growth and size were selected, and the measurement was carried out in the middle position of the ear leaf to avoid the marginal effect affecting the results. The instrument for measuring transpiration rate and stomatal conductance is Yaxin-1102 portable photosynthetic transpiration meter, and the use method is referred to the product manual.

[0131] The results are as follows Figure 5 As shown, the results showed that compared with wild-type corn plants, the leaf transpiration rate and stomatal conductance of the ZmPHR1 overexpressing strain were reduced by 28.57% and 32.21%, respectively. It can be seen that the transpiration rate and stomatal conductance of the ZmPHR1 overexpressing corn plants were significantly lower than those of the wild-type control, indicating that the water loss through transpiration of the ZmPHR1 overexpressing corn plants was significantly slower than that of the wild-type control, which may be one of the reasons for the drought resistance of the ZmPHR1 overexpressing plants.

[0132] Example 5: Measurement of stomatal density and stomatal aperture of ZmPHR1 gene overexpressing maize lines

[0133] The results of Example 4 show that the transpiration water loss of the ZmPHR1 overexpression strain is significantly slower than that of the wild-type control, and stomatal transpiration is the main mode of leaf transpiration. Among them, stomatal movement regulated by ABA is an important way for plants to respond to drought stress. Therefore, the stomatal density and stomatal aperture of the T3 generation of the ZmPHR1 gene overexpression corn strains (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3) constructed in Example 2, zmphr1 mutants (zmphr1-1 and zmphr1-2) and the wild-type corn inbred line B73 were measured, and the specific method is as follows:

[0134] 1. Growth of corn plants: Different test materials were grown in a greenhouse to the V1 stage, and fully expanded mature leaves (the stomata of the leaves were fully developed) were selected for stomatal density and opening experiments. The greenhouse culture conditions were: 27±1°C, a photoperiod of 16 hours of light / 8 hours of darkness, and an air humidity of about 40%.

[0135] 2. Determination of maize stomatal density and stomatal aperture: After 2 hours of greenhouse illumination, maize V1 leaves were taken, the leaf tips and leaf bases were removed, and the middle part of the leaves, about 1 cm in length, was left. The leaves were placed in a stomatal buffer solution (stomatal buffer solution formula: 10 mM KCl, 50 μM CaCl2, 10 mM MES, pH 5.6), with the upper epidermis of the leaves facing upwards, and cultured under illumination for 2 hours (temperature 25°C, light intensity 120 μmol·m -2 ·s -1 ) to fully open the stomata. The cultured leaves were divided into two groups, one group (experimental group) was transferred to the stomatal buffer containing 10μM ABA (stomatal buffer formula: 10mM KCl, 50μM CaCl2, 10mM MES, 10μM ABA, pH5.6), and the other group (control group) was transferred to the stomatal buffer containing 0μM ABA (stomatal buffer formula: 10mM KCl, 50μM CaCl2, 10mM MES, pH5.6). After continuing to culture for 2 hours, they were taken out and the lower epidermis was quickly torn off to prepare the slices. The density and opening state of the stomata were observed under a color CCD optical microscope. At least 4 parallels were set for each treatment, and 12-15 fields of view were randomly selected for each parallel to take pictures. The stomatal aperture was measured using ImageJ software, and the stomatal density and opening degree were statistically analyzed.

[0136] The results of pore density determination are as follows Figure 6 As shown in (a), the results showed that the stomatal density of ZmPHR1 overexpression lines (OE1-OE3) and zmphr1 mutants (zmphr1-1 and zmphr1-2) was not significantly different from that of wild-type maize plants ( Figure 6 a), indicating that ZmPHR1 does not regulate the stomatal development of maize; the results of stomatal aperture determination are as follows Figure 6(b)-(c) show that: in the control treatment without ABA, the stomatal aperture of the ZmPHR1 overexpression lines (OE1-OE3) was significantly lower than that of the wild-type corn plants (reduced by 15.87% compared with the wild-type corn plants); in the 10μM ABA treatment, the stomatal aperture of the ZmPHR1 overexpression lines (OE1-OE3) was further reduced, and the stomatal aperture of the ZmPHR1 overexpression lines was 42.42% lower than that of the wild-type; in the control treatment without ABA, the stomatal aperture of the zmphr1 mutants (zmphr1-1 and zmphr1-2) was not significantly different from that of the wild-type corn plants; in the 10μM ABA treatment, the stomatal aperture of the zmphr1 mutants (zmphr1-1 and zmphr1-2) was significantly larger than that of the wild-type corn plants. The above results indicate that ZmPHR1 can regulate stomatal movement in plant leaves, especially ABA-dependent stomatal movement, which may be one of the important ways for ZmPHR1-overexpressing plants to enhance drought resistance by reducing transpiration water loss.

[0137] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of ZmPHR1 protein in any of the following S1)-S6): S1) Regulates plant drought resistance; S2) regulating the transpiration rate and / or stomatal conductance of plant leaves; S3) regulating the stomatal aperture of plant leaves; S4) regulates the movement of stomatal pores in plant leaves; S5) application in cultivating transgenic plants with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture; S6) Plant genetic breeding or plant germplasm improvement; The ZmPHR1 protein is a1) or a2) or a3) or a4): a1) the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3; a3) a protein related to plant drought resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3; a4) A protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 3, which is derived from corn and is associated with plant drought resistance.

2. Use of biomaterials related to ZmPHR1 protein in any of the following S1)-S6): S1) Regulates plant drought resistance; S2) regulating the transpiration rate and / or stomatal conductance of plant leaves; S3) regulating the stomatal aperture of plant leaves; S4) regulates the movement of stomatal pores in plant leaves; S5) application in cultivating transgenic plants with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture; S6) Plant genetic breeding or plant germplasm improvement; The biological material is any one of the following A1) to A8): A1) a nucleic acid molecule encoding a ZmPHR1 protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); The ZmPHR1 protein is a1) or a2) or a3) or a4): a1) the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3; a3) a protein related to plant drought resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3; a4) A protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 3, which is derived from corn and is associated with plant drought resistance.

3. The use according to claim 2, characterized in that: A1) The nucleic acid molecule is the gene shown in B1) or B2) or B3) below: B1) DNA molecule shown in sequence 1; B2) DNA molecule shown in sequence 2; B3) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in B1) or B2) and encodes the ZmPHR1 protein.

4. Use of a substance that inhibits ZmPHR1 protein in any of the following T1)-T6): T1) Reduce plant drought resistance; T2) increasing the transpiration rate and / or stomatal conductance of plant leaves; T3) Increase the stomatal aperture of plant leaves; T4) Promote the movement of stomatal pores in plant leaves; T5) application in cultivating transgenic plants with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture; T6) Plant genetic breeding or plant germplasm improvement; The ZmPHR1 protein is a1) or a2) or a3) or a4): a1) the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3; a3) a protein related to plant drought resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3; a4) A protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 3, which is derived from corn and is associated with plant drought resistance.

5. A method for cultivating a transgenic plant with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture, comprising the following steps: increasing the content and / or activity of a ZmPHR1 protein in a recipient plant to obtain a transgenic plant; the transgenic plant has higher drought resistance than the recipient plant, and lower transpiration rate and / or stomatal conductance and / or stomatal aperture than the recipient plant; The ZmPHR1 protein is a1) or a2) or a3) or a4): a1) the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3; a3) a protein related to plant drought resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3; a4) A protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 3, which is derived from corn and is associated with plant drought resistance.

6. The method according to claim 5, characterized in that: The method for increasing the content and / or activity of the ZmPHR1 protein in the recipient plant is to overexpress the ZmPHR1 protein in the recipient plant.

7. The method according to claim 6, characterized in that: The overexpression method is to introduce the coding gene of ZmPHR1 protein into the recipient plant.

8. A method for cultivating a transgenic plant with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture, comprising the following steps: reducing the content and / or activity of ZmPHR1 protein in a recipient plant to obtain a transgenic plant; the transgenic plant has lower drought resistance than the recipient plant, and higher transpiration rate and / or stomatal conductance and / or stomatal aperture than the recipient plant; The ZmPHR1 protein is a1) or a2) or a3) or a4): a1) the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3; a3) a protein related to plant drought resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 3; a4) A protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 3, which is derived from corn and is associated with plant drought resistance.

9. The method according to claim 8, characterized in that: The method for reducing the content and / or activity of ZmPHR1 protein in the recipient plant is to introduce a substance that inhibits the activity of ZmPHR1 protein or a substance that inhibits the expression of a gene encoding ZmPHR1 protein or a substance that knocks out a gene encoding ZmPHR1 protein into the recipient plant.

10. The use according to any one of claims 1 to 4 or the method according to any one of claims 5 to 9, characterized in that: The plant is a dicotyledon or a monocotyledon; And / or, the monocotyledonous plant is a grass plant; And / or, the grass plant is corn.

Images